The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	1172899	1196430	5553138	tail,transposase,integrase,holin	Enterobacteria_phage(35.29%)	29	1164545:1164559	1197301:1197315
1164545:1164559	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1172899_1174105_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1174106_1175420_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1175416_1177048_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1177048_1177447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1177544_1177958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150572.1|1178353_1179634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|1179709_1180012_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1180047_1180803_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1181138_1181705_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1181679_1182291_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1182287_1182953_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1182949_1183573_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1183825_1184569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1184654_1184822_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000143068.1|1185229_1187083_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1187232_1187448_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|1187452_1187797_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_001171554.1|1188153_1188534_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1188530_1188878_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998000.1|1188927_1189572_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_001299612.1|1189378_1190269_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000165061.1|1190265_1190592_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001023396.1|1190809_1191079_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1191239_1191662_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1191791_1192850_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1192928_1193579_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1193761_1194352_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1194853_1195102_-	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1195947_1196430_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1197301:1197315	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	1421850	1536195	5553138	integrase,tRNA,portal,transposase,holin,tail,capsid,protease	Escherichia_phage(26.74%)	118	1480487:1480510	1535164:1535187
WP_000695640.1|1421850_1423266_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000604897.1|1423266_1423809_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	57.7	5.1e-41
WP_000826440.1|1423816_1425025_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	6.0e-207
WP_000826499.1|1425064_1425457_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000472021.1|1425458_1425818_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001301445.1|1426436_1428626_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_001301799.1|1428675_1429878_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_000186369.1|1430213_1431452_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_000490072.1|1431591_1431918_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000903148.1|1432032_1433289_-	ion channel protein	NA	NA	NA	NA	NA
WP_000170346.1|1433492_1434458_+	glucokinase	NA	NA	NA	NA	NA
WP_000038456.1|1434676_1435003_+	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
WP_000985336.1|1435024_1436272_+	fructose-like permease IIC component	NA	NA	NA	NA	NA
WP_000173224.1|1436286_1437372_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000366040.1|1437371_1438409_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000955897.1|1438433_1440929_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000646830.1|1440931_1441789_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001295458.1|1441801_1442536_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
WP_000544359.1|1442550_1444248_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000785916.1|1444624_1445863_+	alanine transaminase	NA	NA	NA	NA	NA
WP_010723117.1|1445927_1445999_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000484404.1|1446354_1447275_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
WP_000499593.1|1447627_1447870_+	YfdY family protein	NA	NA	NA	NA	NA
WP_000867641.1|1447946_1448222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825602.1|1448517_1449153_+	YfdX family protein	NA	NA	NA	NA	NA
WP_000106757.1|1449665_1450916_+	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_001283490.1|1450969_1452664_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
WP_000955028.1|1452733_1453678_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001171554.1|1454667_1455048_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1455044_1455392_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1455441_1456980_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001301578.1|1457402_1460996_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	7.8e-37
WP_000991370.1|1461000_1461615_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_001301602.1|1462030_1463194_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
WP_001018694.1|1463193_1464732_+	multidrug efflux MFS transporter permease subunit EmrY	NA	NA	NA	NA	NA
WP_000426437.1|1464839_1466168_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001301925.1|1466646_1467642_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000194527.1|1467649_1469083_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	1.2e-28
WP_001274894.1|1469298_1470213_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001102876.1|1472040_1472667_-	resolvase	NA	A0A0A8WJD4	Clostridium_phage	28.7	5.9e-09
WP_000409798.1|1472969_1473146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119352.1|1473332_1474745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000245915.1|1475414_1476062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005794.1|1476131_1476662_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
WP_000403517.1|1476661_1477129_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1477115_1477796_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1477805_1478942_+	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1479116_1480274_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
1480487:1480510	attL	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
WP_001218301.1|1480705_1481875_+|integrase	site-specific integrase	integrase	A0A1U9AJ52	Stx1_converting_phage	100.0	5.7e-231
WP_000405131.1|1481858_1482041_-	helix-turn-helix domain-containing protein	NA	A0A1U9AJ41	Stx1_converting_phage	100.0	4.1e-27
WP_000497812.1|1482101_1482353_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_000763383.1|1483746_1483968_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001395510.1|1484066_1484348_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548531.1|1484358_1484550_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682304.1|1484522_1484705_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_154074602.1|1484701_1485382_-	exonuclease	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.6	2.7e-132
WP_044706050.1|1485378_1486164_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.2	2.6e-147
WP_000995439.1|1486169_1486466_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|1486541_1486685_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198861.1|1486653_1486818_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000167595.1|1487009_1487480_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_024231298.1|1487483_1487816_-	antitermination protein	NA	K7PJZ2	Enterobacterial_phage	97.3	4.6e-53
WP_032250460.1|1488169_1488574_-	hypothetical protein	NA	Q716D7	Shigella_phage	97.8	9.6e-69
WP_000028392.1|1488570_1489203_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194218.1|1489308_1489524_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251069.1|1489643_1489937_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_044782519.1|1489969_1490908_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	99.7	8.2e-172
WP_000788928.1|1490904_1491606_+	Replication protein P	NA	C1JJ58	Enterobacteria_phage	100.0	3.4e-130
WP_000145931.1|1491602_1491893_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_001000127.1|1491963_1492242_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103676.1|1492374_1492590_+	hypothetical protein	NA	Q8HA10	Enterobacteria_phage	100.0	1.2e-33
WP_001281772.1|1492600_1492837_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|1492793_1493240_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153270.1|1493236_1493764_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254228.1|1493760_1493943_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001502725.1|1494446_1496219_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	100.0	0.0e+00
WP_001108081.1|1496788_1497355_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_064032103.1|1497329_1497941_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	100.0	1.1e-97
WP_000144764.1|1497937_1498132_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|1498124_1498559_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000691354.1|1499065_1500013_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1500022_1500292_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_134793002.1|1500433_1500670_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	81.0	8.7e-22
WP_064032101.1|1500795_1502736_+	SASA family carbohydrate esterase	NA	A0A1U9AJ89	Stx1_converting_phage	100.0	0.0e+00
WP_000143458.1|1502872_1503052_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1503092_1503365_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284510.1|1503441_1503657_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001080433.1|1503661_1504195_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	100.0	4.6e-103
WP_001369534.1|1504509_1505052_+	hypothetical protein	NA	A0A1U9AJ99	Stx1_converting_phage	100.0	4.8e-100
WP_000455406.1|1505051_1505201_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_122995391.1|1505428_1505614_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	100.0	4.9e-28
WP_000738505.1|1505704_1505998_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|1506147_1506351_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086076.1|1506406_1507213_+	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	100.0	1.7e-133
WP_000143991.1|1507193_1508900_+	hypothetical protein	NA	A0A1U9AJA6	Stx1_converting_phage	100.0	0.0e+00
WP_000787520.1|1508899_1511044_+|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	100.0	0.0e+00
WP_000345010.1|1511201_1512209_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1512232_1513447_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1513502_1513892_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001367376.1|1513941_1514403_+	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_000829200.1|1514386_1514950_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207923.1|1514949_1515600_+	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_064234923.1|1515596_1517492_+|tail	phage tail protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.0e-64
WP_001023473.1|1517493_1517763_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	100.0	8.4e-45
WP_001426815.1|1517905_1518094_+	hypothetical protein	NA	A0A1U9AJB8	Stx1_converting_phage	100.0	9.0e-30
