The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045952	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 chromosome, complete genome	5022086	664537	692261	5022086	capsid,terminase,tail,head,portal,integrase,holin	Cronobacter_phage(75.0%)	34	664688:664703	697534:697549
WP_000478472.1|664537_666103_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
664688:664703	attL	ACCACGGTGAAAGCCA	NA	NA	NA	NA
WP_000983441.1|666099_666747_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213760.1|666978_667746_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000627044.1|668003_669785_-	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_001145219.1|669774_670812_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000568372.1|670815_671382_-	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_000514631.1|671398_671980_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_001247711.1|672123_672345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|672375_672879_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|672888_673116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000996837.1|673105_673531_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|673530_673932_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000551169.1|673999_674233_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000279404.1|674223_675084_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000170874.1|675080_677102_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000353141.1|677221_677428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|677401_677725_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038213.1|677721_678783_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001151939.1|678779_680555_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000018800.1|680715_681519_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_000550495.1|681580_682603_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_001218537.1|682606_683308_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000447487.1|683368_683857_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_000084218.1|683853_684360_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000560080.1|684356_685064_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000220203.1|685060_686188_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|686184_686640_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|686649_686943_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|686939_687281_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376373.1|687280_687613_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_000411339.1|687759_688017_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811094.1|688204_690175_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_001002797.1|690171_690501_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_001001828.1|691673_692261_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
697534:697549	attR	ACCACGGTGAAAGCCA	NA	NA	NA	NA
>prophage 2
NZ_CP045952	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 chromosome, complete genome	5022086	1159758	1221036	5022086	integrase,transposase,tRNA	Escherichia_phage(27.27%)	42	1153227:1153242	1187443:1187458
1153227:1153242	attL	ATGCTGATTGATTTTC	NA	NA	NA	NA
WP_000890027.1|1159758_1160541_-|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_000207016.1|1160540_1160870_-	YqcC family protein	NA	NA	NA	NA	NA
WP_000343990.1|1161481_1162027_-	SecY-interacting protein	NA	NA	NA	NA	NA
WP_000100474.1|1162095_1162944_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	3.6e-41
WP_000627973.1|1163056_1164421_+	nucleotide 5'-monophosphate nucleosidase	NA	NA	NA	NA	NA
WP_114050402.1|1165595_1166252_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	6.2e-126
WP_154074713.1|1166549_1167122_+	flagellar phase variation DNA invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	72.1	3.3e-67
WP_085983317.1|1170391_1171554_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
WP_154074714.1|1172826_1173648_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_154074715.1|1174007_1174325_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010989064.1|1174483_1175302_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_001520831.1|1175346_1176630_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001520307.1|1177050_1179120_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_000701821.1|1179155_1179371_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001161781.1|1179821_1180649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039026397.1|1182115_1182937_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010989063.1|1183783_1184377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542209.1|1184423_1184591_-	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_001542208.1|1184604_1185669_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
WP_010989057.1|1186269_1187433_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196159.1|1187440_1189621_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
1187443:1187458	attR	ATGCTGATTGATTTTC	NA	NA	NA	NA
WP_000533858.1|1189617_1191027_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237668.1|1191091_1202566_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1203179_1203662_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1203811_1204288_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1204277_1204568_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1204733_1205072_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1205220_1206882_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1206967_1207846_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1207968_1208559_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287923.1|1208593_1209199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1209319_1210606_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1210625_1211417_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1211582_1212944_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1213257_1213506_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1213524_1214073_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1214117_1214885_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1214925_1215273_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1215429_1216650_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212379.1|1216642_1217161_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1218815_1219886_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_154074716.1|1220214_1221036_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP045952	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 chromosome, complete genome	5022086	1224632	1287578	5022086	capsid,terminase,tail,head,portal,integrase,tRNA,holin,transposase	Cronobacter_phage(52.94%)	56	1268040:1268055	1291627:1291642
WP_000615542.1|1224632_1225652_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.2	1.4e-108
WP_000185337.1|1225691_1225997_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	47.5	1.6e-15
WP_000661531.1|1226094_1226433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079960662.1|1226458_1226791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079960661.1|1226800_1227370_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.3	3.4e-43
WP_076009995.1|1227372_1227591_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.7	5.2e-05
WP_079960660.1|1227629_1230287_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	47.3	7.9e-244
WP_000088096.1|1230314_1230638_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_023210894.1|1230637_1231657_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.1	1.1e-134
WP_054175274.1|1231653_1233438_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_000273112.1|1233495_1234485_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	2.5e-46
