The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046000	Escherichia coli strain 1916D18 chromosome, complete genome	4828364	235334	285736	4828364	transposase	uncultured_Caudovirales_phage(23.08%)	43	NA	NA
WP_085948316.1|235334_236608_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_000100276.1|236767_237769_-	permease	NA	NA	NA	NA	NA
WP_001175589.1|237875_238172_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000065786.1|238305_238731_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.5e-51
WP_000922639.1|238743_240033_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|240086_240440_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_001295215.1|241179_241263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000160808.1|241316_242669_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_000954225.1|242740_243583_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_001295214.1|243785_245828_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
WP_000686627.1|245835_246588_+	16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ	NA	NA	NA	NA	NA
WP_001098652.1|246636_248106_-	dipeptide/tripeptide permease DtpB	NA	NA	NA	NA	NA
WP_000323571.1|248423_248858_-	universal stress protein UspA	NA	NA	NA	NA	NA
WP_000626187.1|249248_249584_+	universal stress protein UspB	NA	NA	NA	NA	NA
WP_000902780.1|249654_251154_-	inorganic phosphate transporter PitA	NA	NA	NA	NA	NA
WP_025653019.1|251384_252587_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000090707.1|252729_253572_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000351437.1|253558_255682_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001049180.1|255681_257130_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001324699.1|257170_258727_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000262423.1|258738_259665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097216.1|260017_260317_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047649489.1|261223_262204_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
WP_154139469.1|262257_263907_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000647571.1|264075_264426_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
WP_000790485.1|264573_265005_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555736.1|265249_266731_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_000697968.1|266723_267404_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000475507.1|267593_268979_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246155.1|269006_269360_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_001381488.1|269473_270766_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_020219104.1|270776_273923_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_000758229.1|274009_274450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001398208.1|274547_277025_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	2.9e-83
WP_000843494.1|277065_277263_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287501.1|277296_278034_-	peptidase	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
WP_001023257.1|278322_278772_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925240.1|279006_280824_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|280823_281720_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_020219105.1|281759_282140_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_000998778.1|282144_283074_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|283128_283809_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_085948178.1|284523_285736_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 2
NZ_CP046000	Escherichia coli strain 1916D18 chromosome, complete genome	4828364	1110943	1122983	4828364	integrase	Escherichia_phage(62.5%)	9	1102066:1102080	1131831:1131845
1102066:1102080	attL	GCTGGCGAAAGCCTT	NA	NA	NA	NA
WP_001278994.1|1110943_1111582_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590385.1|1111578_1112841_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_000847985.1|1112837_1113746_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1113941_1114709_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141325.1|1114759_1115416_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	1.6e-49
WP_001696757.1|1115521_1118089_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.0e-30
WP_000858985.1|1118248_1119709_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PGY7	Moraxella_phage	26.2	5.4e-21
WP_001696754.1|1119705_1120968_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001696753.1|1120964_1122983_+	RNA-directed DNA polymerase	NA	A0A0H4TEY7	Erysipelothrix_phage	25.9	2.0e-29
1131831:1131845	attR	AAGGCTTTCGCCAGC	NA	NA	NA	NA
>prophage 3
NZ_CP046000	Escherichia coli strain 1916D18 chromosome, complete genome	4828364	1719580	1791483	4828364	transposase,tRNA,integrase	Enterobacteria_phage(41.18%)	55	1717219:1717236	1781503:1781520
1717219:1717236	attL	GTAGGCATGATAAGACGC	NA	NA	NA	NA
WP_047649489.1|1719580_1720561_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
WP_000097369.1|1720986_1722702_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000871517.1|1722897_1725195_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001130306.1|1725405_1726323_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_025649220.1|1726329_1727487_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569329.1|1727479_1728406_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1728410_1729142_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1729122_1729230_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1729289_1730021_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1730242_1731928_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001326002.1|1731924_1732644_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1732690_1733161_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001378226.1|1733200_1733662_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	5.4e-76
WP_001326004.1|1733786_1735787_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001292774.1|1735783_1736920_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001294366.1|1736912_1739192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000074859.1|1739202_1740291_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636926.1|1741473_1741794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356790.1|1741854_1745487_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001295427.1|1749431_1751465_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|1751596_1752706_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|1752968_1753250_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|1753542_1754085_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|1754165_1754840_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_085948316.1|1757148_1758421_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_000405707.1|1758687_1759722_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|1759803_1760142_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134569.1|1760360_1761185_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1761305_1761578_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001118621.1|1762991_1763915_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	100.0	8.4e-177
