The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045949	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 chromosome, complete genome	4865665	1132472	1237953	4865665	terminase,portal,integrase,head,capsid,transposase,tRNA,tail	Cronobacter_phage(61.7%)	96	1177000:1177047	1208901:1208948
WP_085983317.1|1132472_1133635_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
WP_000073810.1|1133913_1135896_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000061088.1|1135892_1136531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001738699.1|1138254_1138851_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	90.8	7.7e-99
WP_010989066.1|1139428_1140712_+	membrane protein	NA	NA	NA	NA	NA
WP_001521074.1|1140971_1142846_-	membrane protein	NA	NA	NA	NA	NA
WP_000088556.1|1143011_1143887_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000021514.1|1145003_1146683_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000819716.1|1146905_1148447_+	PTS glucose transporter subunit IIABC	NA	NA	NA	NA	NA
WP_000811366.1|1148576_1149419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682344.1|1149418_1149982_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000776032.1|1150005_1150641_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_000889012.1|1150714_1151917_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001033832.1|1152211_1153225_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098984.1|1153235_1154216_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000973738.1|1154212_1154587_-	PTS sorbitol transporter	NA	NA	NA	NA	NA
WP_000480483.1|1154583_1155105_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000749979.1|1155217_1155502_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_010989065.1|1155596_1155953_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989064.1|1156106_1156925_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_001520831.1|1156969_1158253_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001520307.1|1158755_1160825_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_000701821.1|1160860_1161076_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001161781.1|1161526_1162354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|1162688_1163882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989063.1|1164271_1164865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542209.1|1164911_1165079_-	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_001542208.1|1165092_1166157_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
WP_000783717.1|1166648_1168982_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.7	0.0e+00
WP_000795388.1|1168996_1169317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001216603.1|1169313_1169541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701354.1|1169537_1170089_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_000149860.1|1170889_1171627_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	9.0e-81
WP_000984209.1|1171623_1171866_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	77.8	5.2e-30
WP_000210082.1|1171882_1172449_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	4.1e-57
WP_000562051.1|1172902_1173163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200483.1|1173165_1173714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000628291.1|1173700_1173934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001238818.1|1173920_1175618_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_000124715.1|1175621_1176818_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.9	1.4e-107
1177000:1177047	attL	ATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001738702.1|1177158_1178136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001738703.1|1178138_1179170_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUN9	Cronobacter_phage	84.9	1.6e-173
WP_024137082.1|1179169_1179736_-	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	59.1	3.7e-66
WP_001738705.1|1180122_1180626_+	phage protein	NA	F1BUN6	Cronobacter_phage	72.5	4.5e-60
WP_001738708.1|1180820_1181249_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	58.2	4.9e-31
WP_001738709.1|1181248_1181650_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	65.4	1.6e-47
WP_001738711.1|1181717_1181951_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_001738712.1|1181941_1182811_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	81.0	1.9e-130
WP_001738714.1|1182807_1183020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031247519.1|1183021_1185037_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
WP_001739154.1|1185152_1185371_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	47.2	3.6e-06
WP_012602735.1|1185344_1185668_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	93.3	4.7e-50
WP_001738716.1|1185664_1186726_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.3	5.5e-164
WP_001738718.1|1186722_1188498_-	Terminase ATPase subunit from bacteriophage origin	NA	F1BUM5	Cronobacter_phage	83.4	1.5e-291
WP_001738719.1|1188659_1189463_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.8	1.3e-80
WP_001738720.1|1189524_1190547_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.8	3.0e-159
WP_001738722.1|1190550_1191252_+|terminase	terminase endonuclease subunit from bacteriophage origin	terminase	F1BUM0	Cronobacter_phage	69.0	1.3e-89
WP_020978745.1|1191312_1191801_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.1e-63
WP_001738725.1|1191797_1192304_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	68.7	6.2e-65
WP_001738727.1|1192300_1193008_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	75.6	3.7e-100
WP_001738729.1|1193004_1194132_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	81.6	2.4e-173
WP_000044253.1|1194128_1194584_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.8	5.9e-59
WP_001738730.1|1194594_1194897_+	Holin from bacteriophage origin	NA	A0A0M5M1H1	Salmonella_phage	55.3	1.4e-19
WP_000175561.1|1194883_1195225_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	94.1	6.9e-52
WP_001738731.1|1195224_1195605_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	64.0	2.4e-29
WP_154074052.1|1195709_1195967_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	56.1	5.4e-17
WP_001738733.1|1196154_1198215_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.6	6.2e-273
WP_000004502.1|1198211_1198541_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	68.8	9.3e-38
WP_001738734.1|1198537_1199722_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	80.7	5.5e-181
WP_001738736.1|1199714_1200302_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	7.6e-91
WP_001738737.1|1200312_1202364_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	82.6	9.7e-133
WP_001738738.1|1202365_1202806_+|tail	phage tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	29.8	4.3e-06
WP_001738739.1|1202795_1203521_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	54.4	1.2e-64
WP_001738740.1|1203492_1204038_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	73.6	7.9e-66
WP_001738741.1|1204040_1205741_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	77.4	4.1e-222
WP_001738742.1|1205846_1206179_+	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	50.9	2.2e-23
WP_001738744.1|1206783_1207842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001738745.1|1207995_1208805_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_077910743.1|1209337_1210501_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1208901:1208948	attR	ATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000196159.1|1210508_1212689_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533858.1|1212685_1214095_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237670.1|1214159_1225634_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1226247_1226730_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1226879_1227356_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1227345_1227636_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1227801_1228140_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1228288_1229950_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1230035_1230914_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1231036_1231627_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287923.1|1231661_1232267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1232387_1233674_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1233693_1234485_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1234650_1236012_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1236325_1236574_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1236592_1237141_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1237185_1237953_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP045949	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 chromosome, complete genome	4865665	1264762	1371860	4865665	lysis,terminase,protease,holin,portal,integrase,head,capsid,transposase,tRNA,tail	Salmonella_phage(33.33%)	112	1256843:1256859	1347300:1347316