WP_001146325.1|1518388_1520014_+	hypothetical protein	NA	A0A1U9AJB6	Stx1_converting_phage	100.0	0.0e+00
WP_000197192.1|1520010_1521279_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|1521293_1521572_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001426808.1|1521577_1522195_+	hypothetical protein	NA	A0A1U9AJB9	Stx1_converting_phage	100.0	8.8e-122
WP_000835358.1|1522285_1523020_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U9AJC8	Stx1_converting_phage	100.0	1.3e-135
WP_000078907.1|1523252_1523393_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1523449_1523851_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|1523944_1524601_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455649.1|1524603_1525050_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540394.1|1525059_1525311_+	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012455.1|1525321_1526587_+	hypothetical protein	NA	A0A1U9AJC6	Stx1_converting_phage	100.0	2.4e-206
WP_000331678.1|1526656_1535041_+	hypothetical protein	NA	A0A1U9AJC4	Stx1_converting_phage	100.0	0.0e+00
WP_000368131.1|1535262_1536195_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1535164:1535187	attR	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
>prophage 3
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	1780601	1790047	5553138		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569336.1|1780601_1781528_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1781532_1782264_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1782244_1782352_-	protein YohO	NA	NA	NA	NA	NA
WP_001240409.1|1782411_1783143_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	1.5e-112
WP_001301761.1|1783364_1785050_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1785046_1785766_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1785812_1786283_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1786324_1786786_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1786910_1788914_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1788910_1790047_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
>prophage 4
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	1805624	1870352	5553138	lysis,integrase,tRNA,portal,tail,holin,terminase,capsid,head	Escherichia_phage(59.09%)	74	1835064:1835091	1866026:1866053
WP_001457618.1|1805624_1807658_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_001005448.1|1807789_1808899_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1809160_1809442_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1809733_1810276_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|1810363_1811038_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1811053_1813534_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1813544_1814579_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1814660_1814999_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134629.1|1815216_1816068_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1816188_1816461_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1816570_1816885_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1816894_1817242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1818292_1818532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1818865_1819654_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1819650_1820451_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1820515_1821334_+	glycosyl hydrolase 25 family protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1821385_1822132_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1822105_1823071_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1823067_1824072_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1824068_1825346_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1825602_1826655_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1826953_1827808_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_154074604.1|1827836_1829099_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1829108_1829561_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1829591_1829876_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1829879_1831235_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1831282_1832323_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1832422_1833202_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1833283_1834183_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1834588_1834906_+	hypothetical protein	NA	NA	NA	NA	NA
1835064:1835091	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985260.1|1835170_1836184_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1836299_1836599_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1836720_1836996_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000217673.1|1837173_1837674_+	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.7e-91
WP_000557698.1|1837737_1837962_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|1837961_1838261_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|1838263_1838488_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|1838484_1838760_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268574.1|1838749_1841032_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000063136.1|1841121_1842345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|1842391_1842844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844437.1|1842843_1844811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038161.1|1845128_1846163_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156848.1|1846162_1847935_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|1848108_1848963_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248594.1|1849021_1850095_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_000203418.1|1850098_1850842_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_000988633.1|1850941_1851451_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1851450_1851654_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1851657_1851939_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1851938_1852436_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|1852450_1852876_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|1852863_1853289_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_001300730.1|1853260_1853434_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917144.1|1853396_1853864_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001809.1|1853856_1854309_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.0	2.0e-75
WP_001285352.1|1855262_1855874_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000217052.1|1855870_1857190_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.5	1.2e-179
WP_001057694.1|1857189_1857792_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_001008233.1|1857763_1858207_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001145592.1|1858227_1858638_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	98.4	5.9e-66
WP_000905094.1|1858668_1859262_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001286704.1|1859321_1860512_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	2.6e-223
WP_001251408.1|1860524_1861043_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1861099_1861375_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|1861407_1861527_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_000069957.1|1861519_1863967_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978913.1|1863981_1864461_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|1864460_1865624_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|1865705_1865924_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476015.1|1866197_1867559_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	7.1e-217
1866026:1866053	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001301848.1|1867706_1868039_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|1868229_1868952_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|1868948_1870352_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 5
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	1953576	2030637	5553138	lysis,integrase,transposase,holin,tail,terminase,capsid,head,protease	Stx2-converting_phage(56.1%)	95	1944527:1944541	1959954:1959968
1944527:1944541	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007947.1|1953576_1954755_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
WP_000132739.1|1954735_1954927_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1955008_1955353_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1955540_1955891_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207904.1|1955887_1956244_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	99.2	1.2e-62
WP_001289954.1|1956757_1957705_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1957701_1957923_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001395510.1|1958021_1958303_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548531.1|1958313_1958505_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682304.1|1958477_1958660_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_054428303.1|1958656_1959337_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	100.0	1.2e-132
WP_000100845.1|1959333_1960119_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
1959954:1959968	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_000995487.1|1960124_1960421_-	host-nuclease inhibitor protein Gam	NA	A0A0P0ZE86	Stx2-converting_phage	100.0	3.3e-50
WP_000372937.1|1960495_1960639_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1960607_1960772_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|1960844_1961213_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|1961395_1961647_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|1961705_1961978_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1961955_1962138_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1962706_1963228_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|1963729_1964425_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1964500_1964716_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|1964857_1965154_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000539354.1|1965334_1966156_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|1966152_1967529_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|1967599_1967878_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1968010_1968226_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|1968236_1968473_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|1968429_1968876_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|1968872_1969400_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1969396_1969579_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208502.1|1969853_1970612_+	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_085948178.1|1971109_1972323_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001455113.1|1972381_1972861_+	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	3.1e-90
WP_001004016.1|1972935_1973658_+	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|1973657_1974263_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|1974259_1974931_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|1974921_1975410_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|1976059_1977019_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_154074605.1|1977030_1977267_+	Shiga toxin Stx2 subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	9.6e-37