WP_001176503.1|1234519_1235548_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1235559_1236258_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_000491223.1|1236356_1236809_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_000080871.1|1236805_1237288_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|1237284_1237989_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_054175275.1|1239110_1239566_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1239578_1239875_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1239871_1240213_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|1240212_1240545_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|1240691_1240949_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|1241136_1243104_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|1243100_1243430_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|1243426_1244611_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_006772868.1|1244603_1245191_+	protein phage	NA	F1BUK5	Cronobacter_phage	81.5	2.4e-89
WP_054175279.1|1245200_1247213_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1247215_1247746_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267951.1|1247735_1248461_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_151398038.1|1253832_1254147_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_154074716.1|1254143_1254965_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000178449.1|1255168_1255507_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197660.1|1255778_1256516_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1256647_1257628_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992639.1|1257624_1258356_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235094.1|1258485_1261059_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_000985653.1|1266929_1267385_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_000807809.1|1267488_1268790_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
1268040:1268055	attL	GCAGCAGGTTCTGGAC	NA	NA	NA	NA
WP_001264473.1|1268786_1269110_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1269154_1270510_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082639.1|1270624_1273285_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183639.1|1273338_1274019_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098732.1|1274091_1274511_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1274714_1275752_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1275867_1276557_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1276875_1277259_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1277320_1277908_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1278010_1278910_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1278927_1280262_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1280392_1281130_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1281114_1282737_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1283000_1283165_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1283161_1283737_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1283768_1284419_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1284418_1285375_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1285371_1285851_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1286348_1287578_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
1291627:1291642	attR	GCAGCAGGTTCTGGAC	NA	NA	NA	NA
>prophage 4
NZ_CP045952	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 chromosome, complete genome	5022086	1293922	1333509	5022086	capsid,terminase,lysis,tail,head,portal,holin,transposase	Salmonella_phage(46.34%)	48	NA	NA
WP_000917562.1|1293922_1294081_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001009037.1|1294479_1294884_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000869364.1|1295013_1295250_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|1295215_1295590_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_154074718.1|1295674_1296658_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	4.7e-162
WP_000800010.1|1296660_1297410_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1297420_1297768_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1297764_1298289_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1298288_1298762_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_001217666.1|1299626_1299866_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_001574100.1|1299855_1300161_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
WP_000929803.1|1300200_1300803_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001096550.1|1301011_1301623_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1301619_1301760_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1301756_1302434_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1302706_1303270_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1303776_1303965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574216.1|1305140_1305470_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_154074719.1|1305453_1305903_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	96.6	2.0e-75
WP_001533543.1|1305920_1306373_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1306608_1307010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1307296_1307842_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1307813_1309745_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1309728_1309932_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1309928_1311509_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1311498_1312995_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1313007_1313355_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1313409_1314438_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1314495_1314855_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1314865_1315249_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1315276_1315855_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1315903_1317034_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1317142_1317544_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_077248250.1|1317551_1318298_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000479607.1|1318348_1318744_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1318740_1319079_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372065.1|1319050_1322146_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_000447369.1|1322148_1322478_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1322487_1323186_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1323192_1323930_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1323827_1324475_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000178853.1|1327938_1328181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000593433.1|1330601_1331426_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1331415_1331994_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1332090_1332318_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1332424_1332637_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|1332699_1332765_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_015589559.1|1333344_1333509_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP045952	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 chromosome, complete genome	5022086	1705526	1737546	5022086	holin,protease,transposase,tail	Salmonella_phage(36.36%)	29	NA	NA