1256843:1256859	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_001740919.1|1264762_1265800_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1265915_1266605_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1266923_1267307_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1267368_1267956_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1268058_1268958_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1268975_1270310_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1270440_1271178_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_014344135.1|1273047_1273212_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1273208_1273784_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1273815_1274466_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1274465_1275422_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1275418_1275898_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1276395_1277625_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1277602_1277887_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1277927_1278167_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_014344386.1|1278209_1279367_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_020979242.1|1279329_1282257_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.2	0.0e+00
WP_001539619.1|1282383_1282734_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1282755_1282914_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_000950426.1|1283370_1284033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356948.1|1284032_1284419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111772.1|1284411_1285251_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000660736.1|1285309_1285705_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_000643689.1|1285804_1286047_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_010835408.1|1286006_1286381_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_001738749.1|1286472_1287309_+	replication protein	NA	K7PGT1	Enterobacteria_phage	48.5	4.6e-49
WP_000801764.1|1287305_1288001_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000664368.1|1288014_1288713_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000877757.1|1288820_1289453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1289695_1289929_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1290045_1290294_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929791.1|1290328_1290931_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001096550.1|1291139_1291751_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1291747_1291888_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1291884_1292562_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1292834_1293398_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1293904_1294093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1294307_1294994_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1295269_1295599_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1295582_1296035_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|1296052_1296505_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1296740_1297142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1297428_1297974_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1297945_1299877_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1299860_1300064_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_001738454.1|1300152_1301640_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	63.3	5.8e-180
WP_001189503.1|1301629_1303126_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1303138_1303486_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1303540_1304569_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1304626_1304986_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1304996_1305380_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1305407_1305986_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1306034_1307165_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1307273_1307675_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1307682_1308429_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1308479_1308875_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1308871_1309210_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372065.1|1309181_1312277_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_000447369.1|1312279_1312609_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1312618_1313317_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_015701343.1|1313323_1314061_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	3.0e-129
WP_000246126.1|1313958_1314606_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1314667_1318030_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1318068_1318311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1318364_1320737_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1320733_1321558_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1321547_1322126_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1322222_1322450_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1322556_1322769_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|1322831_1322897_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_015589559.1|1323476_1323641_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1324353_1324491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1324975_1326469_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1326873_1328673_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1328689_1329664_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1329937_1330618_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1330614_1331520_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1331531_1332260_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1332271_1333003_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1333002_1333383_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1333494_1333755_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1333792_1334719_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276370.1|1334834_1336031_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684022.1|1336052_1336970_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1337008_1337857_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1337972_1338866_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1338876_1340238_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000253558.1|1340241_1340877_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1340901_1341453_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000734248.1|1341503_1343048_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001747289.1|1343048_1343282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000970045.1|1343303_1347191_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001670672.1|1347840_1349271_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