WP_085948178.1|1977318_1978531_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303568.1|1978909_1979233_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_154074606.1|1979476_1981414_+	DUF1737 domain-containing protein	NA	A0A0P0ZBP4	Stx2-converting_phage	99.2	0.0e+00
WP_000143458.1|1981551_1981731_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1981771_1982044_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1982120_1982336_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|1982335_1982833_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|1982829_1983267_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|1983469_1983967_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1983963_1984221_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|1984683_1984911_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|1984952_1985318_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958365.1|1985609_1986173_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	98.9	8.9e-89
WP_072617034.1|1986169_1987831_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.8	0.0e+00
WP_072617033.1|1987894_1989832_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.8	0.0e+00
WP_001063099.1|1989876_1990098_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|1992622_1992949_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1992958_1993309_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1993305_1993752_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1993748_1994093_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1994151_1994868_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1994873_1995248_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1995343_1995553_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000807954.1|1998839_1999181_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179516.1|1999180_1999879_+|tail	phage minor tail protein L	tail	A0A0P0ZD82	Stx2-converting_phage	100.0	1.5e-133
WP_001302649.1|1999895_2000216_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2000323_2000497_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001428824.1|2000567_2001491_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	100.0	1.3e-177
WP_001457600.1|2001545_2002283_+|tail	phage tail protein	tail	A0A0P0ZDJ9	Stx2-converting_phage	99.6	9.1e-150
WP_122994717.1|2002228_2002861_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	3.1e-106
WP_085949318.1|2003510_2004723_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
WP_154074661.1|2004830_2007893_+	DUF1983 domain-containing protein	NA	A0A0P0ZDT4	Stx2-converting_phage	99.5	0.0e+00
WP_001230509.1|2007960_2008560_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_001023452.1|2009938_2010208_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2010348_2011224_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2011448_2012099_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2013422_2014589_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2014707_2015181_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2015379_2016438_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2016609_2016939_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2017039_2017222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2017710_2017824_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2017836_2018031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2018489_2018858_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2018931_2019153_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2019215_2019692_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2019706_2020186_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2020267_2021089_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2021309_2021720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2021735_2022419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2022554_2023625_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2023621_2024527_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_023441891.1|2024523_2025321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949318.1|2025384_2026598_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
WP_000998048.1|2029098_2030637_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 6
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	2055022	2096290	5553138	integrase,portal,transposase,holin,tail,terminase,head	Escherichia_phage(34.15%)	51	2035293:2035307	2059147:2059161
2035293:2035307	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000533600.1|2055022_2056045_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2056044_2056248_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2056306_2058778_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2058873_2059062_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2059058_2059247_-	cell division inhibitor	NA	NA	NA	NA	NA
2059147:2059161	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000367376.1|2059727_2059880_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2060154_2060799_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2060896_2061124_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2061120_2061546_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2061614_2062652_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000373320.1|2062683_2063106_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450610.1|2063140_2063839_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2063860_2064085_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2064081_2064438_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2064470_2064623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2064619_2064931_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2065057_2065621_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278461.1|2065730_2065835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2066021_2066234_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2066401_2066680_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2066681_2067731_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2067743_2068103_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2068099_2068789_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000023257.1|2070328_2072179_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_085948178.1|2072260_2073474_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411809.1|2073794_2074001_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731204.1|2074005_2074350_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2074400_2074934_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2075089_2075272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2075284_2075416_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2075643_2075829_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2076355_2076670_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2076751_2076976_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2077370_2077880_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_072147822.1|2077881_2078199_+|terminase	terminase	terminase	K7PGW7	Enterobacteria_phage	65.4	1.4e-22
WP_000259002.1|2079751_2079958_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2079954_2081547_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_154074607.1|2081536_2083024_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.3	1.2e-100
WP_000256723.1|2083060_2083408_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2083465_2083732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|2083713_2084454_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2084467_2084899_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2084925_2085339_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_154074608.1|2085319_2087899_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.6	0.0e+00
WP_000847298.1|2087895_2088225_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072617001.1|2088224_2088923_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.7	1.2e-130
WP_054191786.1|2088933_2089677_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.1e-146
WP_064562156.1|2089622_2090252_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	99.5	1.2e-105
WP_001230509.1|2094041_2094641_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_070080209.1|2094705_2096019_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_001023455.1|2096020_2096290_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
>prophage 7
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	2153870	2173850	5553138	transposase,integrase,tail	Enterobacteria_phage(79.17%)	28	2166986:2166999	2176992:2177005
WP_072612814.1|2153870_2155001_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	4.8e-41
WP_000132765.1|2154951_2155275_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2155432_2156617_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2156616_2157129_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2157183_2157549_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000763327.1|2157584_2157713_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000979955.1|2160515_2161004_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2161160_2161733_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000257965.1|2161776_2162193_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000211280.1|2163398_2163713_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2163717_2164677_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2164753_2167576_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2166986:2166999	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2167582_2167948_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000775057.1|2168020_2168251_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000104305.1|2168573_2168873_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2168869_2169136_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2169132_2169336_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2169359_2169776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2169868_2169982_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2169978_2170221_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2170232_2170511_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2170521_2170872_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2170893_2171097_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2171168_2171306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2171395_2171800_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2171815_2172466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2172495_2172843_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2172848_2173850_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2176992:2177005	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 8
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	2203252	2298467	5553138	integrase,tRNA,portal,holin,tail,terminase,protease	Escherichia_phage(32.69%)	94	2207238:2207252	2216948:2216962
WP_001025318.1|2203252_2204986_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302537.1|2205201_2205768_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185748.1|2205781_2206528_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214277.1|2206915_2208016_+	cytochrome c-type protein TorY	NA	NA	NA	NA	NA
2207238:2207252	attL	CTCATCGCCAGGAAA	NA	NA	NA	NA
WP_000176813.1|2208040_2210470_+	Trimethylamine-N-oxide reductase 2	NA	NA	NA	NA	NA