WP_025653401.1|1764370_1765816_+	ATP-binding protein	NA	E5E3R2	Burkholderia_phage	27.6	3.7e-06
WP_025653400.1|1766135_1767155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025653399.1|1767167_1767539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007666098.1|1769560_1769986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025653397.1|1770263_1770452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001011965.1|1771576_1772143_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001058091.1|1773106_1773289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195605.1|1773626_1774415_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|1774411_1775212_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001297420.1|1775276_1776095_+	glycosyl hydrolase 25 family protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000434038.1|1776146_1776893_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011957.1|1776866_1777832_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|1777828_1778833_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858498.1|1778829_1780107_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1780363_1781416_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_025650478.1|1781725_1782580_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
1781503:1781520	attR	GCGTCTTATCATGCCTAC	NA	NA	NA	NA
WP_000853876.1|1782608_1783871_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182914.1|1783880_1784333_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823272.1|1784363_1784648_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1784651_1786007_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844200.1|1786054_1787095_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|1787194_1787974_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1788055_1788955_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000019448.1|1789302_1790283_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_047649489.1|1790502_1791483_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
>prophage 4
NZ_CP046000	Escherichia coli strain 1916D18 chromosome, complete genome	4828364	3004040	3091886	4828364	integrase,protease,tRNA,head,capsid,lysis,tail,portal,terminase,plate	Salmonella_phage(57.63%)	92	2997001:2997016	3094457:3094472
2997001:2997016	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|3004040_3005333_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067740.1|3005423_3006767_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_001295343.1|3006777_3007389_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077064.1|3007543_3011650_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3011784_3012279_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3012823_3013789_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043615.1|3013911_3015678_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202189.1|3015678_3017400_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
WP_001241678.1|3017441_3018146_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3018430_3018649_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3019332_3021609_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3021639_3021960_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3022282_3022507_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|3022579_3024526_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|3024522_3025638_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|3025788_3026745_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599806.1|3026741_3028400_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001297311.1|3028825_3029521_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|3030015_3030915_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|3031058_3032711_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|3032722_3033691_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815351.1|3033823_3035542_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.8e-31
WP_000566372.1|3035578_3036580_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|3036590_3038021_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3038119_3039133_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255144.1|3039129_3039960_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3039956_3040280_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|3040405_3040921_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3041138_3041867_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3041884_3042616_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3042622_3043339_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3043338_3044007_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3044298_3045030_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149732.1|3045204_3046332_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|3046372_3046861_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|3046920_3047766_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093858.1|3047762_3048716_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996018.1|3048725_3049859_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126084.1|3049953_3051066_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3051416_3051893_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3051980_3052883_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_025649937.1|3052943_3053666_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3053649_3053937_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3054096_3054354_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|3054383_3054761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|3055030_3056716_+	transporter	NA	NA	NA	NA	NA
WP_000972391.1|3056951_3057170_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_033551100.1|3057260_3058361_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	1.1e-175
WP_000980413.1|3058357_3058843_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_033551099.1|3058839_3061917_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000763311.1|3061909_3062029_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3062043_3062346_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|3062400_3062916_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_033551098.1|3062925_3064098_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.1e-202
WP_029697337.1|3064249_3064807_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	1.4e-86