WP_000781589.1|1705526_1706021_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1706434_1706926_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1706915_1707179_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000091673.1|1709667_1710363_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1710349_1711219_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1711334_1711784_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1711793_1712396_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_001747978.1|1714512_1714686_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_154074721.1|1715205_1715466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154074722.1|1715465_1716353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154074723.1|1717085_1717643_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_154074724.1|1717639_1718683_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001115498.1|1718726_1719374_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1720103_1720667_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_039026397.1|1720825_1721647_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_151398038.1|1721643_1721958_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001653202.1|1722075_1722279_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1722581_1723373_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1723669_1723873_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1725256_1727623_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1727951_1728941_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1728955_1729324_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1729352_1730684_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1730980_1731310_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_001215679.1|1733145_1733673_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1734050_1734494_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1734547_1736377_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1736724_1737015_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1737042_1737546_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 6
NZ_CP045952	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 chromosome, complete genome	5022086	1810766	1819937	5022086	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1810766_1811714_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1811697_1812429_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1812409_1812517_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1812576_1813308_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1813530_1815216_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1815212_1815932_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1815978_1816446_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1816502_1817033_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1817204_1817663_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1817903_1819937_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 7
NZ_CP045952	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 chromosome, complete genome	5022086	1891899	1902405	5022086		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1891899_1893303_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1893480_1894374_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1894750_1895836_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1895835_1896735_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1896782_1897661_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1897661_1898213_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1898218_1899211_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1899207_1899981_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1899985_1901065_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1901091_1902405_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 8
NZ_CP045952	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 chromosome, complete genome	5022086	1935248	1956552	5022086	holin,terminase	Salmonella_phage(50.0%)	31	NA	NA
WP_023239959.1|1935248_1935599_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.4e-60
WP_000438989.1|1936176_1936383_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	9.6e-17
WP_000091280.1|1936409_1936844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000439725.1|1936845_1937271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079793610.1|1937313_1937781_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	86.5	1.9e-68
WP_000145711.1|1937794_1938022_+	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_072102773.1|1937987_1938362_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	5.6e-63
WP_000024043.1|1938453_1939290_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.4	7.6e-52
WP_000801765.1|1939286_1939982_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.9	2.5e-56
WP_000025838.1|1939995_1940253_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	90.6	4.7e-37
WP_000664373.1|1940249_1940864_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	65.8	1.7e-72
WP_012218646.1|1940860_1941334_+	ead/Ea22-like family protein	NA	A0A1R3Y5T1	Salmonella_virus	71.2	5.6e-36
WP_000662461.1|1942238_1942796_+	DUF551 domain-containing protein	NA	A0A220NQT9	Salmonella_phage	92.8	1.7e-95
WP_001220318.1|1942894_1943161_+	hypothetical protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
WP_001217669.1|1943316_1943550_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1943666_1943915_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929802.1|1943949_1944552_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_058665211.1|1944760_1945372_+	protein ninG	NA	A0A0M4RU10	Salmonella_phage	98.5	3.6e-91
WP_001617856.1|1945368_1945515_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_058665209.1|1945504_1946302_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	97.4	2.4e-148
WP_000781783.1|1946561_1946909_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	1.3e-45
WP_154074726.1|1946911_1947523_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	65.7	1.6e-70
WP_058665206.1|1947519_1948071_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_058665204.1|1948060_1948462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154631.1|1948522_1949497_+|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	37.7	5.6e-30
WP_154074727.1|1949486_1950758_+	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.1	1.1e-83
WP_001150142.1|1950757_1952188_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.9	2.6e-92
WP_010835735.1|1952159_1953035_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	45.8	1.2e-55
WP_154074728.1|1953035_1954610_+	NUDIX domain-containing protein	NA	Q6UJ14	Burkholderia_virus	48.6	1.7e-20
WP_023181116.1|1954630_1955503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110972.1|1955520_1956552_+	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.5	1.5e-73
>prophage 9
NZ_CP045952	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 chromosome, complete genome	5022086	2034567	2094538	5022086	capsid,terminase,tail,plate,head,portal,integrase,protease,holin,transposase	Salmonella_phage(77.27%)	79	2076338:2076397	2093690:2093756
WP_001219015.1|2034567_2035041_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|2035688_2035979_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|2036350_2037148_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|2037439_2038429_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|2038430_2038673_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061334.1|2038697_2039267_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_020899398.1|2039270_2039852_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_000224241.1|2039862_2040120_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|2040121_2040655_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008351.1|2040725_2041265_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080416.1|2041401_2042229_-	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000997191.1|2042286_2042658_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_023891434.1|2043197_2043422_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|2043384_2043723_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|2043928_2044624_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|2044721_2044946_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|2044974_2045529_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001087404.1|2045525_2046668_+	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000620702.1|2046664_2046889_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_033567233.1|2046885_2047860_+	protein phage	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000054228.1|2047856_2048330_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567232.1|2048326_2049202_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000779148.1|2049210_2049600_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_001061452.1|2049616_2050477_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_020899401.1|2051485_2052238_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|2052388_2052646_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|2052791_2053178_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|2053164_2053446_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|2053445_2054060_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|2054056_2054449_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_154074765.1|2054911_2055205_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	98.8	8.0e-41