WP_000564730.1|2210634_2211606_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2211602_2212346_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2212386_2212782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088137555.1|2212834_2213599_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	1.3e-71
WP_000063650.1|2213615_2214902_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	99.8	6.9e-254
WP_001193437.1|2214935_2215190_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_001692487.1|2215381_2215753_-	hypothetical protein	NA	Q8W655	Enterobacteria_phage	95.1	3.0e-61
WP_000734577.1|2215793_2216621_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	98.2	1.1e-130
WP_000566775.1|2216866_2217259_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	57.1	2.3e-35
2216948:2216962	attR	TTTCCTGGCGATGAG	NA	NA	NA	NA
WP_000002325.1|2217445_2217661_-	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	60.6	5.5e-15
WP_000148632.1|2217660_2218020_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	76.4	2.3e-42
WP_032314860.1|2218204_2218396_-	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	95.2	8.6e-28
WP_000781571.1|2218392_2218584_-	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	93.7	3.3e-27
WP_000930864.1|2218585_2219029_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	45.6	1.6e-08
WP_000402986.1|2219141_2219597_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001287835.1|2220608_2220977_+	hypothetical protein	NA	A0A1B5FPB1	Escherichia_phage	98.4	4.6e-62
WP_000424038.1|2221088_2222747_+	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	95.8	0.0e+00
WP_000844629.1|2222748_2223717_+	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	99.4	5.5e-187
WP_001258397.1|2223716_2224574_+	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	92.3	1.6e-150
WP_000762843.1|2224573_2225389_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	84.1	5.9e-118
WP_000576620.1|2225525_2226470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154074610.1|2227324_2229271_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.3	0.0e+00
WP_000143458.1|2229408_2229588_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2229628_2229901_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284510.1|2229977_2230193_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_154074611.1|2230197_2230731_+	glycoside hydrolase family protein	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	6.0e-103
WP_052834940.1|2230886_2231069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|2231429_2231615_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001688099.1|2231700_2231925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|2232383_2232860_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|2232856_2234980_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102415.1|2234976_2235189_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|2235188_2236691_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|2236635_2238660_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|2238747_2239074_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281348.1|2239066_2239348_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_000974958.1|2239350_2239974_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_000682716.1|2239986_2240385_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2240392_2241145_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|2241158_2241581_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|2241607_2241916_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000847304.1|2244600_2244930_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_080025938.1|2244929_2245628_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_140439088.1|2246326_2246959_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	7.9e-102
WP_154074612.1|2247207_2250681_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	97.6	0.0e+00
WP_001230471.1|2250748_2251348_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	9.7e-110
WP_154074613.1|2251412_2252726_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
WP_001023356.1|2252727_2252997_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_001142085.1|2253857_2257244_-	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	99.6	0.0e+00
WP_000891621.1|2258663_2259230_-	hydrolase	NA	NA	NA	NA	NA
WP_154074614.1|2259539_2261312_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001300367.1|2261429_2261882_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|2261910_2262651_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|2262685_2263207_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024949.1|2263208_2263811_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_010723105.1|2263881_2263947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|2264085_2264697_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|2264705_2265716_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571476.1|2265961_2266747_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|2266743_2267499_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001303192.1|2267577_2268510_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|2268525_2269848_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448391.1|2269967_2270939_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091169.1|2271069_2272512_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056694.1|2272639_2273509_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301737.1|2273846_2275322_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001069467.1|2275556_2277368_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|2277404_2278046_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173471.1|2278101_2279280_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|2279413_2279704_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|2279770_2280127_+	protein YebF	NA	NA	NA	NA	NA
WP_000024742.1|2280453_2281113_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936917.1|2281321_2283382_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944243.1|2283378_2284041_-	exodeoxyribonuclease X	NA	NA	NA	NA	NA
WP_072617024.1|2284064_2284721_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|2284822_2285053_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168751.1|2285191_2285566_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879314.1|2285569_2286442_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976483.1|2286454_2286796_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812736.1|2287191_2287848_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	6.8e-56
WP_001296140.1|2287848_2288040_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|2288144_2288381_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001302304.1|2288498_2289938_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001302055.1|2290018_2292652_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207282.1|2292620_2293904_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|2294033_2294531_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431368.1|2294627_2295326_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001055778.1|2295345_2297394_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000984517.1|2297585_2298467_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 9
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	2538123	2653925	5553138	portal,transposase,holin,tail,terminase,capsid,head,protease	Escherichia_phage(29.36%)	140	NA	NA
WP_001260835.1|2538123_2538945_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2539044_2539128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2539220_2539556_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2539952_2541206_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2541312_2542206_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2542340_2543561_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2543685_2544381_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2544333_2545626_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2545783_2546398_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2546440_2547295_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2547296_2547914_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_154074662.1|2547924_2550348_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	48.6	3.7e-208
WP_000041704.1|2550408_2552835_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2553033_2553339_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2553446_2554157_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2554159_2554720_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2554754_2555096_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2555230_2555557_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|2555729_2555855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296941.1|2556545_2556782_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048458.1|2556869_2559341_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2559433_2559625_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2559621_2559810_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2560209_2560374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2560377_2560596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2560667_2560967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2561319_2561598_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2561599_2561791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2561811_2562183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|2562349_2563562_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_072617017.1|2563611_2563896_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	35.4	5.2e-05
WP_000693943.1|2563892_2564318_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2564340_2565303_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2565309_2566050_+	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2566860_2567256_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2567312_2567897_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2568012_2568117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2568305_2568518_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2568685_2568964_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2568965_2570015_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2570027_2570387_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2570383_2571073_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2571710_2572139_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_154074615.1|2572617_2574468_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_000411805.1|2574916_2575123_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731241.1|2575127_2575472_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001056806.1|2576325_2576895_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2576894_2577041_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2577268_2577454_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2577878_2578106_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2578147_2578513_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958422.1|2578802_2579366_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	99.5	1.8e-89
WP_038425863.1|2579362_2581024_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_072617033.1|2581087_2583025_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.8	0.0e+00
