The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043664	Salmonella enterica subsp. enterica serovar Kentucky strain 161365 chromosome, complete genome	4889798	471071	508369	4889798	integrase,protease,tRNA,tail,terminase,portal,head,capsid	uncultured_Caudovirales_phage(66.67%)	38	493085:493107	508897:508919
WP_001285165.1|471071_472019_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
WP_000114987.1|472034_472544_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_000124529.1|472675_473800_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000460663.1|473771_474245_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_001129708.1|474271_474814_+	DNA topoisomerase	NA	NA	NA	NA	NA
WP_001650846.1|474818_475391_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.3	9.9e-11
WP_000451202.1|475395_476214_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001070576.1|476210_476468_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_001285635.1|476443_476998_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_000795911.1|477111_477264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000825645.1|483654_483876_-	membrane protein	NA	NA	NA	NA	NA
WP_001273283.1|484112_487226_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_000160383.1|487237_488395_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001085721.1|488808_489471_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
WP_023224481.1|489473_491573_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	33.9	8.4e-23
WP_000620015.1|491723_491888_-	DUF2556 family protein	NA	NA	NA	NA	NA
WP_000642611.1|491970_492855_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	1.3e-25
493085:493107	attL	CTGTATAAACATTTGTATAAACA	NA	NA	NA	NA
WP_023309431.1|493128_494355_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.4e-150
WP_023309430.1|494446_495253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|495357_495642_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|495652_496432_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_024194847.1|496555_496750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157263200.1|496934_497153_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_001549752.1|497145_497334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161397193.1|497410_497539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040194363.1|497637_498006_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	5.7e-52
WP_001549749.1|498002_498368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023309421.1|500842_501178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058654945.1|501224_501737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058654942.1|501999_503166_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	1.7e-206
WP_049007540.1|503217_503778_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.2	2.1e-98
WP_058654941.1|503779_505021_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.3	3.2e-232
WP_058654940.1|505017_505353_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|505349_505649_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_058654938.1|505648_506092_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	92.5	1.1e-78
WP_161397194.1|506084_506237_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	74.0	1.6e-13
WP_000113647.1|506367_506724_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_058654936.1|506707_508369_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.4	0.0e+00
508897:508919	attR	CTGTATAAACATTTGTATAAACA	NA	NA	NA	NA
>prophage 2
NZ_CP043664	Salmonella enterica subsp. enterica serovar Kentucky strain 161365 chromosome, complete genome	4889798	676240	713180	4889798	integrase,tail,terminase,portal,head,capsid,holin	Cronobacter_phage(73.53%)	43	679007:679022	721392:721407
WP_023195103.1|676240_677809_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	1.7e-12
WP_086011941.1|677805_678453_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023223848.1|678684_679452_+	siderophore-interacting protein	NA	NA	NA	NA	NA
679007:679022	attL	ATGGCGGCGTAGCCAG	NA	NA	NA	NA
WP_057521324.1|679691_680480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057521323.1|680476_681499_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.7	5.5e-121
WP_021293714.1|681502_682069_-	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.2	7.5e-19
WP_058654818.1|682085_682667_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	38.8	3.7e-29
WP_001247711.1|682810_683032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|683062_683566_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|683575_683803_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996837.1|683792_684218_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|684217_684619_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000057334.1|684686_684917_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_058654816.1|684907_685768_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.7	1.3e-131
WP_058654813.1|685764_687792_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	73.2	1.8e-293
WP_001748628.1|687911_688118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|688091_688415_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038208.1|688411_689473_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	2.3e-162
WP_023199748.1|689469_691245_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.3	2.6e-291
WP_058654812.1|691405_692209_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	55.7	4.5e-78
WP_000550496.1|692270_693293_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218537.1|693296_693998_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000447487.1|694058_694547_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_000084221.1|694543_695050_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.5e-63