WP_154074716.1|2055513_2056335_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_001135098.1|2056512_2056863_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929191.1|2056988_2057483_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_033567282.1|2057479_2059213_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000605609.1|2059224_2059407_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466255.1|2059406_2060648_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_033567207.1|2060625_2061276_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_033572441.1|2061290_2062496_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033572442.1|2062545_2062746_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_000927721.1|2062748_2063072_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033567256.1|2063068_2063473_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_033567257.1|2063444_2063957_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_000779213.1|2063953_2064511_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_065305283.1|2064532_2064697_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_033567258.1|2064686_2066183_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000515953.1|2066182_2066539_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_000588852.1|2066535_2066862_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785381.1|2066946_2068872_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_001033736.1|2068888_2069338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033567259.1|2069397_2070738_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001066632.1|2070734_2071793_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_001273649.1|2071792_2072326_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605055.1|2072330_2072744_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_000785581.1|2072736_2073816_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_001207832.1|2073818_2074406_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554735.1|2074392_2075955_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
2076338:2076397	attL	TGTAATGACCCAGCCGTTCCTGCACAACTAAGCGGCTTCGGCATAGGCCTGCGCCGGTGT	NA	NA	NA	NA
WP_154074766.1|2076405_2076891_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000836773.1|2077808_2078042_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|2078116_2078230_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|2078277_2078691_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|2078687_2078900_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000500831.1|2080093_2080255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|2080381_2080801_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|2080803_2082072_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|2082526_2082739_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2082749_2082938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|2083198_2084395_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|2085044_2085344_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|2085435_2086131_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|2086204_2087635_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000785978.1|2087615_2088086_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001212264.1|2088074_2088995_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000929134.1|2089170_2090082_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001178599.1|2090098_2090344_+	YodC family protein	NA	NA	NA	NA	NA
WP_001119821.1|2090508_2092221_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_000948794.1|2092199_2093015_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844798.1|2093324_2093552_-	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_154074716.1|2093716_2094538_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
2093690:2093756	attR	TGTAATGACCCAGCCGTTCCTGCACAACTAAGCGGCTTCGGCATAGGCCTGCGCCGGTGTTTTCATC	NA	NA	NA	NA
>prophage 10
NZ_CP045952	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 chromosome, complete genome	5022086	2160067	2216177	5022086	integrase,transposase,tail,tRNA	Klebsiella_phage(16.67%)	57	2187761:2187775	2212756:2212770
WP_001025361.1|2160067_2161801_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	3.7e-85
WP_000024794.1|2162037_2162607_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185770.1|2162626_2163373_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_000569041.1|2163608_2164580_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019609.1|2164576_2165320_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	5.4e-25
WP_000252975.1|2165360_2165756_-	membrane protein	NA	NA	NA	NA	NA
WP_000639226.1|2165808_2166627_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	4.5e-57
WP_000916144.1|2166623_2167190_-	hydrolase	NA	NA	NA	NA	NA
WP_001258636.1|2167514_2169287_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000653693.1|2169389_2169842_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907242.1|2169871_2170612_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000022509.1|2170648_2171170_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_000716748.1|2171171_2171771_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_010989032.1|2172397_2173294_-	DUF4034 domain-containing protein	NA	NA	NA	NA	NA
WP_000580335.1|2173713_2174325_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568508.1|2174333_2175344_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.4	2.4e-07
WP_000571508.1|2175422_2176208_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000203014.1|2176204_2176960_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.4	2.2e-18
WP_000939597.1|2177038_2177983_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184028.1|2177998_2179318_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	2.6e-14
WP_000448401.1|2179434_2180406_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091156.1|2180478_2181921_-	pyruvate kinase II	NA	NA	NA	NA	NA
WP_001056720.1|2182044_2182914_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301711.1|2183255_2184731_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	2.6e-79
WP_001069113.1|2184965_2186777_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800497.1|2186814_2187456_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173431.1|2187555_2188734_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
2187761:2187775	attL	ACGGCCGAGGCAGCG	NA	NA	NA	NA
WP_000257723.1|2188864_2189155_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001042119.1|2189222_2189576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000024706.1|2189669_2190329_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936999.1|2190541_2192593_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944282.1|2192627_2193326_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	2.8e-07
WP_000100258.1|2193349_2194006_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000856224.1|2194113_2194344_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2194481_2194856_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2194856_2195732_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2195748_2196102_+	YebY family protein	NA	NA	NA	NA	NA