WP_001063099.1|2583069_2583291_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|2585817_2586144_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2586153_2586504_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2586500_2586947_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2586943_2587288_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2587346_2588063_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2588068_2588443_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2588538_2588748_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064234948.1|2588800_2592043_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.8	0.0e+00
WP_000807954.1|2592035_2592377_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179509.1|2592376_2592814_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_105626756.1|2593001_2596262_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.2	0.0e+00
WP_001304111.1|2596264_2596480_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2596547_2597147_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_071805583.1|2597211_2598435_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	92.6	8.7e-81
WP_001023362.1|2598436_2598706_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|2598819_2599395_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|2600104_2600755_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2601337_2602876_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2602925_2603273_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2603269_2603650_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|2604612_2604927_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2605565_2606810_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2606902_2607091_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2607087_2607276_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2607840_2608050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2608050_2608689_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2608700_2608853_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2609145_2609484_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2609875_2610118_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2610101_2610527_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2610595_2611639_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_001379651.1|2611670_2612093_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_000450627.1|2612126_2612843_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2612875_2613157_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2613153_2613381_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2613373_2613685_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2613812_2614031_+	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2614032_2614590_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2614823_2615036_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2615155_2615500_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2615621_2615894_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2615895_2616945_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2616957_2617263_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2617325_2617880_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2618104_2618302_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2618436_2619150_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2619600_2620032_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2620509_2622360_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411805.1|2622807_2623014_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|2623018_2623363_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992148.1|2623413_2623947_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2624217_2624787_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2624786_2624933_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2625155_2625341_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2625865_2626180_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2626261_2626486_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2626872_2627418_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2627392_2629318_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2629314_2629521_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_154074616.1|2629517_2631119_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	6.7e-307
WP_000123254.1|2631099_2632419_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001457523.1|2632428_2632761_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.9e-54
WP_000063265.1|2632816_2633842_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2633883_2634282_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2634293_2634647_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2634661_2635195_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2635191_2635587_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2635594_2636347_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2636360_2636783_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2636809_2637223_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000847298.1|2639811_2640141_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072617001.1|2640140_2640839_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.7	1.2e-130
WP_054191786.1|2640849_2641593_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.1e-146
WP_064562156.1|2641538_2642168_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	99.5	1.2e-105
WP_072616999.1|2642408_2645888_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.3	0.0e+00
WP_001230508.1|2645955_2646555_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_072617028.1|2646619_2647933_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.3	1.3e-77
WP_001023407.1|2647934_2648204_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2648317_2648893_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2648965_2649595_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2649676_2650318_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_096855372.1|2650479_2650794_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2650853_2652137_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2652225_2653686_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2653721_2653925_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 10
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	2834959	2895910	5553138	integrase,tRNA,transposase,tail,holin,terminase,capsid,head	Stx2-converting_phage(40.98%)	71	2838784:2838809	2890549:2890574
WP_000998048.1|2834959_2836498_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2836547_2836895_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2836891_2837272_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001295593.1|2838149_2838584_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
2838784:2838809	attL	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_122993102.1|2839387_2840401_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|2840615_2840693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023356.1|2840803_2841073_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_072617073.1|2841074_2842388_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.1e-76
WP_001230471.1|2842452_2843052_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	9.7e-110
WP_154074622.1|2843119_2846593_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_140439088.1|2846841_2847474_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	7.9e-102
WP_154074623.1|2847419_2848163_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	94.7	1.5e-144
WP_154074624.1|2848173_2848872_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	97.4	2.0e-130
WP_000807954.1|2848871_2849213_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_154074625.1|2849205_2852448_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.4	0.0e+00
WP_001513217.1|2852495_2852705_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030063.1|2852800_2853175_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275471.1|2853180_2853897_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_000133372.1|2853962_2854307_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_000573364.1|2854303_2854750_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	99.3	1.8e-76
WP_001007905.1|2854746_2855097_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|2855107_2855434_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2857960_2858182_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173079.1|2858226_2860164_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_154074626.1|2860227_2861889_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000958422.1|2861885_2862449_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	99.5	1.8e-89
WP_000279786.1|2862738_2863104_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|2863145_2863373_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2863797_2863983_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2864210_2864357_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2864356_2864926_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000731241.1|2865779_2866124_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000411805.1|2866128_2866335_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000216636.1|2869038_2869206_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
WP_001359877.1|2869202_2869634_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	3.6e-66
WP_024175525.1|2869812_2870034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735807.1|2870086_2870311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001502553.1|2870796_2871339_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.0	1.1e-75
WP_000228020.1|2871335_2871626_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_001502554.1|2871625_2872225_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	7.7e-107
WP_000818161.1|2872658_2873144_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000119356.1|2873162_2873342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024175526.1|2873552_2873765_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	4.0e-26
WP_001278450.1|2873953_2874058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072616987.1|2874173_2874836_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	54.5	9.5e-74
WP_154074627.1|2875349_2876015_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	99.1	3.1e-125
WP_085949318.1|2876074_2877287_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
WP_000172332.1|2877543_2878029_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.1	5.7e-68
WP_001502613.1|2878025_2878754_-	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	54.8	4.3e-51
WP_072616986.1|2878740_2879493_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.6	1.8e-76
WP_000788990.1|2879514_2880261_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_000899743.1|2880267_2881125_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	94.4	4.0e-80
WP_000702023.1|2881137_2881560_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000171139.1|2881543_2881819_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
WP_001253182.1|2881923_2882388_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_000233812.1|2882623_2882758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169149.1|2882768_2882921_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	57.4	2.1e-08
