The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045954	Salmonella enterica subsp. enterica serovar Saintpaul strain AUSMDU00010531 chromosome, complete genome	4731476	1597915	1627496	4731476	tail,protease,holin	Salmonella_phage(38.46%)	26	NA	NA
WP_021000536.1|1597915_1598410_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1598823_1599315_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1599304_1599568_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1599564_1602051_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1602057_1602753_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1602739_1603609_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1603724_1604174_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1604183_1604786_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1604806_1605424_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_001238332.1|1610020_1611064_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1611107_1611755_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1612484_1613048_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1613239_1613443_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1613745_1614537_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1614833_1615037_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1615205_1617572_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1617900_1618890_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_077905362.1|1618904_1619273_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	80.8	1.4e-50
WP_000894640.1|1619301_1620633_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1620929_1621259_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1621851_1623093_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1623095_1623623_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1624000_1624444_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1624497_1626327_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1626674_1626965_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1626992_1627496_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 2
NZ_CP045954	Salmonella enterica subsp. enterica serovar Saintpaul strain AUSMDU00010531 chromosome, complete genome	4731476	1699577	1708747	4731476	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1699577_1700525_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1700508_1701240_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1701220_1701328_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1701387_1702119_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1702340_1704026_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1704022_1704742_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1704788_1705256_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1705312_1705843_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1706014_1706473_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_154079482.1|1706713_1708747_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	3.0e-54
>prophage 3
NZ_CP045954	Salmonella enterica subsp. enterica serovar Saintpaul strain AUSMDU00010531 chromosome, complete genome	4731476	1777056	1787562	4731476		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111840.1|1777056_1778460_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	2.3e-21
WP_000981471.1|1778637_1779531_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697838.1|1779907_1780993_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	9.4e-103
WP_001023662.1|1780992_1781892_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1781939_1782818_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1782818_1783370_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1783375_1784368_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1784364_1785138_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1785142_1786222_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1786248_1787562_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP045954	Salmonella enterica subsp. enterica serovar Saintpaul strain AUSMDU00010531 chromosome, complete genome	4731476	1873556	1884141	4731476		Morganella_phage(25.0%)	12	NA	NA
WP_001219015.1|1873556_1874030_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001669246.1|1874677_1874968_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	5.2e-08
WP_000598920.1|1875339_1876137_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001521460.1|1876617_1876779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1876905_1877325_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1877327_1878596_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1879050_1879263_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1879273_1879462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080668.1|1879722_1880901_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	6.6e-110
WP_000107430.1|1881550_1881850_+	membrane protein	NA	NA	NA	NA	NA
WP_000377042.1|1881941_1882637_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157301.1|1882710_1884141_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP045954	Salmonella enterica subsp. enterica serovar Saintpaul strain AUSMDU00010531 chromosome, complete genome	4731476	1987376	1994185	4731476	tail,integrase	Salmonella_phage(33.33%)	11	1989586:1989608	1999301:1999323
WP_000856224.1|1987376_1987607_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|1987744_1988119_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|1988119_1988995_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|1989011_1989365_+	YebY family protein	NA	NA	NA	NA	NA
1989586:1989608	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|1989738_1990593_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|1990652_1991147_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|1991336_1991567_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|1991620_1992154_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|1992410_1992578_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|1992642_1992831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|1993303_1994185_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
1999301:1999323	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP045954	Salmonella enterica subsp. enterica serovar Saintpaul strain AUSMDU00010531 chromosome, complete genome	4731476	2599450	2687364	4731476	portal,integrase,head,protease,capsid,tRNA,tail,terminase,lysis,holin	Enterobacteria_phage(31.37%)	104	2620261:2620275	2689997:2690011
WP_000829539.1|2599450_2599978_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272241.1|2599974_2600082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|2600287_2600734_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|2600713_2601508_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205341.1|2601608_2602793_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|2602911_2603259_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487126.1|2603244_2603556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|2603624_2603876_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|2604071_2604170_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|2604308_2604557_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000762776.1|2604871_2605513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|2605742_2605925_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|2605927_2606290_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|2606462_2607101_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617985.1|2607297_2607843_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000908464.1|2607925_2608075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208086.1|2608153_2608402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|2608656_2609505_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001738208.1|2609573_2610167_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000175803.1|2610311_2611100_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_000234685.1|2611208_2611859_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|2612052_2612379_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_000456065.1|2612572_2613706_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947460.1|2613787_2614378_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950207.1|2614371_2615169_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000966645.1|2615162_2615975_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001520270.1|2615964_2616939_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946082.1|2616938_2618573_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|2619254_2619569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929982.1|2619717_2620248_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
2620261:2620275	attL	TCCCGGCGTGAGAGA	NA	NA	NA	NA
WP_000761746.1|2620330_2621374_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001518864.1|2621712_2622183_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000480529.1|2622331_2622604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758946.1|2622803_2622929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977725.1|2623306_2623651_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789471.1|2624887_2625445_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|2626257_2626521_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|2626652_2626865_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|2627279_2627801_+	lipoprotein	NA	NA	NA	NA	NA
WP_000497451.1|2627991_2628231_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001033408.1|2628719_2629508_+	lipoprotein	NA	NA	NA	NA	NA
WP_000917255.1|2630488_2631613_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_001521673.1|2632060_2632273_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.5e-20