WP_001520095.1|2196475_2197330_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2197389_2197884_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2198073_2198304_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2198357_2198891_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2199147_2199315_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2199379_2199568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074732.1|2201986_2202874_+|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_010989029.1|2202970_2203171_-	PhoPQ-activated virulence protein PagK	NA	NA	NA	NA	NA
WP_000457876.1|2203740_2203866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848069.1|2205013_2205628_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000480735.1|2205637_2205796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233446.1|2205928_2206843_-	DMT family transporter	NA	NA	NA	NA	NA
WP_151398038.1|2207202_2207517_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_050955884.1|2209373_2209742_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	47.5	1.5e-23
WP_001617922.1|2211205_2211346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001752421.1|2211511_2211781_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
WP_154074716.1|2212407_2213229_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
2212756:2212770	attR	CGCTGCCTCGGCCGT	NA	NA	NA	NA
WP_000030934.1|2214172_2214649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074733.1|2214978_2215353_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	33.0	1.1e-13
WP_039026397.1|2215355_2216177_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP045952	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 chromosome, complete genome	5022086	3008524	3101417	5022086	terminase,lysis,tail,integrase,protease,tRNA,holin	Salmonella_phage(56.41%)	83	3032618:3032637	3098490:3098509
WP_000938191.1|3008524_3009205_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|3009825_3010485_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|3010571_3010901_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|3010897_3011179_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|3011227_3012007_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|3012032_3012581_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|3012795_3014007_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|3014064_3014382_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|3014426_3014843_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|3015013_3015676_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|3015770_3016229_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|3016264_3018319_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|3018442_3018889_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|3018907_3021061_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|3021047_3021653_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|3021869_3022379_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|3022735_3023788_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|3023859_3024312_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|3024497_3026258_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|3026326_3026845_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|3026944_3027112_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_033567177.1|3027367_3027931_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|3027927_3029568_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|3029572_3030826_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|3030840_3032748_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
3032618:3032637	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|3032760_3034869_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|3034967_3036077_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|3036073_3036616_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|3036781_3037792_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|3037999_3040612_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|3041038_3041230_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|3041500_3042187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603423.1|3042171_3042471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|3042539_3043166_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001692088.1|3043813_3044674_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.3	1.2e-169
WP_000143167.1|3045255_3045837_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_154074744.1|3045836_3047204_-	shikimate transporter	NA	E5G6P0	Salmonella_phage	51.2	2.7e-78
WP_000178849.1|3048330_3048573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033415.1|3048611_3051962_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_001576012.1|3052033_3052738_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|3052635_3053373_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|3053382_3054078_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|3054167_3054701_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|3054817_3055315_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_020899435.1|3055414_3055747_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000867564.1|3056867_3057413_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_024143045.1|3057881_3058328_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_077248428.1|3058779_3059109_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_001141973.1|3059384_3060071_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|3060431_3060881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|3061016_3061142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000801757.1|3062021_3062162_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_000929788.1|3062974_3063577_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_000763780.1|3063661_3063883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|3063992_3064226_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_136571508.1|3065623_3066190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|3066201_3067179_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001536080.1|3067233_3067491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208142.1|3067490_3068135_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_000850457.1|3068138_3068447_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000065109.1|3068450_3068909_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_154074745.1|3068877_3069252_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.2	1.1e-50
WP_000800012.1|3069262_3070012_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000426364.1|3071080_3071401_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_001555460.1|3071435_3071663_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|3071768_3072203_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_023139985.1|3072678_3073029_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_001237031.1|3077512_3077752_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|3077792_3078041_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_020899445.1|3078085_3079378_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_154074746.1|3079572_3080775_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000544849.1|3083750_3084965_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|3085281_3085743_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|3085943_3087344_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|3087950_3089042_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|3089226_3090417_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109471.1|3090478_3091126_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|3091153_3091702_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|3091961_3093803_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572724.1|3094147_3098614_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