WP_000935592.1|2883349_2884198_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_000560228.1|2884244_2884466_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.4e-37
WP_065336296.1|2884465_2884636_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	1.0e-16
WP_001502427.1|2884709_2884985_+	bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	95.6	5.2e-42
WP_001502426.1|2885086_2887687_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.2	5.1e-248
WP_001502425.1|2887679_2888489_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_001302840.1|2888732_2888921_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079602.1|2889020_2889236_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	98.6	2.3e-37
WP_001358842.1|2889237_2890473_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	2.3e-238
WP_001157382.1|2890524_2891460_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
2890549:2890574	attR	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_000123746.1|2891588_2892962_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001625136.1|2892994_2893165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|2893439_2894423_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2894677_2895910_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 11
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	2979550	3055095	5553138	integrase,portal,transposase,tail,holin,terminase,capsid,head,protease	Stx2-converting_phage(37.5%)	85	2995052:2995079	3055232:3055259
WP_000422055.1|2979550_2980600_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2980819_2981578_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2981574_2982165_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2982204_2983077_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2983289_2984873_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2984900_2985521_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2985517_2986399_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2986536_2986581_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2986672_2988235_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2988234_2989830_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001302292.1|2989833_2991192_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000209521.1|2991203_2992397_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2992396_2993203_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2993583_2993763_+	general stress protein	NA	NA	NA	NA	NA
WP_001056499.1|2993848_2994349_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2994394_2994901_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2995052:2995079	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000147167.1|2995402_2995621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302903.1|2996214_2996643_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_001144877.1|2998371_2998962_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2999145_2999793_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2999929_3000076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|3000503_3000782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171540.1|3001121_3001502_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|3001498_3001846_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3001895_3003434_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|3004399_3004969_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|3005034_3005946_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|3006052_3006175_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|3007773_3009099_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|3010125_3010395_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|3010396_3011710_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|3011861_3012461_-	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_154074663.1|3012528_3015036_-	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	99.6	0.0e+00
WP_050439450.1|3016343_3016976_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|3016921_3017665_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179510.1|3017675_3018374_-|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
WP_000807954.1|3018373_3018715_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_154074628.1|3018707_3021950_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.2	0.0e+00
WP_001453746.1|3021997_3022207_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3022302_3022677_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3022691_3023408_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3023473_3023818_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3023814_3024261_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3024257_3024608_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3024617_3024944_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_154074629.1|3024946_3027526_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|3027471_3027693_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_072617033.1|3027737_3029675_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.8	0.0e+00
WP_001301491.1|3029738_3031400_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958422.1|3031396_3031960_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	99.5	1.8e-89
WP_000279786.1|3032249_3032615_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|3032656_3032884_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3033308_3033494_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3033721_3033868_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3033867_3034437_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3034707_3035241_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3035291_3035636_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3035640_3035856_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_072617007.1|3036005_3037859_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000935548.1|3038655_3039714_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|3039864_3040062_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3040303_3040834_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3040842_3041202_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3041214_3042261_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_072617008.1|3042262_3042541_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.3e-11
WP_001217394.1|3042610_3042868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3043088_3043301_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3043579_3044338_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3045036_3045201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3045197_3045779_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001302276.1|3045965_3046388_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000020556.1|3046419_3047460_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3047431_3047983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3047966_3048194_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3048270_3048678_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3048943_3049243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3049315_3049534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3049556_3049964_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3049941_3050175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3050168_3050336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3050733_3050922_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3050918_3051110_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|3051202_3053674_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|3053738_3053987_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3053964_3055095_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
3055232:3055259	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 12
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	3101791	3209473	5553138	lysis,integrase,tRNA,portal,transposase,tail,holin,terminase,capsid,head,protease	Enterobacteria_phage(50.91%)	115	3138972:3138987	3203376:3203391
WP_001299679.1|3101791_3103048_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3103261_3103885_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3103884_3104736_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3104886_3105834_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3105958_3107638_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3107692_3107971_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3108248_3108833_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3108949_3110041_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3110884_3113770_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3113869_3115789_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733713.1|3116016_3117087_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3117097_3117730_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_154074630.1|3117740_3119159_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001417816.1|3119462_3119741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304187.1|3119705_3121163_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_001459046.1|3121190_3121391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3121498_3122521_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3122520_3123501_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3123497_3124256_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000903990.1|3124265_3124910_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000576838.1|3125074_3125929_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3125954_3127925_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3127974_3128229_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020148.1|3128429_3129026_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_085952403.1|3129077_3130290_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001295616.1|3130478_3131090_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3131189_3132104_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_154074631.1|3132199_3133936_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_064717263.1|3134038_3134128_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.7e-07
WP_154074632.1|3134093_3135307_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	1.9e-168
WP_000197859.1|3135644_3136715_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3136724_3138023_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3138385_3139918_+	SpoVR family protein	NA	NA	NA	NA	NA