1347300:1347316	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_001054236.1|1349272_1350037_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_000625591.1|1350033_1351371_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_000717694.1|1351447_1351786_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000856793.1|1351834_1353295_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_001100652.1|1353350_1355495_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000100008.1|1355577_1356909_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187150.1|1357269_1358814_-	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000883146.1|1358995_1360186_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919178.1|1360510_1361764_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_001173729.1|1361959_1363099_+	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000982961.1|1363093_1364371_-	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_000805728.1|1364496_1365135_+	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000111027.1|1365125_1366112_+	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000020685.1|1366112_1367126_-	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000017587.1|1367136_1367955_-	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000985204.1|1367958_1369002_-	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000174944.1|1369183_1370062_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000553467.1|1370206_1371010_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000940032.1|1371128_1371860_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP045949	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 chromosome, complete genome	4865665	1694880	1724473	4865665	holin,tail,protease	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1694880_1695375_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1695788_1696280_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1696269_1696533_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1696529_1699016_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1699022_1699718_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1699704_1700574_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1700689_1701139_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1701148_1701751_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1701771_1702389_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1702385_1703045_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1703096_1703834_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_020979162.1|1703830_1704043_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1704039_1704519_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1704515_1706447_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1706443_1707001_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001238333.1|1706997_1708041_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1708084_1708732_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1709461_1710025_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1710216_1710420_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1710722_1711514_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1711810_1712014_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1712182_1714549_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1714877_1715867_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1715881_1716250_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1716278_1717610_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1717906_1718236_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1718828_1720070_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1720072_1720600_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1720977_1721421_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1721474_1723304_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1723651_1723942_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1723969_1724473_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 4
NZ_CP045949	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 chromosome, complete genome	4865665	1796524	1805695	4865665	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_147161520.1|1796524_1797472_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.2	2.9e-23
WP_000824855.1|1797455_1798187_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1798167_1798275_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1798334_1799066_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1799288_1800974_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1800970_1801690_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1801736_1802204_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1802260_1802791_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1802962_1803421_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1803661_1805695_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP045949	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 chromosome, complete genome	4865665	1874003	1884509	4865665		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1874003_1875407_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1875584_1876478_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1876854_1877940_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1877939_1878839_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1878886_1879765_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1879765_1880317_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1880322_1881315_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1881311_1882085_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1882089_1883169_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1883195_1884509_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP045949	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 chromosome, complete genome	4865665	1970503	2020640	4865665	lysis,terminase,protease,holin,portal,integrase,head,capsid,plate,tail	Salmonella_phage(88.89%)	68	1965081:1965095	1980944:1980958
1965081:1965095	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1970503_1970977_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|1971624_1971915_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|1972286_1973084_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1973375_1974365_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|1974366_1974609_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061334.1|1974633_1975203_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000208068.1|1975206_1976040_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_000065095.1|1976036_1976654_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000071070.1|1976650_1977166_-	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000764235.1|1977162_1977393_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|1977463_1978003_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_001738355.1|1978139_1978967_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	99.6	2.9e-152
WP_001020636.1|1979597_1980293_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|1980390_1980615_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1980643_1981198_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1980944:1980958	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087402.1|1981194_1982352_+	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000620702.1|1982348_1982573_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000061500.1|1982569_1983388_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_001684745.1|1983389_1983872_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000066908.1|1983871_1984765_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001241579.1|1984761_1985151_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_001061457.1|1985167_1986028_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001202277.1|1986035_1987025_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	4.9e-191