WP_000334551.1|2632526_2633198_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	1.1e-80
WP_154079489.1|2633517_2635629_-	type III secretion system effector E3 ubiquitin transferase SspH1	NA	Q9MBL9	Phage_Gifsy-2	46.2	8.1e-26
WP_000457876.1|2637162_2637288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000143179.1|2638154_2638739_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.8	1.7e-87
WP_154079490.1|2638738_2641180_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	61.7	2.1e-86
WP_000178849.1|2641233_2641476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080191857.1|2641514_2644877_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	79.3	0.0e+00
WP_080191858.1|2644938_2645586_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.2	6.6e-88
WP_000662740.1|2645483_2646221_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
WP_047596067.1|2646227_2646926_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.9	1.6e-103
WP_000447370.1|2646935_2647265_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_080191859.1|2647267_2650309_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	65.1	2.7e-296
WP_010989052.1|2650280_2650619_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2650615_2651011_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_080191860.1|2651061_2651808_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2651815_2652217_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000677089.1|2652213_2652792_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083293.1|2652778_2653156_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000201485.1|2653166_2653532_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2653589_2654618_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_080191861.1|2654672_2655020_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	1.6e-19
WP_154079491.1|2655032_2656529_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2656518_2658099_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2658095_2658299_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_079970731.1|2658282_2660214_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.4e-258
WP_001102153.1|2660185_2660731_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_152279297.1|2661016_2661418_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
WP_001533543.1|2661653_2662106_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_015701345.1|2662123_2662576_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001574216.1|2662559_2662889_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2663164_2663851_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_080191863.1|2664065_2664254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154079503.1|2664760_2665420_-	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	65.4	4.7e-41
WP_154079492.1|2665808_2666486_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_023194650.1|2666482_2666623_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	76.3	2.1e-07
WP_154079493.1|2666619_2666847_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	72.5	4.8e-17
WP_001604753.1|2666843_2667443_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.4	2.8e-96
WP_152279298.1|2667506_2667812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080191865.1|2668442_2670422_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	8.6e-163
WP_152279299.1|2670818_2671949_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_058656896.1|2672235_2672631_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.1	1.7e-17
WP_000140163.1|2672645_2673107_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.8e-67
WP_080191575.1|2673099_2674107_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.5	5.3e-124
WP_025711034.1|2674153_2674648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033909.1|2674634_2674889_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
WP_001224470.1|2674985_2675411_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	9.3e-14
WP_001674119.1|2675719_2675875_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	4.7e-08
WP_023233097.1|2676256_2676541_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
WP_152280164.1|2676615_2676951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152280163.1|2677091_2679782_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.3	1.4e-115
WP_001126032.1|2679774_2680605_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_001033921.1|2680640_2680961_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_000066252.1|2680953_2681286_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	80.3	3.0e-20
WP_000069466.1|2681282_2681786_+	hypothetical protein	NA	A0A075B8H2	Enterobacteria_phage	92.3	6.0e-36
WP_023244951.1|2681835_2682072_+	excisionase	NA	NA	NA	NA	NA
WP_000741321.1|2682061_2683204_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.0	1.4e-173
WP_000444509.1|2683317_2684568_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249412.1|2684739_2685405_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825957.1|2685401_2685731_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000476067.1|2685742_2686204_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004541.1|2686257_2687364_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2689997:2690011	attR	TCTCTCACGCCGGGA	NA	NA	NA	NA
>prophage 7
NZ_CP045954	Salmonella enterica subsp. enterica serovar Saintpaul strain AUSMDU00010531 chromosome, complete genome	4731476	2935541	2943561	4731476	transposase,protease	Enterobacteria_phage(16.67%)	6	NA	NA
WP_085983316.1|2935541_2936796_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000934063.1|2937197_2939474_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2939504_2939825_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2940148_2940370_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|2940499_2942446_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|2942442_2943561_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 8
NZ_CP045954	Salmonella enterica subsp. enterica serovar Saintpaul strain AUSMDU00010531 chromosome, complete genome	4731476	4317107	4364715	4731476	tail,plate,tRNA	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182230.1|4317107_4318106_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039335.1|4318193_4319504_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4319750_4320266_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4320364_4320574_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4320595_4320709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4320705_4322031_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4322209_4322818_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4322926_4323295_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4323465_4325886_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4325984_4326857_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4326870_4327368_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4327548_4328466_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4328629_4329988_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4330076_4331186_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4331547_4332738_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4332869_4334414_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4334428_4335319_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4335484_4335895_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4336037_4338134_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4338133_4338871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022742863.1|4338867_4339536_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4339569_4339812_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4340255_4341905_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4342249_4343599_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4343731_4344079_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4344654_4344942_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4344944_4345550_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4345562_4345877_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4346036_4346492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4346488_4346686_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4346675_4348103_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4348102_4348627_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4348678_4348996_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4348955_4349084_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4349180_4351535_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4351534_4352488_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4352487_4352697_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4352684_4353728_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4353737_4354460_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4354787_4355150_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|4355146_4356076_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|4356075_4357623_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|4357786_4358146_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951737.1|4358136_4359252_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.0	2.0e-100
WP_000359509.1|4359244_4359877_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000368193.1|4359879_4361538_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_001151758.1|4361544_4362159_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084336.1|4362155_4362611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024133214.1|4362991_4363408_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000587740.1|4363986_4364715_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	7.3e-35
