The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043667	Salmonella enterica subsp. enterica serovar Kentucky strain 162835 chromosome, complete genome	4851336	109333	127269	4851336	integrase	Morganella_phage(35.71%)	22	102789:102802	131640:131653
102789:102802	attL	CGCGACGCGCGGCG	NA	NA	NA	NA
WP_000230718.1|109333_109777_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	4.8e-45
WP_000204054.1|109793_110171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072645.1|110174_110657_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	43.9	1.5e-28
WP_000560496.1|111569_111959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001029844.1|111977_114083_-	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	37.1	7.2e-91
WP_001555748.1|114082_115504_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	53.0	3.7e-123
WP_000909176.1|115503_116181_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
WP_000420674.1|116174_116636_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_001555747.1|117398_120155_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.0	3.4e-298
WP_001208878.1|120141_120513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628967.1|120505_120847_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001058740.1|120857_121460_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.6e-25
WP_000181940.1|121452_121674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024679.1|121670_121934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065741.1|121930_122125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069914140.1|122117_123185_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	37.2	7.5e-12
WP_000476150.1|123178_123361_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001594599.1|123353_124187_-	hypothetical protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000412543.1|124199_124631_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	3.9e-28
WP_001090781.1|124630_124834_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001555743.1|124948_125914_-	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	51.2	3.0e-07
WP_021538781.1|126009_127269_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	77.9	5.1e-193
131640:131653	attR	CGCGACGCGCGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP043667	Salmonella enterica subsp. enterica serovar Kentucky strain 162835 chromosome, complete genome	4851336	474223	511522	4851336	protease,tRNA,head,portal,tail,terminase,integrase,capsid	uncultured_Caudovirales_phage(63.16%)	39	496238:496260	512050:512072
WP_001285165.1|474223_475171_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
WP_000114987.1|475186_475696_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_000124529.1|475827_476952_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000460663.1|476923_477397_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_001129708.1|477423_477966_+	DNA topoisomerase	NA	NA	NA	NA	NA
WP_001650846.1|477970_478543_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.3	9.9e-11
WP_000451202.1|478547_479366_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001070576.1|479362_479620_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_001285635.1|479595_480150_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_000795911.1|480263_480416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000825645.1|486807_487029_-	membrane protein	NA	NA	NA	NA	NA
WP_001273283.1|487265_490379_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_000160383.1|490390_491548_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001085721.1|491961_492624_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
WP_023224481.1|492626_494726_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	33.9	8.4e-23
WP_000620015.1|494876_495041_-	DUF2556 family protein	NA	NA	NA	NA	NA
WP_000642611.1|495123_496008_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	1.3e-25
496238:496260	attL	CTGTATAAACATTTGTATAAACA	NA	NA	NA	NA
WP_023309431.1|496281_497508_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.4e-150
WP_023309430.1|497599_498406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|498510_498795_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|498805_499585_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_024194847.1|499708_499903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157263200.1|500087_500306_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_001549752.1|500298_500487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161397193.1|500563_500692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040194363.1|500790_501159_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	5.7e-52
WP_001549749.1|501155_501521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058654948.1|501520_503650_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.4	7.1e-187
WP_023309421.1|503995_504331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058654945.1|504377_504890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058654942.1|505152_506319_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	1.7e-206
WP_049007540.1|506370_506931_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.2	2.1e-98
WP_058654941.1|506932_508174_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.3	3.2e-232
WP_058654940.1|508170_508506_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|508502_508802_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_058654938.1|508801_509245_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	92.5	1.1e-78
WP_161397194.1|509237_509390_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	74.0	1.6e-13
WP_000113647.1|509520_509877_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_058654936.1|509860_511522_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.4	0.0e+00