WP_000188927.1|1987035_1987659_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001527054.1|1987791_1988049_+	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_014343859.1|1987978_1988413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001527046.1|1988574_1988919_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_001005901.1|1988921_1989536_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001050825.1|1989532_1990018_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_000877027.1|1990230_1990650_+	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001292890.1|1990869_1991172_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_001135225.1|1991232_1991583_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_000929191.1|1991708_1992203_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_000088182.1|1992199_1993933_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000605609.1|1993944_1994127_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466254.1|1994126_1995368_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_001193639.1|1995345_1995996_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000257528.1|1996010_1997216_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_000601353.1|1997266_1997467_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000927378.1|1997469_1997793_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702408.1|1997789_1998194_+|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_001135697.1|1998165_1998678_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000779218.1|1998674_1999235_+	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_000497739.1|1999238_1999403_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007991.1|1999392_2000889_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000515952.1|2000888_2001245_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|2001241_2001568_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785385.1|2001652_2003581_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000863818.1|2003614_2004955_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_001066636.1|2004951_2006010_+	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_001273649.1|2006009_2006543_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605050.1|2006547_2006961_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_014343856.1|2006932_2007478_+	phage protein	NA	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_001738350.1|2007512_2008034_+|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	99.4	1.5e-93
WP_001207832.1|2008036_2008624_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554736.1|2008610_2010173_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	7.5e-287
WP_000760554.1|2010172_2010742_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000492926.1|2011026_2012034_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|2012246_2012468_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000500831.1|2013098_2013260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|2013386_2013806_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|2013808_2015077_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|2015531_2015744_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2015754_2015943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|2016203_2017400_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|2018049_2018349_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|2018440_2019136_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|2019209_2020640_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP045949	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 chromosome, complete genome	4865665	2124684	2131493	4865665	tail,integrase	Salmonella_phage(33.33%)	11	2126894:2126916	2136609:2136631
WP_000856224.1|2124684_2124915_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2125052_2125427_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2125427_2126303_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2126319_2126673_+	YebY family protein	NA	NA	NA	NA	NA
2126894:2126916	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2127046_2127901_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2127960_2128455_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2128644_2128875_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2128928_2129462_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2129718_2129886_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2129950_2130139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2130611_2131493_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2136609:2136631	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP045949	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 chromosome, complete genome	4865665	2920698	3005434	4865665	lysis,terminase,protease,portal,holin,integrase,tRNA,tail	Salmonella_phage(44.44%)	92	2944792:2944811	3016580:3016599
WP_000938191.1|2920698_2921379_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2921999_2922659_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2922745_2923075_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2923071_2923353_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2923401_2924181_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2924206_2924755_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2924969_2926181_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2926238_2926556_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2926600_2927017_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2927187_2927850_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2927944_2928403_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2928438_2930493_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2930616_2931063_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2931081_2933235_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2933221_2933827_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2934043_2934553_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2934909_2935962_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2936033_2936486_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156453.1|2936671_2938432_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2938500_2939019_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2939118_2939286_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2939541_2940105_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2940101_2941742_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2941746_2943000_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2943014_2944922_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2944792:2944811	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2944934_2947043_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2947141_2948251_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2948247_2948790_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2948955_2949966_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2950173_2952786_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2953212_2953404_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2953674_2954361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2954345_2954645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2954713_2955340_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001533476.1|2955987_2956956_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000143167.1|2957431_2958013_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|2958012_2960451_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|2960504_2960747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033415.1|2960785_2964136_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000246065.1|2964207_2964912_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2964809_2965547_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2965556_2966252_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2966341_2966875_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2966991_2967489_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|2967587_2967920_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|2967916_2970904_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|2970983_2971313_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2971309_2971708_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|2971753_2972503_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|2972514_2972916_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|2972912_2973479_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2973459_2973759_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2973751_2974075_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2974165_2976247_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_077679777.1|2976170_2977688_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_000196190.1|2977714_2977921_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2977917_2980056_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2980012_2980546_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_031248426.1|2980753_2981233_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	75.0	2.3e-53
