The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP035696	Vibrio furnissii strain 2419-04 chromosome 1, complete sequence	3371444	569282	575850	3371444		Staphylococcus_phage(66.67%)	7	NA	NA
WP_004724909.1|569282_569753_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.3	1.9e-31
WP_004724911.1|569945_571055_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.8	7.0e-61
WP_014204552.1|571096_571753_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.0	2.1e-33
WP_154180328.1|571755_572865_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.0	1.9e-42
WP_014204550.1|572878_573328_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_154180329.1|573430_574681_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.7	4.9e-95
WP_004724922.1|574692_575850_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.6	2.6e-66
>prophage 2
NZ_CP035696	Vibrio furnissii strain 2419-04 chromosome 1, complete sequence	3371444	1853809	1864955	3371444	tRNA	uncultured_Mediterranean_phage(28.57%)	8	NA	NA
WP_154180757.1|1853809_1854577_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	1.0e-66
WP_014205779.1|1854569_1855196_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.5	1.7e-35
WP_004723838.1|1856202_1857192_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.5	1.3e-34
WP_004723840.1|1857260_1859822_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.6	1.5e-34
WP_154180758.1|1859906_1860401_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.7	2.6e-28
WP_004723845.1|1860567_1861620_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.7	6.3e-112
WP_154180759.1|1861714_1862185_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_154180760.1|1862372_1864955_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.7	1.3e-78
>prophage 3
NZ_CP035696	Vibrio furnissii strain 2419-04 chromosome 1, complete sequence	3371444	2074311	2081355	3371444		Faustovirus(16.67%)	9	NA	NA
WP_154180821.1|2074311_2075526_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.2	4.8e-31
WP_004729416.1|2075562_2075946_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	76.6	9.1e-53
WP_004729414.1|2076005_2076329_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	5.5e-27
WP_154180822.1|2076395_2076911_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_143680138.1|2076932_2078786_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.5	5.5e-111
WP_004729409.1|2078799_2079138_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_004729407.1|2079193_2079388_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_055465968.1|2079564_2080857_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.1	1.7e-34
WP_004729403.1|2080923_2081355_+	nucleoside-diphosphate kinase	NA	K7YW26	Megavirus	38.3	4.4e-19
>prophage 4
NZ_CP035696	Vibrio furnissii strain 2419-04 chromosome 1, complete sequence	3371444	2331084	2395161	3371444	tRNA,tail,terminase,portal,capsid,integrase,head	Vibrio_phage(85.71%)	72	2358905:2358924	2395953:2395972
WP_038151364.1|2331084_2333136_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	30.7	4.0e-62
WP_154180908.1|2333294_2334371_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_004726628.1|2334546_2335188_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.8	2.1e-33
WP_154180909.1|2335286_2337401_+	AsmA family protein	NA	NA	NA	NA	NA
WP_004726626.1|2337539_2338145_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_154180910.1|2338346_2339591_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_154180911.1|2340177_2340741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154180912.1|2340745_2341222_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_143679260.1|2341250_2342540_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_154180913.1|2342843_2344112_-	transporter	NA	NA	NA	NA	NA