WP_000560083.1|695046_695754_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.9	6.8e-102
WP_058654810.1|695750_696878_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	3.3e-175
WP_000166743.1|696874_697330_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|697339_697633_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|697629_697971_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376375.1|697970_698303_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	71.8	6.7e-36
WP_057521313.1|698449_698707_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	2.8e-21
WP_057521312.1|698894_700862_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	4.6e-273
WP_001002797.1|700858_701188_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_057521311.1|701184_702369_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	3.9e-179
WP_057521310.1|702361_702949_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	2.9e-90
WP_058654808.1|702957_705198_+|tail	phage tail protein	tail	A0A192Y7M1	Salmonella_phage	82.7	6.5e-207
WP_094198672.1|705167_705773_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	94.1	4.4e-102
WP_057521330.1|705762_706488_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.0	6.6e-68
WP_058654804.1|706459_707005_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	4.2e-59
WP_024143413.1|707007_708708_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	5.8e-224
WP_000340945.1|710076_710379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|710702_711209_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|711332_713180_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
721392:721407	attR	CTGGCTACGCCGCCAT	NA	NA	NA	NA
>prophage 3
NZ_CP043664	Salmonella enterica subsp. enterica serovar Kentucky strain 161365 chromosome, complete genome	4889798	1187234	1287692	4889798	protease,transposase,tRNA,tail,terminase,portal,holin	Enterobacteria_phage(27.27%)	92	NA	NA
WP_094300857.1|1187234_1188402_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	88.5	1.3e-163
WP_052939544.1|1188337_1188943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000718637.1|1189069_1189909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537359.1|1189949_1191125_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.4	1.4e-147
WP_001061331.1|1191330_1191900_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	81.3	3.7e-90
WP_000210516.1|1191901_1192342_-	hypothetical protein	NA	A0A088CE95	Shigella_phage	40.3	3.1e-12
WP_000840609.1|1192345_1192819_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.1	1.1e-66
WP_000125081.1|1192818_1193133_-	hypothetical protein	NA	I6RSM9	Salmonella_phage	85.0	3.4e-21
WP_000120457.1|1193293_1193833_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	81.0	9.5e-80
WP_001670089.1|1194277_1194925_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.4	3.2e-74
WP_000278289.1|1195029_1195233_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	67.8	2.1e-16
WP_000526197.1|1195255_1195807_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	67.2	6.7e-65
WP_024135506.1|1195979_1196159_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	2.3e-14
WP_023224275.1|1196148_1197006_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	87.9	6.3e-70
WP_000174330.1|1197002_1197884_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	78.0	7.6e-135
WP_001206910.1|1197876_1199811_+	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	53.8	3.9e-200
WP_000780154.1|1199807_1200206_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	90.2	4.7e-60
WP_077906859.1|1200379_1201177_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	46.1	9.4e-60
WP_001670090.1|1201173_1202163_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	71.0	7.7e-144
WP_000609697.1|1202177_1202747_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	54.4	1.5e-46
WP_000417508.1|1202937_1203513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001670091.1|1203699_1204140_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	9.6e-14
WP_001283171.1|1204301_1204688_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	93.0	1.0e-56
WP_000250463.1|1204674_1204956_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	50.0	3.1e-18
WP_001076629.1|1204955_1205570_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	80.9	1.9e-92
WP_000522146.1|1205577_1205847_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	69.0	2.2e-21
WP_001100261.1|1205987_1206218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000120194.1|1206309_1206624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761930.1|1207133_1207460_+	hypothetical protein	NA	M9NZE9	Enterobacteria_phage	80.0	2.9e-07
WP_001670093.1|1207643_1208132_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	90.7	6.3e-75
WP_001118990.1|1208131_1210234_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	86.6	0.0e+00
WP_001082414.1|1210230_1210446_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	82.9	1.5e-25
WP_000054308.1|1210442_1211951_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	86.7	4.2e-258
WP_001125851.1|1211895_1213920_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.7	0.0e+00
WP_001097009.1|1214011_1214338_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	60.2	2.4e-30
WP_000933904.1|1214330_1214606_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	61.5	2.6e-25
WP_000023109.1|1214618_1215173_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	76.7	2.4e-62
WP_000797819.1|1215169_1215568_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	62.0	6.8e-43
WP_000211139.1|1215575_1216313_+|tail	tail protein	tail	O64327	Escherichia_phage	66.9	3.6e-90
WP_000479023.1|1216349_1216757_+|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	57.9	3.8e-25
WP_071529728.1|1216765_1217086_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	69.8	2.1e-34