512050:512072	attR	CTGTATAAACATTTGTATAAACA	NA	NA	NA	NA
>prophage 3
NZ_CP043667	Salmonella enterica subsp. enterica serovar Kentucky strain 162835 chromosome, complete genome	4851336	679393	716333	4851336	portal,head,tail,terminase,holin,integrase,capsid	Cronobacter_phage(73.53%)	43	682160:682175	724545:724560
WP_023195103.1|679393_680962_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	1.7e-12
WP_086011941.1|680958_681606_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023223848.1|681837_682605_+	siderophore-interacting protein	NA	NA	NA	NA	NA
682160:682175	attL	ATGGCGGCGTAGCCAG	NA	NA	NA	NA
WP_057521324.1|682844_683633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057521323.1|683629_684652_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.7	5.5e-121
WP_021293714.1|684655_685222_-	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.2	7.5e-19
WP_058654818.1|685238_685820_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	38.8	3.7e-29
WP_001247711.1|685963_686185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|686215_686719_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|686728_686956_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996837.1|686945_687371_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|687370_687772_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000057334.1|687839_688070_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_058654816.1|688060_688921_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.7	1.3e-131
WP_058654813.1|688917_690945_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	73.2	1.8e-293
WP_001748628.1|691064_691271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|691244_691568_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038208.1|691564_692626_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	2.3e-162
WP_023199748.1|692622_694398_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.3	2.6e-291
WP_058654812.1|694558_695362_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	55.7	4.5e-78
WP_000550496.1|695423_696446_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218537.1|696449_697151_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000447487.1|697211_697700_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_000084221.1|697696_698203_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.5e-63
WP_000560083.1|698199_698907_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.9	6.8e-102
WP_058654810.1|698903_700031_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	3.3e-175
WP_000166743.1|700027_700483_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|700492_700786_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|700782_701124_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376375.1|701123_701456_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	71.8	6.7e-36
WP_057521313.1|701602_701860_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	2.8e-21
WP_057521312.1|702047_704015_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	4.6e-273
WP_001002797.1|704011_704341_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_057521311.1|704337_705522_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	3.9e-179
WP_057521310.1|705514_706102_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	2.9e-90
WP_058654808.1|706110_708351_+|tail	phage tail protein	tail	A0A192Y7M1	Salmonella_phage	82.7	6.5e-207
WP_094198672.1|708320_708926_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	94.1	4.4e-102
WP_057521330.1|708915_709641_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.0	6.6e-68
WP_058654804.1|709612_710158_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	4.2e-59
WP_024143413.1|710160_711861_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	5.8e-224
WP_000340945.1|713229_713532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|713855_714362_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|714485_716333_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
724545:724560	attR	CTGGCTACGCCGCCAT	NA	NA	NA	NA
>prophage 4
NZ_CP043667	Salmonella enterica subsp. enterica serovar Kentucky strain 162835 chromosome, complete genome	4851336	1481558	1524916	4851336	coat,protease,portal,tail,terminase,holin,lysis,integrase	Salmonella_phage(66.67%)	64	1482654:1482668	1523825:1523839
WP_023203533.1|1481558_1482497_+|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
1482654:1482668	attL	TGGTGTCCCCTGCAG	NA	NA	NA	NA
WP_001749406.1|1482758_1482962_-	hypothetical protein	NA	I6RSG8	Salmonella_phage	100.0	5.5e-33
WP_023138683.1|1483058_1483433_-	hypothetical protein	NA	A0A1V0E5M6	Salmonella_phage	100.0	2.0e-65
WP_000509169.1|1483675_1483942_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	97.7	3.7e-45
WP_058654768.1|1484018_1484732_-	hypothetical protein	NA	A0A220NQU1	Salmonella_phage	66.4	4.8e-39
WP_025711796.1|1484735_1484954_-	DUF4014 family protein	NA	B9UDM3	Salmonella_phage	100.0	2.4e-34
WP_058654766.1|1485336_1485714_-	hypothetical protein	NA	I6R9B7	Salmonella_phage	96.0	1.8e-61
WP_001214770.1|1485710_1485881_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
WP_058654763.1|1485891_1486185_-	DUF2856 family protein	NA	A0A1V0E5L7	Salmonella_phage	94.8	1.5e-47
WP_001253480.1|1486231_1486516_-	anti-RecBCD protein 1	NA	Q76H41	Enterobacteria_phage	96.8	5.7e-44
WP_058344790.1|1486515_1487223_-	recombinase	NA	A0A2H4FN95	Salmonella_phage	96.2	1.9e-133
WP_000361564.1|1487416_1487530_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_001199099.1|1487522_1487663_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	84.8	2.6e-18
WP_154122955.1|1487862_1488684_-	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	90.4	1.8e-77
WP_058654756.1|1488872_1489367_+	hypothetical protein	NA	K7PK22	Enterobacteria_phage	62.8	4.3e-55