WP_077898376.1|3064836_3065346_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	66.1	3.0e-51
WP_154139600.1|3065345_3065948_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.0	7.3e-97
WP_001463953.1|3065919_3066363_-|tail	caudovirales tail fiber assembly family protein	tail	A0A0F7LDZ0	Escherichia_phage	49.7	2.4e-36
WP_089632067.1|3066365_3067868_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.7	4.7e-153
WP_001086836.1|3067864_3068470_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_154139542.1|3068462_3069371_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	5.0e-142
WP_000177590.1|3069357_3069717_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_089588518.1|3069713_3070292_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.6e-93
WP_000829157.1|3070360_3070807_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.9e-62
WP_001039945.1|3070799_3071231_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_154139544.1|3071326_3071755_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	87.9	6.2e-58
WP_001069904.1|3071751_3072267_-	lysozyme	NA	E5G6N1	Salmonella_phage	93.0	7.4e-90
WP_000171568.1|3072247_3072463_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3072466_3072670_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673520.1|3072669_3073134_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000059193.1|3073229_3073880_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	4.3e-111
WP_000742511.1|3073883_3074942_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_001554837.1|3074958_3075792_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.7	5.3e-122
WP_089588519.1|3075934_3077701_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_089588520.1|3077700_3078729_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.5	2.9e-170
WP_089588521.1|3078760_3079444_-	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_089588522.1|3079440_3080544_-	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	26.2	5.0e-19
WP_028985770.1|3081044_3082088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029364119.1|3082084_3083944_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_023486382.1|3084088_3084322_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	8.0e-36
WP_001154431.1|3084332_3084521_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_047649414.1|3084673_3087088_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.1	0.0e+00
WP_000104157.1|3087084_3087942_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
WP_000752613.1|3087938_3088166_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_097494783.1|3088165_3088399_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	1.2e-31
WP_001352070.1|3088466_3088808_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	96.5	4.3e-54
WP_000956182.1|3088771_3088972_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460891.1|3088979_3089489_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_001247707.1|3089521_3089743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047320.1|3089868_3090438_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
WP_001513672.1|3090453_3090645_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_000290937.1|3090833_3091886_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3094457:3094472	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 5
NZ_CP046000	Escherichia coli strain 1916D18 chromosome, complete genome	4828364	3385581	3404840	4828364	transposase,protease,integrase,tail	Escherichia_phage(38.46%)	18	3396105:3396164	3401330:3402636
WP_047649489.1|3385581_3386562_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
WP_000019440.1|3386780_3387761_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_106423173.1|3387795_3388212_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001201857.1|3388725_3389679_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|3389928_3390678_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000239874.1|3391537_3392206_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|3392571_3392685_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3392753_3392987_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|3393303_3393894_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_154139554.1|3393991_3394558_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	8.6e-100
3396105:3396164	attL	ACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACTAAA	NA	NA	NA	NA
WP_085948178.1|3396155_3397368_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000738421.1|3397913_3398207_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_085948316.1|3398621_3399895_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_154139556.1|3399925_3400072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071790554.1|3400115_3400487_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	80.2	3.0e-45
WP_154139558.1|3400342_3401329_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A088CD23	Shigella_phage	86.9	9.0e-169
WP_085948178.1|3401380_3402593_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000019440.1|3403859_3404840_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
3401330:3402636	attR	ACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACTAAAAATACTCGTTTTTCCCCCGAAGTCCGTCAGCGGGCGATTCGTATGGTTCTGGAAAGTCAGGATGAATATGACTCACAGTGGGCGGCAATTTGTTCCATTGCCCCAAAGATTGGCTGTACGCCGGAGACTCTGCGTGTCTGGGTTCGCCAGCATGAGCGGGATACCGGGGGCGGTGATGGTGGGCTCACCAGCGCGGAACGTCAGCGTCTGAAAGAGCTGGAACGTGAAAATCGTGAACTGCGCCGCAGTAACGATATCCTTCGCCAGGCTTCCGCTTATTTTGCGAAGGCGGAGTTCGACCGCCTCTGGAAAAAATGATGCCACTGCTGGATAAGCTGCGTGAGCAGTACGGGGTCGGACCGGTATGCAGCGAACTGCATATTGCCCCGTCAACGTATTACCATTGTCAGCAACAGCGACATCATCCGGATAAACGTAGTGCCCGTGCGCAGCACGACGACTGGCTGAAGAGAGAGATACAGCGCGTATACGATGAAAATCATCAGGTGTACGGTGTGCGTAAAGTCTGGCGTCAGTTGTTACGGGAAGGAATCAGGGTGGCCAGATGTACAGTGGCACGTCTCATGGCGGTTATGGGACTTGCCGGTGTTCTCCGGGGTAAAAAGGTCCGTACGACCATCAGCCGGAAAGCCGTTGCCGCAGGCGACCGCGTAAACCGTCAGTTCGTGGCAGAACGACCTGACCAGCTGTGGGTGGCTGATTTTACTTACGTCAGCACATGGCAGGGCTTCGTCTATGTGGCGTTTATCATTGATGTGTTTGCCGGATACATCGTGGGGTGGCGGGTCTCATCGTCTATGGAAACGACATTCGTGCTGGATGCGCTGGAGCAGGCGTTGTGGGCCCGTCGTCCGTCTGGCACCATCCATCACAGCGATAAAGGCTCTCAGTATGTGTCACTGGCCTATACGGAGCGACTAAAAGAAGCCGGATTACTGGCATCAACAGGGAGTACAGGCGACTCGTATGACAACGCGATGGCTGAGAGCATCAATGGTCTTTACAAAGCGGAGGTAATACACCGTAAGAGCTGGAAAAACCGTGCAGAAGTGGAACTGGCCACACTAACGTGGGTGGACTGGTATAACAATCGACGATTGCTGGGAAGGCTGGGCCATACTCCTCCGGCAGAAGCAGAAAAAGCTTATTATGCTTCCATCGGAAACGATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCA	NA	NA	NA	NA
>prophage 6
NZ_CP046000	Escherichia coli strain 1916D18 chromosome, complete genome	4828364	3646558	3730602	4828364	integrase,protease,head,capsid,transposase,tail,holin,portal,terminase,plate	Shigella_phage(45.31%)	94	3666164:3666180	3728048:3728064