3138972:3138987	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3139969_3140689_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3140910_3142452_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3142597_3143128_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3143173_3144442_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3144441_3144861_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3145233_3146145_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3146351_3146813_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3146889_3147549_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3147620_3147914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000874954.1|3147925_3148084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3148154_3148556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056834.1|3148658_3149027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3149546_3150242_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3150265_3151078_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3151081_3151348_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3152586_3153171_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3153669_3154623_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3154809_3156294_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3156596_3158135_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3158184_3158532_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000937476.1|3158984_3159233_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3159289_3159958_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3160455_3160638_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3160716_3161217_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3161253_3161760_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3161778_3162669_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3162788_3163370_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3163369_3166285_-	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3166349_3166949_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_072617011.1|3167015_3170414_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.6	0.0e+00
WP_000090920.1|3170474_3171107_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3171043_3171787_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3171792_3172491_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3172490_3172820_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3172816_3175366_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3175358_3175793_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3175774_3176197_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3176212_3176953_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3176960_3177356_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000752995.1|3177941_3178295_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3178306_3178705_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3178746_3179772_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3179827_3180160_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3180169_3181489_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3181469_3183071_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3183067_3183274_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3183270_3185196_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3185170_3185716_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3186104_3186299_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3186463_3186670_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3186955_3187366_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3187657_3187951_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3188041_3188224_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3188440_3188917_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3188903_3189209_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3189530_3190220_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3190216_3190357_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3190353_3190716_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3190712_3191003_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3190995_3191166_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3191165_3191621_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3192122_3193649_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3193706_3193829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3193893_3194226_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3194293_3194596_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3194592_3195294_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000945520.1|3195290_3196115_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000088655.1|3196218_3196455_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3196444_3197587_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3197700_3198951_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3199122_3199776_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3199785_3200247_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3200300_3201407_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3201442_3202084_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3202087_3203458_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3203376:3203391	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3203626_3204298_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3204297_3205758_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3206358_3206640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3206895_3207438_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3207643_3208057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3208069_3208405_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3208417_3209473_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 13
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	3215563	3272892	5553138	integrase,tail,holin,terminase,capsid,head	Enterobacteria_phage(25.45%)	70	3258459:3258479	3279549:3279569
WP_000085256.1|3215563_3216793_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3217041_3218163_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|3218211_3219438_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3219687_3220824_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3220807_3221671_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3222034_3223396_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3223456_3223732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|3223811_3223937_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001301673.1|3230031_3232380_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3232399_3232489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3232501_3232738_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967274.1|3232683_3233421_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	99.6	9.1e-150
WP_000835336.1|3233474_3234353_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3234655_3234766_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3234875_3235130_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3235146_3235845_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3235844_3236186_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3236178_3239421_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3239468_3239678_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_001030063.1|3239773_3240148_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3240153_3240870_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3240928_3241273_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3241269_3241716_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3241712_3242063_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3242072_3242399_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001063099.1|3244925_3245147_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3245191_3247129_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_038425863.1|3247192_3248854_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958422.1|3248850_3249414_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	99.5	1.8e-89
WP_000279796.1|3249703_3250069_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001302977.1|3250110_3250296_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3250425_3250566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3250922_3251147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3251211_3251418_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3251645_3251792_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3251791_3252361_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3252631_3253165_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731259.1|3253215_3253560_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284518.1|3253564_3253780_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3253855_3254125_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3254162_3254345_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3254492_3256430_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3256744_3256912_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3257508_3258330_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3258326_3258701_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3258459:3258479	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3258713_3259763_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3259764_3260043_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3260210_3260423_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3260611_3260716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3260831_3261419_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3261421_3261613_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3261614_3262052_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3262038_3262356_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3262309_3262627_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3262616_3262919_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_000017339.1|3262915_3263233_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_000451012.1|3263229_3263946_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_001301518.1|3263979_3264402_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_001457513.1|3264433_3265471_-	primosomal protein I	NA	A0A0U2RT81	Escherichia_phage	79.5	1.5e-89
WP_000693915.1|3265539_3265965_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3265948_3266272_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3266396_3266873_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3267188_3267341_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3267455_3267971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3268103_3268493_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3268554_3268824_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3268792_3269911_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3270077_3270872_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3270868_3271915_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3272070_3272892_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3279549:3279569	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 14
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	3375210	3439053	5553138	transposase,protease,integrase	Stx2-converting_phage(27.78%)	60	3364576:3364591	3441730:3441745
3364576:3364591	attL	GCGCTGCTGACGCTGT	NA	NA	NA	NA
WP_085952195.1|3375210_3376423_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_001287881.1|3377017_3377209_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124179.1|3377261_3377495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260384.1|3377590_3378214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|3378302_3378812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301456.1|3379269_3379728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231525.1|3381081_3382206_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|3382935_3383133_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001340489.1|3383198_3383414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303898.1|3383697_3383970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299815.1|3384058_3384238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|3384289_3384484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|3385264_3385600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477623.1|3386232_3386451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|3387903_3389994_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001053349.1|3390507_3390894_-	protein TerF	NA	NA	NA	NA	NA