3098490:3098509	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_000060025.1|3098613_3099318_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|3099298_3100621_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|3100613_3101417_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP045952	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 chromosome, complete genome	5022086	3151480	3160211	5022086	protease,transposase	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3151480_3152735_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_137024714.1|3153198_3153693_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.4e-13
WP_000934063.1|3153847_3156124_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3156154_3156475_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3156798_3157020_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3157149_3159096_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3159092_3160211_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 13
NZ_CP045952	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 chromosome, complete genome	5022086	3565631	3627302	5022086	protease,transposase,tRNA	Planktothrix_phage(18.18%)	55	NA	NA
WP_001154078.1|3565631_3566726_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000342247.1|3566764_3567424_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569660.1|3567416_3568433_-	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-32
WP_000524317.1|3568469_3569300_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000152869.1|3569556_3570690_-	porin	NA	NA	NA	NA	NA
WP_000561776.1|3570875_3573290_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110598.1|3573286_3573973_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.1e-31
WP_001010574.1|3573943_3574558_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001172802.1|3574712_3575483_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000116058.1|3575542_3576397_+	chaperedoxin	NA	NA	NA	NA	NA
WP_001002130.1|3576482_3577262_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000140195.1|3577248_3577926_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	32.5	3.0e-22
WP_000906146.1|3578072_3578990_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_000561177.1|3578986_3579439_+	NfeD family protein	NA	NA	NA	NA	NA
WP_001026760.1|3579439_3579856_-	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
WP_000083899.1|3579965_3582467_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.4	6.1e-113
WP_151398038.1|3582954_3583269_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_154074716.1|3583265_3584087_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000421859.1|3584750_3585545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186618.1|3585746_3586226_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_020899464.1|3586342_3587995_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_001251593.1|3588167_3589388_+	MFS transporter	NA	NA	NA	NA	NA
WP_000546207.1|3589602_3591279_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_000671592.1|3591327_3592632_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_000801786.1|3592784_3593756_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.4	6.6e-15
WP_001250078.1|3593752_3594715_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220237.1|3594943_3595588_-	adenylate kinase	NA	NA	NA	NA	NA
WP_001520210.1|3595828_3597703_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.9	7.5e-116
WP_001195023.1|3597813_3598419_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|3598418_3598748_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000121962.1|3598793_3600722_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	2.3e-43
WP_000127350.1|3600835_3601387_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	1.0e-28
WP_001189860.1|3601539_3601917_-	DUF454 family protein	NA	NA	NA	NA	NA
WP_000926658.1|3601997_3602513_+	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_000051161.1|3602526_3602694_+	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_000440523.1|3602763_3603699_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	1.3e-63
WP_000178249.1|3603740_3607103_-	mechanosensitive channel MscK	NA	NA	NA	NA	NA
WP_000101755.1|3607221_3607875_-	multidrug efflux transporter transcriptional repressor AcrR	NA	NA	NA	NA	NA
WP_001039202.1|3608016_3609210_+	multidrug efflux RND transporter periplasmic adaptor subunit AcrA	NA	NA	NA	NA	NA
WP_151398038.1|3612058_3612373_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000344807.1|3614093_3614468_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_001280991.1|3614495_3614714_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001278792.1|3614892_3615444_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_000136181.1|3615560_3616031_+	membrane protein	NA	NA	NA	NA	NA
WP_001197749.1|3616086_3616227_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000801415.1|3616232_3616493_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000213139.1|3616717_3618268_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000961285.1|3618498_3618888_+	MGMT family protein	NA	NA	NA	NA	NA
WP_000779803.1|3618920_3619490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000084180.1|3619704_3620565_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_000684912.1|3620664_3621951_-	ammonium transporter AmtB	NA	NA	NA	NA	NA
WP_000780341.1|3621982_3622321_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_001256070.1|3622533_3624315_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	5.4e-39
WP_022630944.1|3624307_3626080_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	4.7e-51
WP_151398038.1|3626987_3627302_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP045952	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 chromosome, complete genome	5022086	3780809	3875020	5022086	terminase,lysis,plate,portal,integrase,protease,transposase,coat	Salmonella_phage(51.72%)	103	3767628:3767644	3837831:3837847
3767628:3767644	attL	ACGCGAATTTCAATATC	NA	NA	NA	NA
WP_154074752.1|3780809_3781295_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_154074753.1|3781189_3781429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000532175.1|3782374_3782626_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
WP_001085430.1|3782725_3782905_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_151398038.1|3783160_3783475_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_154074716.1|3783471_3784293_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000889769.1|3784531_3784861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262317.1|3784878_3786792_-	hypothetical protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
WP_033572424.1|3786791_3788075_-	DNA injection protein	NA	E7C9U5	Salmonella_phage	94.7	4.5e-221
WP_000964900.1|3788085_3788775_-	hypothetical protein	NA	E7C9U4	Salmonella_phage	100.0	4.3e-109
WP_000627695.1|3788777_3789233_-	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
WP_022631116.1|3789232_3789934_-	hypothetical protein	NA	B8K1I3	Salmonella_phage	98.7	1.8e-70
WP_033572423.1|3789937_3791356_-	Packaged DNA stabilization protein gp10	NA	A0A220NQZ5	Salmonella_phage	99.6	5.4e-276
WP_001166093.1|3791315_3791816_-	packaged DNA stabilization protein p27	NA	E7C9U0	Salmonella_phage	100.0	2.5e-90
WP_000538674.1|3791799_3792360_-	hypothetical protein	NA	E7C9T9	Salmonella_phage	100.0	1.3e-103
WP_022630931.1|3792400_3793693_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	99.5	1.2e-242
WP_006831698.1|3793692_3794604_-	scaffolding protein	NA	Q5C834	Enterobacteria_phage	100.0	1.7e-161
WP_000774652.1|3794617_3796795_-|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000417860.1|3796794_3798294_-|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000729923.1|3798271_3798760_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3798763_3799168_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3799167_3799557_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3799560_3799803_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_015995148.1|3800025_3800556_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	100.0	1.3e-94
WP_001687043.1|3800768_3801236_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3801232_3801730_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3801707_3801911_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_033572422.1|3802447_3803221_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	96.5	1.2e-128