WP_014205508.1|2344343_2345069_-	DUF3379 domain-containing protein	NA	NA	NA	NA	NA
WP_014205507.1|2345061_2345625_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	30.3	3.6e-05
WP_154180914.1|2346156_2347464_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_154180915.1|2347463_2349590_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_014205504.1|2349728_2350277_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_038151361.1|2350412_2351288_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004726612.1|2352818_2352950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014205502.1|2353002_2353407_+	DUF454 domain-containing protein	NA	NA	NA	NA	NA
WP_004726610.1|2353536_2354082_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.8	1.3e-28
WP_154180916.1|2354103_2356182_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	37.8	2.6e-45
WP_004726608.1|2356260_2356590_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_004726607.1|2356605_2357205_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_014205499.1|2357259_2357958_-	aquaporin Z	NA	NA	NA	NA	NA
WP_154181332.1|2358092_2358341_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_154180917.1|2358496_2358937_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
2358905:2358924	attL	GACCACATTTTGAACCATCC	NA	NA	NA	NA
WP_154180131.1|2359056_2360115_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I7RNH5	Vibrio_phage	86.0	1.4e-175
WP_154180132.1|2360497_2361937_-	hypothetical protein	NA	R9TRQ8	Vibrio_phage	65.6	1.1e-170
WP_154180133.1|2361945_2362854_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_154180134.1|2362891_2363230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154180135.1|2363432_2363621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049781803.1|2363649_2364072_-	hypothetical protein	NA	R9TPX9	Vibrio_phage	56.1	4.5e-37
WP_154180136.1|2364094_2364748_-	transcriptional regulator	NA	R9TR74	Vibrio_phage	65.8	5.0e-75
WP_041942596.1|2364904_2365105_+	hypothetical protein	NA	A0A2I7RNG9	Vibrio_phage	51.5	3.1e-12
WP_154180918.1|2365215_2365755_+	transcriptional regulator	NA	R9TRR3	Vibrio_phage	58.1	9.8e-53
WP_154180919.1|2365766_2366051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154180920.1|2366136_2366430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154180921.1|2366429_2366666_+	hypothetical protein	NA	R9TPY7	Vibrio_phage	83.3	3.2e-32
WP_154180922.1|2366662_2367274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154180923.1|2367274_2370178_+	replication endonuclease	NA	R9TNQ0	Vibrio_phage	51.7	6.1e-250
WP_154180924.1|2370311_2370560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154180925.1|2370556_2370835_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_154180926.1|2370837_2371035_+	hypothetical protein	NA	R9TRR8	Vibrio_phage	70.5	3.6e-13
WP_154180927.1|2371576_2371879_+	hypothetical protein	NA	R9TPZ1	Vibrio_phage	55.6	2.5e-13
WP_047461592.1|2371873_2372125_-	ogr/Delta-like zinc finger family protein	NA	R9TNQ2	Vibrio_phage	83.1	8.1e-34
WP_047461589.1|2372215_2372446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154180928.1|2372428_2373454_-|portal	phage portal protein	portal	U3PFK6	Vibrio_phage	83.4	3.9e-167
WP_154180929.1|2373450_2375274_-|terminase	terminase	terminase	U3PIL1	Vibrio_phage	83.7	3.1e-300
WP_154180930.1|2375444_2376350_+|capsid	capsid protein	capsid	U3PDG3	Vibrio_phage	89.0	7.3e-117
WP_154180931.1|2376349_2377357_+|capsid	phage major capsid protein, P2 family	capsid	R9TPZ5	Vibrio_phage	59.6	3.5e-104
WP_154181333.1|2377367_2378087_+|terminase	terminase	terminase	U3PCG2	Vibrio_phage	72.0	1.6e-95
WP_154180932.1|2378195_2378657_+|head	head protein	head	U3PFL1	Vibrio_phage	75.2	2.3e-58