WP_000984581.1|2981250_2981703_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|2981686_2982016_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2982291_2982978_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2983338_2983788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2983923_2984049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2984222_2984540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2984606_2985404_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2985393_2985540_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|2985536_2986148_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_000929805.1|2986356_2986959_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2987041_2987263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2987374_2987608_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|2987899_2988190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2988267_2988579_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2988575_2988923_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|2988933_2989683_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_001738833.1|2989685_2990669_-	gifsy-1 prophage PrpO	NA	H6WRX7	Salmonella_phage	99.7	1.6e-162
WP_001574095.1|2990753_2991128_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2991093_2991333_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2991452_2991863_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_014344008.1|2991912_2992173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|2992165_2992324_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|2992345_2992645_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000017133.1|2992771_2995657_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|2995619_2996777_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2996819_2997059_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2997099_2997348_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2997392_2998685_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|2998879_3000082_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|3000159_3001596_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_147161527.1|3001840_3003055_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|3003371_3003833_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|3004033_3005434_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
3016580:3016599	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 9
NZ_CP045949	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 chromosome, complete genome	4865665	3069366	3078098	4865665	protease,transposase	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3069366_3070621_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3071084_3071543_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3071734_3074011_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3074041_3074362_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3074685_3074907_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3075036_3076983_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3076979_3078098_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 10
NZ_CP045949	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 chromosome, complete genome	4865665	4445185	4492229	4865665	tail,plate,tRNA	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4445185_4446184_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001738636.1|4446271_4447582_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4447828_4448344_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4448442_4448652_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4448673_4448787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4448783_4450109_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4450287_4450896_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4451004_4451373_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_001741029.1|4451543_4453964_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4454062_4454935_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4454948_4455446_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4455626_4456544_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4456707_4458066_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4458154_4459264_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4459625_4460816_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4460947_4462492_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4462506_4463397_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4463562_4463973_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4464115_4466212_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4466211_4466949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343934.1|4466945_4467614_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4467647_4467890_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4468333_4469983_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4470327_4471677_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4471809_4472157_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4472732_4473020_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4473022_4473628_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4473640_4473955_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4474114_4474570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4474566_4474764_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4474753_4476181_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4476180_4476705_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4476756_4477074_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4477033_4477162_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262500.1|4477258_4479613_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_000271423.1|4479612_4480566_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4480565_4480775_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4480762_4481806_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4481815_4482538_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4482865_4483228_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4483224_4484154_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4484153_4485701_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4485864_4486224_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4486214_4487330_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4487322_4487955_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4487957_4489703_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4489707_4490313_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4490309_4490765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4491013_4491304_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4491500_4492229_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP045950	Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 plasmid pAUSMDU00010529_01, complete sequence	93865	61322	70618	93865	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_000088645.1|61322_62003_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
WP_000369839.1|62384_62741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490265.1|62733_63204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925627.1|63714_64137_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000457541.1|64136_65411_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_014344447.1|65492_66470_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
WP_000427676.1|66466_67672_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|68086_69028_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|69059_69626_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|69682_70018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|70201_70618_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