WP_023217800.1|3803378_3803621_-	hypothetical protein	NA	A0A1V0E5R3	Salmonella_phage	92.5	1.3e-36
WP_033572421.1|3803617_3803800_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	95.0	3.6e-23
WP_023250726.1|3804238_3804475_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	97.4	3.9e-38
WP_033572420.1|3804467_3804644_-	protein ninF	NA	A0A192Y808	Salmonella_phage	91.4	6.9e-24
WP_033572419.1|3804636_3805038_-	hypothetical protein	NA	G9L690	Escherichia_phage	85.7	2.7e-63
WP_000113767.1|3805040_3805217_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	98.3	7.9e-28
WP_001573980.1|3805353_3806226_-	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
WP_000736920.1|3806222_3806663_-	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	98.6	2.9e-79
WP_001248409.1|3806736_3808113_-	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	99.3	4.8e-253
WP_000067076.1|3808109_3808943_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	99.6	2.4e-151
WP_001125981.1|3808935_3809082_-	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_001103492.1|3811070_3811352_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000067726.1|3811462_3811678_-	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_023135942.1|3811796_3812459_+	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	100.0	1.7e-126
WP_033572418.1|3812810_3813113_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	97.0	6.3e-49
WP_033572417.1|3813125_3813713_-	superinfection exclusion protein B	NA	A0A0M4R594	Salmonella_phage	99.0	6.2e-85
WP_154074716.1|3813973_3814795_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_154074754.1|3815103_3815622_+	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	44.6	3.3e-29
WP_033572415.1|3815655_3815943_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	97.9	1.1e-47
WP_001539176.1|3816262_3816436_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.6e-23
WP_000156731.1|3816416_3816605_+	hypothetical protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_033572414.1|3816734_3817442_+	recombinase	NA	A0A1R3Y600	Salmonella_virus	98.7	2.9e-137
WP_001111312.1|3817772_3818066_+	DUF2856 family protein	NA	A0A1R3Y5T7	Salmonella_virus	100.0	3.2e-50
WP_001214769.1|3818076_3818247_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	94.6	5.7e-23
WP_050517928.1|3818243_3818768_+	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	96.9	4.2e-48
WP_033572413.1|3818764_3819670_+	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	95.4	5.3e-51
WP_033572412.1|3819671_3819890_+	DUF4014 domain-containing protein	NA	C6ZR28	Salmonella_phage	98.6	3.7e-35
WP_033572411.1|3819893_3820565_+	DUF550 domain-containing protein	NA	A0A220NQU1	Salmonella_phage	64.6	5.6e-90
WP_001277764.1|3821191_3821371_+	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	100.0	1.9e-29
WP_033572425.1|3821471_3822101_+	hypothetical protein	NA	A0A220NQT7	Salmonella_phage	96.7	7.3e-116
WP_033572410.1|3822330_3823494_+|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	99.5	5.3e-229
WP_000893231.1|3823699_3824950_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|3824961_3826065_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_154074716.1|3827296_3828118_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000174696.1|3828667_3829069_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189588.1|3829126_3830371_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001292018.1|3830459_3830918_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292977.1|3831166_3832624_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602086.1|3832779_3833394_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_048307383.1|3834741_3835746_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001225658.1|3836045_3836786_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333387.1|3836756_3837524_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284051.1|3837736_3838315_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
3837831:3837847	attR	ACGCGAATTTCAATATC	NA	NA	NA	NA
WP_000973041.1|3838554_3840999_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000015789.1|3841107_3841875_+	amidohydrolase	NA	NA	NA	NA	NA
WP_000788200.1|3842245_3842653_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_022630913.1|3842983_3843703_+	adhesin/invasin protein PagN	NA	NA	NA	NA	NA
WP_001575654.1|3843706_3843922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000970302.1|3844038_3844986_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001550229.1|3845460_3845721_-	transcriptional activator PerC	NA	NA	NA	NA	NA
WP_000119390.1|3845800_3846622_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000266939.1|3847027_3847498_-	pilin structural protein SafD	NA	NA	NA	NA	NA
WP_000669634.1|3847519_3850030_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001535430.1|3850053_3850791_-	pili assembly chaperone PapD	NA	NA	NA	NA	NA
WP_077248260.1|3850874_3851387_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_001738030.1|3852893_3853142_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_010988969.1|3853243_3853552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088131292.1|3853634_3853808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000994224.1|3853992_3854268_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_000943619.1|3854320_3854758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000935097.1|3855320_3855767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010988968.1|3855760_3856501_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	51.8	2.0e-27
WP_154074716.1|3856918_3857740_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000932531.1|3857912_3858176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000272656.1|3858169_3862264_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.5	2.3e-24
WP_000375832.1|3862282_3862729_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_000011534.1|3862752_3864942_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_077248259.1|3865338_3865860_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_001596567.1|3865883_3866300_-	DUF2195 family protein	NA	NA	NA	NA	NA
WP_001254137.1|3866296_3867085_-	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
WP_022630910.1|3867084_3870930_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000227044.1|3870963_3871395_-	Shiga toxin A subunit	NA	NA	NA	NA	NA
WP_000976553.1|3871597_3872371_-	membrane protein	NA	NA	NA	NA	NA
WP_000132483.1|3872375_3873680_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_000118732.1|3873676_3875020_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 15
NZ_CP045952	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 chromosome, complete genome	5022086	4582636	4647005	5022086	plate,transposase,tail,tRNA	Burkholderia_phage(34.62%)	67	NA	NA
WP_151398038.1|4582636_4582951_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_154074716.1|4582947_4583769_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_154074760.1|4583724_4583895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389233.1|4583891_4584524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039026397.1|4584807_4585629_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000168322.1|4586779_4587310_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	88.9	3.9e-54
WP_000357724.1|4587557_4590383_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	0.0e+00
WP_000432207.1|4590514_4590970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000146593.1|4590956_4591295_+	membrane protein	NA	NA	NA	NA	NA
WP_000155666.1|4591295_4591652_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000270393.1|4591654_4592071_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_000724435.1|4592199_4592913_-	class B acid phosphatase	NA	NA	NA	NA	NA
WP_000486903.1|4593099_4594293_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_001147297.1|4594478_4595558_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	1.2e-28