WP_047461573.1|2378653_2379145_+	hypothetical protein	NA	R9TRS7	Vibrio_phage	84.0	1.9e-74
WP_047461570.1|2379131_2379791_+	phage virion morphogenesis protein	NA	R9TPZ7	Vibrio_phage	89.5	3.9e-104
WP_154180933.1|2379792_2380902_+	DUF2586 family protein	NA	R9TNQ8	Vibrio_phage	93.5	4.3e-196
WP_047461566.1|2380898_2381354_+	DUF2597 family protein	NA	U3PCG7	Vibrio_phage	88.7	3.2e-73
WP_154180934.1|2381362_2381569_+	TraR/DksA family transcriptional regulator	NA	R9TMS3	Vibrio_phage	80.6	1.0e-26
WP_047461563.1|2381569_2381770_+	hypothetical protein	NA	R9TRT0	Vibrio_phage	83.3	1.4e-25
WP_154180935.1|2381756_2382347_+	glycoside hydrolase family protein	NA	A0A2I7RNI5	Vibrio_phage	64.8	9.4e-73
WP_154180936.1|2382321_2382663_+	hypothetical protein	NA	R9TNR2	Vibrio_phage	92.9	1.6e-48
WP_154181334.1|2382631_2382871_+	hypothetical protein	NA	A0A166YHN7	Vibrio_phage	69.2	1.1e-24
WP_024375122.1|2382867_2383152_+	hypothetical protein	NA	A0A160DHS7	Vibrio_phage	79.3	3.0e-32
WP_154180937.1|2383333_2385151_+|tail	phage tail tape measure protein	tail	R9TRA2	Vibrio_phage	92.1	3.3e-310
WP_047461551.1|2385140_2385473_+	DUF2590 family protein	NA	R9TMS7	Vibrio_phage	88.2	1.5e-48
WP_154180938.1|2385469_2386675_+	hypothetical protein	NA	R9TRT3	Vibrio_phage	85.0	9.5e-197
WP_154180123.1|2386667_2387327_+|tail	phage tail protein	tail	R9TQ05	Vibrio_phage	81.7	1.7e-102
WP_154180124.1|2388849_2389281_+	hypothetical protein	NA	A0A2D0YU91	Vibrio_phage	42.4	1.8e-17
WP_154180125.1|2389284_2390178_+	hypothetical protein	NA	R9TRQ4	Vibrio_phage	70.4	7.0e-112
WP_154180126.1|2390165_2390639_+	DNA-binding protein	NA	R9TPX7	Vibrio_phage	85.8	4.9e-64
WP_154180127.1|2390635_2392222_+	hypothetical protein	NA	R9TNN7	Vibrio_phage	83.7	3.6e-268
WP_047461530.1|2392221_2392419_+	hypothetical protein	NA	R9TR72	Vibrio_phage	47.7	6.0e-08
WP_154180128.1|2392953_2394057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154180129.1|2394447_2395161_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	57.3	1.8e-22
2395953:2395972	attR	GACCACATTTTGAACCATCC	NA	NA	NA	NA
>prophage 1
NZ_CP035694	Vibrio furnissii strain 2419-04 chromosome 2, complete sequence	1612406	446408	454058	1612406		Bacillus_virus(16.67%)	9	NA	NA
WP_004727456.1|446408_447803_+	dihydrolipoyl dehydrogenase	NA	G3MA85	Bacillus_virus	25.1	1.8e-05
WP_154179486.1|448226_449429_+	MFS transporter	NA	NA	NA	NA	NA
WP_004727458.1|449451_449880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038151816.1|449891_450215_+	thioredoxin fold domain-containing protein	NA	A0A2K9L3H4	Tupanvirus	29.5	2.9e-07
WP_154179487.1|450315_450642_+	thiol reductase thioredoxin	NA	A0A023NHA9	Dinoroseobacter_phage	33.0	6.9e-09
WP_154179488.1|450658_451630_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	2.4e-65
WP_014257812.1|451769_452360_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_154179489.1|452604_453249_+	antibiotic acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	37.8	5.5e-18
WP_004727463.1|453440_454058_-	3'-5' exonuclease	NA	A0A0A7RWA3	Clostridium_phage	35.4	3.7e-19
>prophage 2
NZ_CP035694	Vibrio furnissii strain 2419-04 chromosome 2, complete sequence	1612406	802775	840955	1612406	capsid,integrase,plate,portal,lysis,tail,head	Vibrio_phage(61.11%)	48	802896:802955	840956:841019
WP_154179633.1|802775_804002_-|integrase	tyrosine-type recombinase/integrase	integrase	R9TMP3	Vibrio_phage	81.3	6.7e-198
802896:802955	attL	TTGCTGCGCAAGGTAACTCACGTTGACGTTTGCGTGTGTGATAGCCCAACTCGCATAGGT	NA	NA	NA	NA
WP_044363388.1|803980_804166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154179634.1|804247_804460_-	hypothetical protein	NA	A0A1V0E8D5	Vibrio_phage	49.3	1.5e-12