WP_058654755.1|1489367_1489730_-	hypothetical protein	NA	C6ZR44	Salmonella_phage	90.8	7.1e-55
WP_058654753.1|1490097_1490301_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	98.5	1.0e-26
WP_020899481.1|1490336_1491260_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	99.7	4.3e-181
WP_024142240.1|1491344_1492052_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	81.7	1.2e-106
WP_024142239.1|1492162_1492387_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	89.0	6.8e-32
WP_023229430.1|1492517_1492811_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	92.8	1.0e-40
WP_058654751.1|1492991_1493840_+	replication protein	NA	C6ZR51	Salmonella_phage	95.7	1.7e-152
WP_058654749.1|1493950_1495831_+	DNA replication protein	NA	A0A0M4R313	Salmonella_phage	99.5	0.0e+00
WP_001064628.1|1495831_1496110_+	hypothetical protein	NA	C6ZR54	Salmonella_phage	100.0	5.2e-50
WP_000796285.1|1496182_1496509_+	hypothetical protein	NA	Q716D0	Shigella_phage	99.1	4.2e-59
WP_000049638.1|1496505_1496706_+	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
WP_001552357.1|1496717_1497047_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	67.7	4.6e-37
WP_058654746.1|1497003_1497450_+	recombination protein NinB	NA	I6R0N7	Salmonella_phage	96.6	7.8e-80
WP_043856233.1|1497446_1497623_+	NinE family protein	NA	I6RSI9	Salmonella_phage	98.3	1.5e-26
WP_023217803.1|1497619_1497799_+	hypothetical protein	NA	I6R994	Salmonella_phage	96.6	3.6e-28
WP_058654774.1|1497773_1498382_+	protein ninG	NA	I6S604	Salmonella_phage	98.0	5.6e-97
WP_000036319.1|1498378_1498603_+	hypothetical protein	NA	I6R0N9	Salmonella_phage	98.6	1.8e-37
WP_000149880.1|1498599_1498803_+	protein ninH	NA	A0A1V0E5I5	Salmonella_phage	100.0	5.5e-33
WP_001650242.1|1498783_1498963_+	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	96.6	7.8e-23
WP_058654744.1|1498959_1499478_+	DUF1133 family protein	NA	A0A1R3Y5U9	Salmonella_virus	95.9	8.8e-91
WP_023135295.1|1499942_1500146_+|holin	holin	holin	I6R0S9	Salmonella_phage	98.5	1.5e-33
WP_023205065.1|1500123_1500621_+	lysozyme RrrD	NA	I6R0P2	Salmonella_phage	98.8	2.4e-90
WP_058654742.1|1500709_1501177_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	91.0	3.4e-70
WP_016048832.1|1501389_1502076_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	100.0	1.6e-124
WP_000808100.1|1502436_1502679_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_015995317.1|1502681_1503086_+	hypothetical protein	NA	C6ZR73	Salmonella_phage	100.0	3.1e-67
WP_000729924.1|1503089_1503578_+	hypothetical protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
WP_058654739.1|1503555_1505055_+|terminase	terminase	terminase	A0A1R3Y5N2	Salmonella_virus	99.8	4.8e-307
WP_058654737.1|1505054_1507232_+|portal	portal protein	portal	A0A075B8I1	Enterobacteria_phage	99.0	0.0e+00
WP_052940620.1|1507245_1508157_+	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	2.4e-160
WP_052909388.1|1508156_1509452_+|coat	coat protein	coat	A0A0M5M1J5	Salmonella_phage	99.8	2.2e-244
WP_000538672.1|1509492_1510053_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	100.0	1.7e-103
WP_001166097.1|1510036_1510537_+	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	98.2	8.7e-88
WP_001750868.1|1510496_1511915_+	DNA stabilization protein	NA	B9UDK6	Salmonella_phage	97.5	2.1e-272
WP_000774920.1|1511918_1512620_+	hypothetical protein	NA	I6S5X0	Salmonella_phage	99.6	2.5e-72
WP_000627703.1|1512619_1513075_+	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_004015040.1|1513077_1513770_+	hypothetical protein	NA	A0A2H4FUQ9	Salmonella_phage	98.3	8.4e-89
WP_033555246.1|1513780_1515130_+	phage DNA ejection protein	NA	A0A0M5M1J8	Salmonella_phage	70.2	9.1e-172
WP_058654735.1|1515114_1517271_+	hypothetical protein	NA	A0A0A0P1R1	Enterobacteria_phage	29.6	3.7e-50
WP_162007603.1|1517328_1517751_-	hypothetical protein	NA	A0A075B8F4	Enterobacteria_phage	64.3	3.3e-35
WP_058654733.1|1518194_1518380_+	hypothetical protein	NA	I6RSG3	Salmonella_phage	98.4	3.3e-08
WP_000820796.1|1518389_1518707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058654731.1|1518703_1518952_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	51.5	2.0e-08
WP_000410001.1|1519066_1519219_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_058654729.1|1519215_1519485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058654728.1|1519548_1520472_+	antirepressor	NA	A5VW58	Enterobacteria_phage	93.2	1.0e-166
WP_058654725.1|1520572_1522429_+|tail	phage tail protein	tail	I6S5Y0	Salmonella_phage	99.0	0.0e+00
WP_001749026.1|1522491_1523661_-|integrase	tyrosine-type recombinase/integrase	integrase	I6R0M2	Salmonella_phage	100.0	3.7e-230
WP_000377779.1|1523974_1524916_-	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
1523825:1523839	attR	TGGTGTCCCCTGCAG	NA	NA	NA	NA
>prophage 5
NZ_CP043667	Salmonella enterica subsp. enterica serovar Kentucky strain 162835 chromosome, complete genome	4851336	1765359	1774530	4851336	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_023224579.1|1765359_1766307_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.0	6.2e-10
WP_000824854.1|1766290_1767022_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1767002_1767110_-	protein YohO	NA	NA	NA	NA	NA
WP_023224580.1|1767169_1767901_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	5.9e-101
WP_000272850.1|1768123_1769809_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1769805_1770525_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1770571_1771039_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_023224581.1|1771095_1771626_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1771797_1772256_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195330.1|1772496_1774530_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