WP_000131044.1|3646558_3648592_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_025649816.1|3648720_3649308_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089092.1|3649321_3650794_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|3650807_3652478_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209105.1|3652690_3653359_+	membrane protein	NA	NA	NA	NA	NA
WP_000370401.1|3653601_3654297_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023907.1|3654289_3655717_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102119.1|3655727_3656447_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_025649824.1|3656973_3657828_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_154139573.1|3658053_3659379_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474077.1|3659487_3659724_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3659735_3660329_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|3660488_3661358_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_000621018.1|3661606_3662464_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092611.1|3662584_3666838_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
3666164:3666180	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_000662258.1|3667953_3668055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803999.1|3668417_3668681_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3668680_3668821_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|3668855_3669083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025649835.1|3669905_3670448_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3670522_3671110_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3671168_3671837_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131077.1|3671862_3674388_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_085948316.1|3675137_3676411_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_001305432.1|3677325_3678036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|3678348_3678678_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3678925_3679540_-	YagU family protein	NA	NA	NA	NA	NA
WP_000643333.1|3680632_3681589_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667026.1|3681585_3683784_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121333.1|3683793_3684750_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|3684728_3685139_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_012602456.1|3685957_3687172_+	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_001288444.1|3687206_3688640_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.1e-106
WP_000355481.1|3689048_3689822_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.9	1.9e-36
WP_021556504.1|3689879_3690434_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.3	1.8e-86
WP_001115559.1|3690463_3690955_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_086259928.1|3690957_3691401_+|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	49.7	2.4e-36
WP_024234210.1|3691372_3691975_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	1.9e-97
WP_089540311.1|3691974_3692736_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	66.1	2.6e-51
WP_000383548.1|3692739_3693324_-	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_032141738.1|3693314_3694373_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.3	2.3e-199
WP_000424732.1|3694359_3694785_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259084.1|3694784_3695333_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_000999511.1|3695332_3696412_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	2.6e-206
WP_000219917.1|3696408_3697737_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.6	3.5e-245
WP_000734912.1|3697847_3698294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032201156.1|3698325_3700158_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.5	3.9e-303
WP_000661047.1|3700299_3700569_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|3700568_3700925_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_047664120.1|3700924_3702421_-|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.6	3.1e-274
WP_000497757.1|3702404_3702575_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_047664123.1|3702583_3703144_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	98.9	5.2e-105
WP_000213502.1|3703140_3703647_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_000702398.1|3703621_3704032_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	100.0	3.1e-75
WP_000927710.1|3704028_3704352_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	100.0	5.1e-57
WP_072808084.1|3704354_3704555_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.3e-26
WP_000257507.1|3704604_3705810_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_001193631.1|3705824_3706475_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466255.1|3706452_3707694_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605606.1|3707693_3707876_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_122985710.1|3707887_3709384_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	99.8	1.5e-300
WP_000929173.1|3709617_3710112_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
WP_001131133.1|3710237_3710588_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	93.1	1.4e-60
WP_053897783.1|3710738_3711074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000613842.1|3711174_3711744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122986267.1|3711765_3712023_-	peptidase	NA	Q8SBD8	Shigella_phage	75.6	3.7e-26
WP_001356320.1|3711907_3712300_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	87.6	9.3e-53
WP_001148538.1|3712283_3712760_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	98.1	2.4e-87
WP_001532222.1|3712763_3713090_-|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	98.1	3.4e-56
WP_000799659.1|3713166_3714219_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.1	6.8e-207
WP_000917730.1|3714369_3714573_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_032252670.1|3714973_3715837_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	41.0	1.4e-40
WP_077908626.1|3715849_3716215_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	6.4e-56
WP_001420253.1|3716230_3717220_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	5.6e-195
WP_032305273.1|3717227_3718025_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	1.5e-150
WP_000767113.1|3718044_3718434_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210152.1|3718430_3718757_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.3e-52
WP_000066917.1|3718753_3719407_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001619134.1|3719406_3719901_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	1.2e-86
WP_154139575.1|3719897_3720839_-	GntR family transcriptional regulator	NA	S5FM81	Shigella_phage	99.4	2.8e-143
WP_001250269.1|3720828_3721008_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_154139602.1|3721183_3721735_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.4	2.9e-100