WP_000079422.1|1217063_1219580_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	69.2	1.0e-309
WP_000963482.1|1219583_1219931_+	hypothetical protein	NA	K7PJT2	Enterobacteria_phage	69.6	1.0e-39
WP_023224278.1|1219927_1220683_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	85.3	8.2e-130
WP_001249174.1|1220684_1221395_+	peptidase P60	NA	K7P6F5	Enterobacteria_phage	90.7	1.1e-136
WP_000709674.1|1221424_1221766_+	hypothetical protein	NA	K7PLP0	Enterobacteria_phage	92.9	5.6e-54
WP_000659016.1|1221809_1222415_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	97.0	1.4e-100
WP_001162257.1|1222468_1225672_+	host specificity protein J	NA	O64335	Escherichia_phage	88.7	0.0e+00
WP_001113924.1|1225673_1226633_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	94.4	2.1e-175
WP_001272641.1|1226643_1227825_+	hypothetical protein	NA	S4TSP4	Salmonella_phage	68.9	1.2e-55
WP_000497432.1|1228048_1228291_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	3.4e-29
WP_023224279.1|1228611_1229001_+	DNA polymerase V subunit	NA	Q1MVE7	Enterobacteria_phage	72.1	1.0e-51
WP_001670096.1|1229188_1230394_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_072106078.1|1231122_1232286_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_052939543.1|1232293_1234474_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_023224284.1|1234470_1235880_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_058654786.1|1235944_1247410_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1248029_1248512_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1248661_1249138_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1249127_1249418_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1249578_1249917_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1250065_1251727_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1251812_1252691_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1252814_1253405_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001727770.1|1253439_1254045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1254165_1255452_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1255471_1256263_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1256428_1257790_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1258042_1258291_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1258309_1258858_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469813.1|1258902_1259670_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1259710_1260058_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1260214_1261435_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212379.1|1261427_1261946_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1262385_1263456_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023224291.1|1263465_1264587_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_052939541.1|1264644_1265553_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200080.1|1265513_1266674_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1266773_1266821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1266924_1267263_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197660.1|1267534_1268272_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_023138905.1|1268403_1269384_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992639.1|1269380_1270112_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_023200636.1|1270241_1272815_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.0e-127
WP_000985658.1|1278869_1279325_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	8.6e-34
WP_023224293.1|1279428_1280730_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
WP_001264473.1|1280726_1281050_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1281094_1282450_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082643.1|1282564_1285225_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183647.1|1285278_1285959_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023224294.1|1286031_1286451_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1286654_1287692_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043664	Salmonella enterica subsp. enterica serovar Kentucky strain 161365 chromosome, complete genome	4889798	1520068	1563372	4889798	integrase,protease,tail,coat,terminase,portal,lysis,holin	Salmonella_phage(68.33%)	64	1521164:1521178	1562281:1562295
WP_023203533.1|1520068_1521007_+|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
1521164:1521178	attL	TGGTGTCCCCTGCAG	NA	NA	NA	NA
WP_001749406.1|1521268_1521472_-	hypothetical protein	NA	I6RSG8	Salmonella_phage	100.0	5.5e-33
WP_023138683.1|1521568_1521943_-	hypothetical protein	NA	A0A1V0E5M6	Salmonella_phage	100.0	2.0e-65
WP_000509169.1|1522185_1522452_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	97.7	3.7e-45
WP_058654768.1|1522528_1523242_-	hypothetical protein	NA	A0A220NQU1	Salmonella_phage	66.4	4.8e-39
WP_025711796.1|1523245_1523464_-	DUF4014 family protein	NA	B9UDM3	Salmonella_phage	100.0	2.4e-34
WP_058654766.1|1523846_1524224_-	hypothetical protein	NA	I6R9B7	Salmonella_phage	96.0	1.8e-61
WP_001214770.1|1524220_1524391_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
WP_058654763.1|1524401_1524695_-	DUF2856 family protein	NA	A0A1V0E5L7	Salmonella_phage	94.8	1.5e-47
WP_001253480.1|1524741_1525026_-	anti-RecBCD protein 1	NA	Q76H41	Enterobacteria_phage	96.8	5.7e-44
WP_058344790.1|1525025_1525733_-	recombinase	NA	A0A2H4FN95	Salmonella_phage	96.2	1.9e-133
WP_000361564.1|1525926_1526040_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_001199099.1|1526032_1526173_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	84.8	2.6e-18
WP_154188751.1|1526372_1527140_-	hypothetical protein	NA	A0A2H4FRY7	Salmonella_phage	83.1	3.9e-79
WP_058654756.1|1527328_1527823_+	hypothetical protein	NA	K7PK22	Enterobacteria_phage	62.8	4.3e-55