NZ_CP043667	Salmonella enterica subsp. enterica serovar Kentucky strain 162835 chromosome, complete genome	4851336	1848725	1859232	4851336		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023224545.1|1848725_1850129_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1850306_1851200_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1851576_1852662_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023659.1|1852661_1853561_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_023224546.1|1853608_1854487_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	3.0e-107
WP_000973713.1|1854487_1855039_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	7.7e-53
WP_000018224.1|1855044_1856019_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_052939425.1|1856034_1856808_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1856812_1857892_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126351.1|1857918_1859232_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
>prophage 7
NZ_CP043667	Salmonella enterica subsp. enterica serovar Kentucky strain 162835 chromosome, complete genome	4851336	1968678	1975912	4851336		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1968678_1969098_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023224669.1|1969100_1970369_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.4	1.1e-227
WP_000208509.1|1970823_1971036_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1971046_1971235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052939410.1|1971493_1972672_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.0	1.1e-109
WP_000107435.1|1973321_1973633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023224667.1|1973712_1974408_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.1e-07
WP_001157305.1|1974481_1975912_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
NZ_CP043667	Salmonella enterica subsp. enterica serovar Kentucky strain 162835 chromosome, complete genome	4851336	4407357	4454433	4851336	tail,tRNA,plate	Burkholderia_phage(40.91%)	49	NA	NA
WP_001182233.1|4407357_4408356_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039335.1|4408443_4409754_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4410000_4410516_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4410615_4410825_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4410846_4410960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128102.1|4410956_4412282_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4412460_4413069_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4413177_4413546_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4413716_4416137_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4416235_4417108_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|4417121_4417619_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4417799_4418717_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973642.1|4418880_4420239_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4420326_4421436_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_001651229.1|4421797_4422988_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382565.1|4423119_4424664_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4424678_4425569_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4425734_4426145_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_023224741.1|4426287_4428384_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_023216234.1|4428383_4429121_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4429117_4429786_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4429819_4430062_-	outer membrane protein	NA	NA	NA	NA	NA
WP_023224740.1|4430505_4432155_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4432499_4433849_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4433979_4434327_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4434903_4435191_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_023224739.1|4435193_4435799_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	4.2e-60
WP_000777267.1|4435811_4436126_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	8.3e-20
WP_000449440.1|4436284_4436740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875313.1|4436736_4436934_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	5.1e-07
WP_000729853.1|4436923_4438351_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.4e-194
WP_023224738.1|4438350_4438875_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	9.5e-69
WP_001003638.1|4438926_4439244_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_023224737.1|4439203_4439332_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_052939511.1|4439428_4441783_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	2.1e-67
WP_052939512.1|4441782_4442736_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4442735_4442945_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023224735.1|4442932_4443976_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	5.5e-76
WP_000679393.1|4443985_4444708_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593184.1|4445035_4445398_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_023137582.1|4445394_4446324_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_023138094.1|4446334_4447882_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
WP_001093501.1|4448045_4448405_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_023224732.1|4448395_4449511_+	hypothetical protein	NA	Q6QI99	Burkholderia_phage	51.2	5.0e-99
WP_000359504.1|4449503_4450136_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_023224731.1|4450138_4451908_+|tail	phage tail fiber protein H	tail	A0A0M3ULF6	Salmonella_phage	52.7	4.2e-52
WP_023203256.1|4451912_4452518_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_023203255.1|4452514_4452970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587738.1|4453704_4454433_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