WP_000205494.1|3721772_3721973_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|3722070_3722697_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000549626.1|3722944_3723151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|3723122_3723557_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000008235.1|3724101_3724638_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242749.1|3724628_3724991_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|3724990_3725296_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_077873866.1|3725211_3725646_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
WP_000051887.1|3725522_3726686_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893255.1|3726890_3728144_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
3728048:3728064	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001285288.1|3728155_3729259_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3729546_3730602_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 7
NZ_CP046000	Escherichia coli strain 1916D18 chromosome, complete genome	4828364	3980791	4088691	4828364	integrase,tRNA,head,capsid,lysis,transposase,tail,portal,terminase	Enterobacteria_phage(42.19%)	106	4076905:4076919	4089869:4089883
WP_001286834.1|3980791_3983608_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	7.9e-77
WP_000767329.1|3983650_3984592_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001295417.1|3984599_3984818_-	DUF2575 domain-containing protein	NA	NA	NA	NA	NA
WP_001274021.1|3984920_3985184_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_025653107.1|3988678_3989296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948316.1|3989326_3990599_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_000062888.1|3991012_3991918_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_000681368.1|3991977_3993144_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
WP_000935262.1|3993672_3993882_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118464.1|3993985_3995116_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|3995204_3997121_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843559.1|3997497_3997902_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102383.1|3997927_3998641_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|3998789_3999356_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|3999390_3999978_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130185.1|4000092_4001046_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001112599.1|4001324_4002755_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000906204.1|4002824_4003601_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_000399648.1|4003792_4004773_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000738721.1|4005032_4005329_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000781063.1|4005542_4006829_-	threonine synthase	NA	NA	NA	NA	NA
WP_000241660.1|4006829_4007762_-	homoserine kinase	NA	NA	NA	NA	NA
WP_001264725.1|4007763_4010226_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_001386572.1|4010306_4010372_-	thr operon leader peptide	NA	NA	NA	NA	NA
WP_001223181.1|4010585_4011272_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|4011671_4011812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4011907_4012624_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920333.1|4012683_4014036_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219606.1|4014093_4015518_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_001188666.1|4015517_4016207_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_000875487.1|4016219_4016693_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|4016903_4017773_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|4017769_4018417_-	phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001297279.1|4018468_4018990_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|4019074_4019401_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409451.1|4019490_4021428_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|4021638_4023306_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|4023612_4024845_-	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_001029698.1|4024865_4026248_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132955.1|4026296_4027265_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124605.1|4027370_4028015_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105887.1|4028042_4029059_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000224877.1|4029514_4030234_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|4030313_4031537_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477808.1|4031588_4032911_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
WP_025651378.1|4033037_4033817_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143246.1|4034074_4035625_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088405.1|4035596_4036460_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563061.1|4036572_4037355_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299799.1|4037351_4038425_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4038546_4038708_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4038834_4039440_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202562.1|4039832_4041419_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_048943363.1|4041638_4041899_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	95.1	3.1e-36
WP_005025120.1|4042258_4043863_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_048943362.1|4044307_4044892_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.3e-103
WP_073546634.1|4044891_4048242_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	39.1	7.3e-13
WP_000090892.1|4051684_4052317_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	98.1	2.7e-94
WP_048943354.1|4052253_4052997_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	1.8e-145
WP_001152502.1|4053002_4053701_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000847345.1|4053700_4054030_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_048943353.1|4054026_4056588_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.3	0.0e+00
WP_000459457.1|4056580_4057015_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001357868.1|4056996_4057419_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	8.2e-71
WP_048943399.1|4057434_4058175_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
WP_000683111.1|4058182_4058578_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_048943351.1|4058574_4059153_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	5.9e-80
WP_000752996.1|4059164_4059518_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_048943350.1|4059529_4059925_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	2.4e-56