WP_154179635.1|804462_804732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154179636.1|804780_805599_-	DUF2303 family protein	NA	R9TRN9	Vibrio_phage	81.6	7.3e-124
WP_154179637.1|805639_806035_-	hypothetical protein	NA	R9TMP0	Vibrio_phage	90.1	6.5e-62
WP_154179638.1|806166_807231_-	restriction endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	42.0	1.2e-70
WP_154179639.1|807258_808041_-	helix-turn-helix domain-containing protein	NA	R9TNM0	Vibrio_phage	74.4	1.2e-88
WP_154179640.1|808330_808783_+	hypothetical protein	NA	R9TRN6	Vibrio_phage	64.2	8.6e-42
WP_044363395.1|808779_809031_+	hypothetical protein	NA	R9TMN6	Vibrio_phage	78.3	5.4e-30
WP_154179641.1|809188_809890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154179642.1|809889_810411_+	DNA methyltransferase	NA	R9TNL7	Vibrio_phage	87.3	3.6e-92
WP_044363401.1|810410_810698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154179643.1|810690_811686_+	ATPase	NA	R9TPU9	Vibrio_phage	46.9	2.0e-38
WP_044363405.1|811675_811882_+	hypothetical protein	NA	R9TRN3	Vibrio_phage	50.0	4.5e-14
WP_154179644.1|812108_813107_+	DUF968 domain-containing protein	NA	R9TRM9	Vibrio_phage	74.7	1.8e-153
WP_154179645.1|813294_813705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154179646.1|814054_815593_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	34.8	1.6e-26
WP_075990185.1|816044_816254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154179647.1|816276_817401_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_154179648.1|817409_818021_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_154179649.1|818308_818974_+	hypothetical protein	NA	R9TRM8	Vibrio_phage	57.0	2.9e-70
WP_154179650.1|819101_819293_+	hypothetical protein	NA	A0A1V1FD92	Vibrio_phage	59.7	2.1e-13
WP_154179651.1|819279_819783_+	glycoside hydrolase family protein	NA	A0A1V0E844	Vibrio_phage	59.8	5.0e-51
WP_154179652.1|819740_820220_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	43.3	9.5e-15
WP_154179653.1|820348_820930_+	hypothetical protein	NA	D4HTU0	Vibrio_phage	35.4	1.1e-17
WP_154179654.1|822804_823014_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_154179655.1|823013_824570_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	56.4	6.0e-159
WP_154179656.1|824562_825930_+|capsid	capsid protein	capsid	A0A2I6TC87	Escherichia_phage	44.7	1.0e-85
WP_154179657.1|825940_826273_+|head	head decoration protein	head	A0A1I9KF38	Aeromonas_phage	43.9	7.5e-11
WP_154179658.1|826312_827353_+|capsid	phage capsid protein	capsid	A0A1I9KF25	Aeromonas_phage	42.8	5.3e-71
WP_154179659.1|827416_827935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154179660.1|827938_828307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154179661.1|828354_828957_+	hypothetical protein	NA	R9TR34	Vibrio_phage	50.0	7.4e-49
WP_154179662.1|828960_829491_+	hypothetical protein	NA	A0A193GYB4	Enterobacter_phage	27.9	4.4e-13
WP_154179663.1|829483_830149_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	36.6	1.4e-16
WP_154179664.1|830150_830489_+|plate	phage baseplate protein	plate	A0A088FV58	Escherichia_phage	59.5	3.5e-32
WP_154179666.1|830485_831373_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	54.3	1.0e-78
WP_154179667.1|831365_831977_+|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	53.5	2.7e-54
WP_154179670.1|831973_833131_+	hypothetical protein	NA	A0A0M3ULH6	Salmonella_phage	68.9	2.3e-51
WP_154179672.1|833133_833565_+	hypothetical protein	NA	A0A2D0YU91	Vibrio_phage	44.1	7.0e-17
WP_154179673.1|833631_835098_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	45.7	9.4e-114
WP_154179675.1|835097_835613_+|tail	phage tail protein	tail	A0A193GYM4	Enterobacter_phage	30.4	3.7e-17
WP_154179677.1|835682_835973_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_154179679.1|837862_838267_+	hypothetical protein	NA	R9TMP6	Vibrio_phage	46.6	3.3e-29