WP_058654755.1|1527823_1528186_-	hypothetical protein	NA	C6ZR44	Salmonella_phage	90.8	7.1e-55
WP_058654753.1|1528553_1528757_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	98.5	1.0e-26
WP_020899481.1|1528792_1529716_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	99.7	4.3e-181
WP_024142240.1|1529800_1530508_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	81.7	1.2e-106
WP_024142239.1|1530618_1530843_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	89.0	6.8e-32
WP_023229430.1|1530973_1531267_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	92.8	1.0e-40
WP_058654751.1|1531447_1532296_+	replication protein	NA	C6ZR51	Salmonella_phage	95.7	1.7e-152
WP_058654749.1|1532406_1534287_+	DNA replication protein	NA	A0A0M4R313	Salmonella_phage	99.5	0.0e+00
WP_001064628.1|1534287_1534566_+	hypothetical protein	NA	C6ZR54	Salmonella_phage	100.0	5.2e-50
WP_000796285.1|1534638_1534965_+	hypothetical protein	NA	Q716D0	Shigella_phage	99.1	4.2e-59
WP_000049638.1|1534961_1535162_+	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
WP_001552357.1|1535173_1535503_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	67.7	4.6e-37
WP_058654746.1|1535459_1535906_+	recombination protein NinB	NA	I6R0N7	Salmonella_phage	96.6	7.8e-80
WP_043856233.1|1535902_1536079_+	NinE family protein	NA	I6RSI9	Salmonella_phage	98.3	1.5e-26
WP_023217803.1|1536075_1536255_+	hypothetical protein	NA	I6R994	Salmonella_phage	96.6	3.6e-28
WP_058654774.1|1536229_1536838_+	protein ninG	NA	I6S604	Salmonella_phage	98.0	5.6e-97
WP_000036319.1|1536834_1537059_+	hypothetical protein	NA	I6R0N9	Salmonella_phage	98.6	1.8e-37
WP_000149880.1|1537055_1537259_+	protein ninH	NA	A0A1V0E5I5	Salmonella_phage	100.0	5.5e-33
WP_001650242.1|1537239_1537419_+	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	96.6	7.8e-23
WP_058654744.1|1537415_1537934_+	DUF1133 family protein	NA	A0A1R3Y5U9	Salmonella_virus	95.9	8.8e-91
WP_023135295.1|1538398_1538602_+|holin	holin	holin	I6R0S9	Salmonella_phage	98.5	1.5e-33
WP_023205065.1|1538579_1539077_+	lysozyme RrrD	NA	I6R0P2	Salmonella_phage	98.8	2.4e-90
WP_058654742.1|1539165_1539633_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	91.0	3.4e-70
WP_016048832.1|1539845_1540532_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	100.0	1.6e-124
WP_000808100.1|1540892_1541135_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_015995317.1|1541137_1541542_+	hypothetical protein	NA	C6ZR73	Salmonella_phage	100.0	3.1e-67
WP_000729924.1|1541545_1542034_+	hypothetical protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
WP_058654739.1|1542011_1543511_+|terminase	terminase	terminase	A0A1R3Y5N2	Salmonella_virus	99.8	4.8e-307
WP_058654737.1|1543510_1545688_+|portal	portal protein	portal	A0A075B8I1	Enterobacteria_phage	99.0	0.0e+00
WP_052940620.1|1545701_1546613_+	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	2.4e-160
WP_154188753.1|1546612_1547908_+|coat	coat protein	coat	A0A0M5M1J5	Salmonella_phage	99.5	6.5e-244
WP_000538672.1|1547948_1548509_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	100.0	1.7e-103
WP_001166097.1|1548492_1548993_+	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	98.2	8.7e-88
WP_001750868.1|1548952_1550371_+	DNA stabilization protein	NA	B9UDK6	Salmonella_phage	97.5	2.1e-272
WP_000774920.1|1550374_1551076_+	hypothetical protein	NA	I6S5X0	Salmonella_phage	99.6	2.5e-72
WP_000627703.1|1551075_1551531_+	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_004015040.1|1551533_1552226_+	hypothetical protein	NA	A0A2H4FUQ9	Salmonella_phage	98.3	8.4e-89
WP_033555246.1|1552236_1553586_+	phage DNA ejection protein	NA	A0A0M5M1J8	Salmonella_phage	70.2	9.1e-172
WP_058654735.1|1553570_1555727_+	hypothetical protein	NA	A0A0A0P1R1	Enterobacteria_phage	29.6	3.7e-50
WP_162007603.1|1555784_1556207_-	hypothetical protein	NA	A0A075B8F4	Enterobacteria_phage	64.3	3.3e-35
WP_058654733.1|1556650_1556836_+	hypothetical protein	NA	I6RSG3	Salmonella_phage	98.4	3.3e-08
WP_000820796.1|1556845_1557163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058654731.1|1557159_1557408_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	51.5	2.0e-08
WP_000410001.1|1557522_1557675_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_058654729.1|1557671_1557941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058654728.1|1558004_1558928_+	antirepressor	NA	A5VW58	Enterobacteria_phage	93.2	1.0e-166
WP_058654725.1|1559028_1560885_+|tail	phage tail protein	tail	I6S5Y0	Salmonella_phage	99.0	0.0e+00
WP_001749026.1|1560947_1562117_-|integrase	tyrosine-type recombinase/integrase	integrase	I6R0M2	Salmonella_phage	100.0	3.7e-230
WP_000377779.1|1562430_1563372_-	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
1562281:1562295	attR	TGGTGTCCCCTGCAG	NA	NA	NA	NA
>prophage 5
NZ_CP043664	Salmonella enterica subsp. enterica serovar Kentucky strain 161365 chromosome, complete genome	4889798	1803815	1812986	4889798	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_023224579.1|1803815_1804763_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.0	6.2e-10
WP_000824854.1|1804746_1805478_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1805458_1805566_-	protein YohO	NA	NA	NA	NA	NA
WP_023224580.1|1805625_1806357_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	5.9e-101
WP_000272850.1|1806579_1808265_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1808261_1808981_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1809027_1809495_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_023224581.1|1809551_1810082_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1810253_1810712_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195330.1|1810952_1812986_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