WP_048943349.1|4059966_4060992_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	9.0e-188
WP_001338090.1|4061047_4061380_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_048943348.1|4061389_4062709_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	3.8e-231
WP_032358757.1|4062689_4064291_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|4064287_4064494_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027268.1|4064490_4066416_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453611.1|4066390_4066936_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001663509.1|4067324_4067558_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079508.1|4067614_4068025_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|4068376_4068529_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|4068557_4068764_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_122654012.1|4068767_4068959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048943344.1|4068980_4069514_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	5.3e-99
WP_000370550.1|4069619_4069892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001468348.1|4069857_4070202_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	96.4	4.4e-38
WP_000839596.1|4070206_4070422_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|4070489_4071542_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|4071692_4071896_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001047110.1|4072149_4072902_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_001433852.1|4072915_4073905_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.9e-195
WP_001061397.1|4073912_4074710_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	4.4e-150
WP_000767103.1|4074729_4075119_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_000210170.1|4075115_4075442_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001442792.1|4075438_4076092_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
WP_074400546.1|4076091_4076586_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	93.9	1.7e-83
WP_000104941.1|4076582_4077524_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	6.4e-140
4076905:4076919	attL	TCGTACAGGGCAATG	NA	NA	NA	NA
WP_001250269.1|4077513_4077693_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000526668.1|4077868_4078426_-	protein YmfL	NA	S5FXP0	Shigella_phage	94.6	1.7e-95
WP_001191669.1|4078418_4078679_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001020632.1|4078776_4079469_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_000135680.1|4080171_4080534_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081316.1|4080599_4081424_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
WP_000008209.1|4081551_4082088_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	1.6e-100
WP_001242723.1|4082078_4082441_+	phage protein	NA	U5P092	Shigella_phage	95.8	4.4e-65
WP_000206803.1|4082440_4083061_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.3	2.2e-112
WP_048943335.1|4083457_4087285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218277.1|4087467_4088691_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.5	4.0e-235
4089869:4089883	attR	TCGTACAGGGCAATG	NA	NA	NA	NA
>prophage 8
NZ_CP046000	Escherichia coli strain 1916D18 chromosome, complete genome	4828364	4507682	4627393	4828364	integrase,protease,tRNA,plate,tail,portal,terminase	Escherichia_phage(45.0%)	112	4531356:4531379	4611439:4611462
WP_000187022.1|4507682_4508783_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|4508822_4509182_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|4509181_4509832_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|4510162_4511563_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|4511545_4512463_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_000382183.1|4512714_4513998_-	MFS transporter	NA	NA	NA	NA	NA
WP_154139580.1|4514064_4515258_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.7	7.5e-45
WP_001230081.1|4516553_4517927_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001302318.1|4517987_4518764_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|4518771_4519776_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001389399.1|4519929_4521081_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_001005579.1|4521432_4524084_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556278.1|4524266_4526000_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274621.1|4526148_4527000_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323849.1|4526986_4527328_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_154139582.1|4527329_4528208_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184831.1|4528173_4530471_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|4530521_4530842_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_025652848.1|4530856_4531936_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
4531356:4531379	attL	CCGCCCATATCGAACGCCAGCATC	NA	NA	NA	NA
WP_001174083.1|4532244_4534746_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|4534757_4535420_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|4535430_4536534_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647882.1|4536808_4537426_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001341951.1|4537452_4538358_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001297636.1|4538451_4540632_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007523.1|4540960_4541851_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|4542199_4544632_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001297633.1|4544634_4545795_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|4546071_4546389_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797341.1|4546572_4547181_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_097412863.1|4548412_4552510_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.2	2.8e-22
WP_000710769.1|4552669_4552882_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001325632.1|4553084_4555283_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|4555438_4556464_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068834.1|4556555_4557515_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|4557607_4558138_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293343.1|4558147_4559479_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4559545_4560472_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4560564_4561050_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4561134_4561380_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4561804_4562650_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4562672_4564181_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4564315_4565326_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796320.1|4565422_4566169_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323556.1|4566173_4566602_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|4566628_4566928_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155254.1|4567139_4567580_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|4567680_4568280_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|4568387_4569155_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|4569209_4569965_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045689.1|4570071_4571061_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|4571380_4572343_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|4572523_4573426_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000468308.1|4573662_4573881_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001598749.1|4573962_4575126_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	1.4e-205