WP_000918353.1|4595589_4597005_-	replicative DNA helicase DnaB	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_000235551.1|4597069_4598053_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891414.1|4598227_4598470_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_001182237.1|4598637_4599636_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4599723_4601034_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4601280_4601796_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4601894_4602104_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4602125_4602239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4602235_4603561_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4603739_4604348_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4604456_4604825_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4604995_4607416_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4607514_4608387_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4608400_4608898_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4609078_4609996_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4610159_4611518_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4611606_4612716_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4613077_4614268_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4614399_4615944_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4615958_4616849_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4617014_4617425_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4617567_4619664_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4619663_4620401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125572646.1|4620397_4621066_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4621099_4621342_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4621785_4623435_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4623779_4625129_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4625261_4625609_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4627508_4627796_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4627798_4628404_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4628416_4628731_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4628890_4629346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4629342_4629540_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4629529_4630957_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4630956_4631481_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4631532_4631850_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4631809_4631938_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4632034_4634389_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4634388_4635342_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4635341_4635551_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4635538_4636582_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4636591_4637314_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4637641_4638004_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4638000_4638930_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4638929_4640477_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4640640_4641000_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4640990_4642106_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4642098_4642731_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4642733_4644479_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4644483_4645089_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4645085_4645541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4645789_4646080_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4646276_4647005_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP045953	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 plasmid pAUSMDU00008979_01, complete sequence	144821	38404	87234	144821	transposase	Escherichia_phage(36.36%)	52	NA	NA
WP_001067858.1|38404_39109_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001333231.1|39269_39479_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_065800292.1|39524_40046_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	36.4	8.1e-20
WP_000392235.1|41095_41773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139341.1|42402_42963_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_015059122.1|43017_43764_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.6	1.7e-07
WP_015059123.1|43783_49054_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000009364.1|49053_51261_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000850424.1|51513_52245_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_031943494.1|52258_52768_-	conjugal transfer entry exclusion protein TraS	NA	NA	NA	NA	NA
WP_001007045.1|52764_55590_-	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_154074716.1|56037_56859_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	28.7	6.0e-09
WP_154074770.1|56855_58181_-	F-type conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010379880.1|58177_58540_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000059821.1|58469_59015_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_000624109.1|59001_59286_-	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_001287891.1|59404_59752_-	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_001430248.1|59767_60511_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_000864352.1|60503_60761_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_000821821.1|60787_62596_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_000777692.1|62592_63231_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_000830839.1|63239_64232_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_001203720.1|64228_64861_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_000214092.1|64857_65244_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_000069764.1|65240_67871_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_000836675.1|67996_68359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059129.1|68680_69157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278695.1|69149_69371_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	4.4e-07
WP_015059130.1|69505_70021_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001038342.1|70017_70269_-	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_071594066.1|70261_70615_-	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_000002787.1|70568_71159_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_000146685.1|71148_72576_-	protein TraB	NA	NA	NA	NA	NA
WP_148713163.1|72575_73280_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000399792.1|73290_73857_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000012106.1|73878_74190_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000340272.1|74204_74564_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_001254386.1|74597_74825_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000332484.1|74918_75605_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000124981.1|75795_76179_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_031943493.1|76455_77103_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001234469.1|77399_78221_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_154074774.1|78338_78629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|78679_79384_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000587837.1|80099_80642_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|80654_81515_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_154074771.1|81657_81828_+	hypothetical protein	NA	A4KWT9	Enterobacteria_phage	100.0	1.1e-05
WP_001067858.1|81773_82478_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_039026394.1|82801_84427_+	phosphoethanolamine--lipid A transferase MCR-3.1	NA	NA	NA	NA	NA
WP_039026395.1|84544_84925_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_039026397.1|85429_86251_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	28.7	3.5e-09
WP_154074772.1|86529_87234_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	4.5e-138