WP_154179681.1|838241_838448_+|tail	phage tail protein	tail	R9TR63	Vibrio_phage	47.8	5.5e-12
WP_154179683.1|838438_839443_+|tail	phage tail protein	tail	R9TNM7	Vibrio_phage	36.5	4.7e-56
WP_154180089.1|840835_840955_-|integrase	integrase	integrase	R9TMP3	Vibrio_phage	83.8	9.1e-12
840956:841019	attR	TTGCTGCGCAAGGTAACTCACGTTGACGTTTGCGTGTGTGATAGCCCAACTCGCATAGGTGTGT	NA	NA	NA	NA
>prophage 3
NZ_CP035694	Vibrio furnissii strain 2419-04 chromosome 2, complete sequence	1612406	1013718	1024382	1612406	capsid,terminase,portal,tail	Burkholderia_phage(33.33%)	15	NA	NA
WP_080871245.1|1013718_1013826_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_020432125.1|1013861_1014149_-|tail	phage tail assembly protein	tail	E5FFG7	Burkholderia_phage	40.4	9.7e-07
WP_154179802.1|1014132_1014840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004726844.1|1014850_1015216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154179803.1|1015219_1016353_-|tail	phage tail protein	tail	C9DGP7	Escherichia_phage	38.7	1.5e-47
WP_154179804.1|1016349_1016532_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_154179805.1|1016532_1017072_-	virion morphogenesis protein	NA	NA	NA	NA	NA
WP_154179806.1|1017068_1017533_-|tail	phage tail protein	tail	A0A1S5NPS3	Burkholderia_phage	28.6	8.6e-05
WP_154179807.1|1017532_1017982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154179808.1|1018090_1019128_-|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	41.1	7.0e-63
WP_154179809.1|1019170_1019998_-|capsid	phage capsid protein	capsid	Q9ZXM4	Pseudomonas_virus	34.0	5.4e-18
WP_154179810.1|1020168_1021893_+|terminase	terminase	terminase	E5E3X0	Burkholderia_phage	41.4	1.2e-112
WP_154179811.1|1021903_1022860_+|portal	phage portal protein	portal	A0A0M3LS06	Mannheimia_phage	42.4	5.6e-59
WP_154179812.1|1022881_1023475_-	cell filamentation protein Fic	NA	S4TP71	Salmonella_phage	29.2	7.4e-09
WP_154179813.1|1023773_1024382_-	KilA-N domain-containing protein	NA	I6R977	Salmonella_phage	55.6	2.3e-18
>prophage 1
NZ_CP035695	Vibrio furnissii strain 2419-04 plasmid unnamed1	16678	1041	16527	16678	integrase,tail	Vibrio_phage(91.67%)	17	7312:7325	11744:11757
WP_154180123.1|1041_1701_+|tail	phage tail protein	tail	R9TQ05	Vibrio_phage	81.7	1.7e-102
WP_154180124.1|3223_3655_+	hypothetical protein	NA	A0A2D0YU91	Vibrio_phage	42.4	1.8e-17
WP_154180125.1|3658_4552_+	hypothetical protein	NA	R9TRQ4	Vibrio_phage	70.4	7.0e-112
WP_154180126.1|4539_5013_+	DNA-binding protein	NA	R9TPX7	Vibrio_phage	85.8	4.9e-64
WP_154180127.1|5009_6596_+	hypothetical protein	NA	R9TNN7	Vibrio_phage	83.7	3.6e-268
WP_047461530.1|6595_6793_+	hypothetical protein	NA	R9TR72	Vibrio_phage	47.7	6.0e-08
7312:7325	attL	TTGCAAATAACTTC	NA	NA	NA	NA
WP_154180128.1|7327_8431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154180129.1|8821_9535_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	57.3	1.8e-22
WP_154180130.1|9677_10241_+	SOS response-associated peptidase	NA	NA	NA	NA	NA
WP_154180131.1|10478_11537_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I7RNH5	Vibrio_phage	86.0	1.4e-175
WP_154180132.1|11919_13359_-	hypothetical protein	NA	R9TRQ8	Vibrio_phage	65.6	1.1e-170
11744:11757	attR	TTGCAAATAACTTC	NA	NA	NA	NA
WP_154180133.1|13367_14276_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_154180134.1|14313_14652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154180135.1|14854_15043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049781803.1|15071_15494_-	hypothetical protein	NA	R9TPX9	Vibrio_phage	56.1	4.5e-37
WP_154180136.1|15516_16170_-	transcriptional regulator	NA	R9TR74	Vibrio_phage	65.8	5.0e-75
WP_041942596.1|16326_16527_+	hypothetical protein	NA	A0A2I7RNG9	Vibrio_phage	51.5	3.1e-12