WP_000978896.1|4575125_4575605_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
WP_001598748.1|4575619_4578067_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	96.9	0.0e+00
WP_000785970.1|4578059_4578179_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|4578211_4578487_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|4578543_4579062_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286698.1|4579074_4580265_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_023993658.1|4580324_4580918_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	3.9e-103
WP_154139607.1|4580948_4581452_+|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	72.6	5.6e-58
WP_154139584.1|4581451_4582045_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
WP_154139586.1|4582016_4582457_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	3.4e-51
WP_154139588.1|4582459_4583644_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	78.4	4.0e-163
WP_001285307.1|4583640_4584252_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.4e-116
WP_001121474.1|4584244_4585153_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_006778006.1|4585157_4585505_-	protein 25-like lysozyme	NA	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_154139609.1|4585754_4586009_+|terminase	terminase	terminase	A0A0F7LCM8	Escherichia_phage	98.7	1.3e-34
WP_001598738.1|4586008_4587043_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	1.9e-201
WP_001161722.1|4587469_4588411_+	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	73.7	2.0e-133
WP_001389947.1|4588493_4588976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119270.1|4589159_4589645_-	ImmA/IrrE family metallo-endopeptidase	NA	Q854W5	Mycobacterium_virus	37.1	6.0e-09
WP_001598736.1|4590782_4593059_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.3	0.0e+00
WP_000027673.1|4593048_4593324_-	hypothetical protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_001113277.1|4593320_4593545_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	6.5e-35
WP_001277898.1|4593547_4593847_-	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557703.1|4593846_4594071_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|4594134_4594635_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|4594804_4595077_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_001598735.1|4595213_4595507_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	99.0	6.1e-49
WP_000985246.1|4595576_4596557_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|4596743_4597244_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|4597393_4598092_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4598088_4599462_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001166063.1|4600390_4601374_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|4601633_4602254_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_000063502.1|4602538_4603573_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001296618.1|4603569_4604508_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000217137.1|4604491_4605328_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000144052.1|4605615_4607085_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_001325794.1|4607081_4608341_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001179764.1|4608582_4609407_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000619503.1|4609416_4609731_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000729595.1|4610043_4610490_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000446026.1|4610500_4611952_+	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
4611439:4611462	attR	GATGCTGGCGTTCGATATGGGCGG	NA	NA	NA	NA
WP_001019461.1|4611941_4613012_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000931336.1|4613011_4614760_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_001317404.1|4614809_4615850_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000753583.1|4616002_4616836_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_011310337.1|4617029_4620080_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000331377.1|4620092_4620995_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000829013.1|4620991_4621627_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027708.1|4621623_4622553_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_001086388.1|4622882_4623125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295676.1|4623343_4623562_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_000356397.1|4624166_4624457_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000897305.1|4624457_4624769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001162704.1|4624997_4625906_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001297068.1|4625969_4626911_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000560983.1|4626955_4627393_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP045998	Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence	59353	1111	52796	59353	integrase,transposase	Escherichia_phage(55.56%)	54	NA	NA
WP_001067855.1|1111_1816_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_124354296.1|2125_5158_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_154139449.1|5097_5808_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	96.7	5.5e-120
WP_148245969.1|5772_6300_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|6299_6884_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|7376_8141_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001323889.1|8477_10055_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_002210513.1|10382_11144_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|11164_12025_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|12161_12866_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_103859199.1|13671_15231_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	24.4	1.5e-16