NZ_CP043664	Salmonella enterica subsp. enterica serovar Kentucky strain 161365 chromosome, complete genome	4889798	1887181	1897688	4889798		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023224545.1|1887181_1888585_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1888762_1889656_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1890032_1891118_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023659.1|1891117_1892017_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_023224546.1|1892064_1892943_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	3.0e-107
WP_000973713.1|1892943_1893495_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	7.7e-53
WP_000018224.1|1893500_1894475_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_052939425.1|1894490_1895264_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1895268_1896348_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126351.1|1896374_1897688_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
>prophage 7
NZ_CP043664	Salmonella enterica subsp. enterica serovar Kentucky strain 161365 chromosome, complete genome	4889798	2007134	2014368	4889798		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|2007134_2007554_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023224669.1|2007556_2008825_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.4	1.1e-227
WP_000208509.1|2009279_2009492_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2009502_2009691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052939410.1|2009949_2011128_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.0	1.1e-109
WP_000107435.1|2011777_2012089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023224667.1|2012168_2012864_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.1e-07
WP_001157305.1|2012937_2014368_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
NZ_CP043664	Salmonella enterica subsp. enterica serovar Kentucky strain 161365 chromosome, complete genome	4889798	4445808	4492884	4889798	tRNA,tail,plate	Burkholderia_phage(40.91%)	49	NA	NA
WP_001182233.1|4445808_4446807_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039335.1|4446894_4448205_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4448451_4448967_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4449066_4449276_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4449297_4449411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128102.1|4449407_4450733_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4450911_4451520_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4451628_4451997_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4452167_4454588_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4454686_4455559_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|4455572_4456070_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4456250_4457168_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973642.1|4457331_4458690_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4458777_4459887_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_001651229.1|4460248_4461439_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382565.1|4461570_4463115_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4463129_4464020_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4464185_4464596_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_023224741.1|4464738_4466835_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_023216234.1|4466834_4467572_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4467568_4468237_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4468270_4468513_-	outer membrane protein	NA	NA	NA	NA	NA
WP_023224740.1|4468956_4470606_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4470950_4472300_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4472430_4472778_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4473354_4473642_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_023224739.1|4473644_4474250_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	4.2e-60
WP_000777267.1|4474262_4474577_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	8.3e-20
WP_000449440.1|4474735_4475191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875313.1|4475187_4475385_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	5.1e-07
WP_000729853.1|4475374_4476802_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.4e-194
WP_023224738.1|4476801_4477326_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	9.5e-69
WP_001003638.1|4477377_4477695_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_023224737.1|4477654_4477783_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_052939511.1|4477879_4480234_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	2.1e-67
WP_052939512.1|4480233_4481187_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4481186_4481396_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023224735.1|4481383_4482427_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	5.5e-76
WP_000679393.1|4482436_4483159_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593184.1|4483486_4483849_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_023137582.1|4483845_4484775_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_023138094.1|4484785_4486333_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
WP_001093501.1|4486496_4486856_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_023224732.1|4486846_4487962_+	hypothetical protein	NA	Q6QI99	Burkholderia_phage	51.2	5.0e-99
WP_000359504.1|4487954_4488587_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_023224731.1|4488589_4490359_+|tail	phage tail fiber protein H	tail	A0A0M3ULF6	Salmonella_phage	52.7	4.2e-52
WP_023203256.1|4490363_4490969_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_023203255.1|4490965_4491421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587738.1|4492155_4492884_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