WP_000844627.1|15958_16201_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_072109431.1|16232_16895_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000804063.1|16973_18173_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|18439_18745_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058657119.1|18772_19987_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_012728215.1|20203_21088_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|21118_22612_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_094309310.1|22950_24108_-	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_094309312.1|24097_25015_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001067858.1|25289_25994_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_065799592.1|26005_26818_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_001206356.1|26949_27741_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_154139451.1|27886_28651_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	36.9	1.3e-26
WP_033545665.1|28541_29246_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_024245155.1|30043_30682_-	resolvase	NA	A0A1V0E035	Clostridioides_phage	27.1	1.9e-07
WP_000864791.1|30967_31588_+	ParA family protein	NA	A2I303	Vibrio_virus	33.8	1.1e-18
WP_000051064.1|31639_31870_+	partitioning protein	NA	NA	NA	NA	NA
WP_015060510.1|31885_32179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154139453.1|32225_33149_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	5.4e-176
WP_031942371.1|33208_33631_-	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
WP_001074386.1|33698_34145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001050931.1|34184_35021_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000121743.1|36276_36528_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000220560.1|36517_36799_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	3.8e-24
WP_001181903.1|36944_37268_+	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	46.1	9.2e-14
WP_000356546.1|37312_37558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001180116.1|37547_37763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866648.1|37855_38185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000160399.1|38633_38906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038976855.1|39232_39778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000538023.1|39780_40938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000872475.1|41298_41790_+	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000953539.1|42014_42659_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000921916.1|42642_42933_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_000108725.1|42956_45716_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_000737859.1|45717_46455_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_001228869.1|46464_46725_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_000235774.1|46736_47792_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000394570.1|47981_48704_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_025755764.1|48709_49639_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_025755765.1|49635_50850_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_154139455.1|50867_51578_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_085948178.1|51583_52796_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 1
NZ_CP045999	Escherichia coli strain 1916D18 plasmid p1916D18-2, complete sequence	78498	0	7560	78498		Xanthomonas_phage(100.0%)	2	NA	NA
WP_063073481.1|1523_6794_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_063073482.1|6813_7560_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	3.3e-06
>prophage 2
NZ_CP045999	Escherichia coli strain 1916D18 plasmid p1916D18-2, complete sequence	78498	17887	38467	78498	transposase	Salmonella_phage(37.5%)	11	NA	NA
WP_154139459.1|17887_20854_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	99.9	0.0e+00
WP_001161490.1|20857_21418_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001513488.1|21727_23305_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_062894229.1|23549_23834_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_063073486.1|23833_24109_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_096320939.1|25392_26666_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	4.4e-168
WP_033804283.1|27174_28311_+	porin	NA	Q1MVN1	Enterobacteria_phage	56.6	8.3e-118
WP_000401034.1|28406_30104_+	sulfatase-like hydrolase/transferase	NA	A0A1V0SA98	Catovirus	23.2	2.0e-06
WP_001032733.1|30172_30430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099145072.1|31528_32691_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_063073396.1|34390_38467_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	43.1	4.3e-265
>prophage 3
NZ_CP045999	Escherichia coli strain 1916D18 plasmid p1916D18-2, complete sequence	78498	41757	53687	78498	integrase,transposase	Escherichia_phage(66.67%)	6	26381:26395	46523:46537
26381:26395	attL	TAATCTGCTTCATGG	NA	NA	NA	NA
WP_020219156.1|41757_42564_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.5	1.1e-55
WP_085948178.1|42638_43851_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_074440817.1|44095_44791_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.0	1.5e-117
WP_000019440.1|46176_47157_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
46523:46537	attR	CCATGAAGCAGATTA	NA	NA	NA	NA
WP_085948178.1|49113_50326_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_085947917.1|52414_53687_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 4
NZ_CP045999	Escherichia coli strain 1916D18 plasmid p1916D18-2, complete sequence	78498	57264	62685	78498	transposase	Macacine_betaherpesvirus(33.33%)	4	NA	NA
WP_001066942.1|57264_58005_+	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361612.1|58289_59267_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_089533208.1|60441_61083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019440.1|61704_62685_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
>prophage 5
NZ_CP045999	Escherichia coli strain 1916D18 plasmid p1916D18-2, complete sequence	78498	69708	76317	78498	integrase,transposase	Escherichia_phage(50.0%)	9	69250:69262	73687:73699
69250:69262	attL	AAAGTCCGGGTCA	NA	NA	NA	NA
WP_154139461.1|69708_70413_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.7	6.4e-137
WP_001707302.1|70478_70910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016494.1|70906_71698_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	9.4e-52
WP_050858693.1|71849_72125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633913.1|72118_72763_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_001103690.1|72991_73963_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
73687:73699	attR	TGACCCGGACTTT	NA	NA	NA	NA
WP_063073471.1|73967_74360_+	plasmid stability protein	NA	NA	NA	NA	NA
WP_000109071.1|75634_76072_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_001775014.1|76068_76317_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	49.3	6.4e-15