WP_000301248.1|3391315_3391891_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3391959_3392538_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3392586_3393627_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3393649_3394105_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3394127_3395285_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254140.1|3395284_3395866_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3396188_3397247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|3397256_3398399_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3398391_3399165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3399166_3400246_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|3400245_3401202_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|3401212_3402421_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3402438_3402906_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3403166_3403496_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957248.1|3403482_3403824_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3404766_3406380_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3406410_3406761_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3406757_3407183_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000397129.1|3409520_3410192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135715.1|3411063_3411204_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000803992.1|3411505_3411769_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021389.1|3412980_3413598_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142971.1|3413609_3414284_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|3414284_3414749_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000612150.1|3416461_3416782_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|3416790_3417093_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_149026314.1|3417186_3417882_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|3418262_3418538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591997.1|3418762_3420382_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|3420474_3420834_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_001304211.1|3421519_3421810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072616976.1|3421833_3422124_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_085952403.1|3422126_3423340_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_028913479.1|3423445_3424051_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001171554.1|3425442_3425823_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612606.1|3425819_3426167_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
WP_000998048.1|3426216_3427755_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000233452.1|3428511_3430872_-	DEAD/DEAH box helicase	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000282084.1|3431026_3431590_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000335698.1|3432410_3433796_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|3434014_3434212_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|3434438_3434735_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000282209.1|3435846_3437664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072616975.1|3437850_3439053_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
3441730:3441745	attR	GCGCTGCTGACGCTGT	NA	NA	NA	NA
>prophage 15
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	3531498	3587091	5553138	integrase,portal,transposase,tail,holin,head,protease	Escherichia_phage(27.91%)	63	3533433:3533448	3588856:3588871
WP_000003653.1|3531498_3532086_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3532082_3532790_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3532808_3534602_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3533433:3533448	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3534598_3535717_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3537990_3538260_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268962.1|3538261_3539575_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230444.1|3539639_3540239_-	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515110.1|3540306_3543780_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_000649829.1|3543913_3544441_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3544631_3545264_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_001151078.1|3545962_3546661_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|3546660_3546990_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_134790849.1|3546986_3547751_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	92.1	8.6e-127
WP_001455418.1|3547702_3549565_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	7.4e-265
WP_000533402.1|3549545_3549959_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3549985_3550417_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3550430_3551171_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3551152_3551419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3551476_3551824_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_154074607.1|3551860_3553348_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.3	1.2e-100
WP_000831796.1|3553337_3554930_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3554926_3555133_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001301919.1|3557003_3557246_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|3557295_3558834_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3558883_3559231_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000235421.1|3559683_3559959_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3560709_3560916_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3561171_3561444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3561603_3562137_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3562357_3562471_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3562692_3562878_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3563405_3563720_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085948178.1|3563924_3565138_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000874392.1|3565313_3567164_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3567931_3568645_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|3568739_3568979_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|3569265_3570084_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3570235_3570607_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3570596_3570968_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3570980_3572030_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3572031_3572310_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|3572477_3572690_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|3572734_3572872_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3573237_3574011_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3574362_3574776_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3574791_3575562_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3575583_3576330_-	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3576336_3577428_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3577506_3577962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3578168_3578594_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3578577_3578850_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3578958_3579360_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3579387_3579579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3579578_3579866_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3580143_3580299_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3580440_3580830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3581016_3581202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3581775_3581964_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3581960_3582152_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3582245_3584717_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3584784_3585027_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3585004_3586024_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3586431_3587091_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3588856:3588871	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 16
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	3818020	3855129	5553138	lysis,portal,transposase,tail,holin,terminase,protease	Enterobacteria_phage(48.78%)	47	NA	NA
WP_001247925.1|3818020_3818719_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3818949_3819831_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3819999_3820161_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3820657_3821677_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3821710_3822691_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3822867_3823137_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3823138_3824455_-|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3824514_3825114_-	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_072616970.1|3825184_3828598_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_000090841.1|3828658_3829267_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3829203_3829947_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3829952_3830651_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3830660_3830990_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3830989_3834055_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3834026_3834356_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3834364_3834751_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3834811_3835555_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3835565_3835967_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3835963_3836542_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3836553_3836829_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3836821_3837145_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3837231_3839259_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3839203_3839539_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3839660_3840785_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3840712_3840925_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_154074641.1|3840921_3843024_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3843023_3843515_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3844189_3844342_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3844329_3844797_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3844793_3845291_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3845290_3845506_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3845648_3846047_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3846127_3846286_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|3846371_3847115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3847298_3847988_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3848002_3848125_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3848462_3849422_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3849633_3850299_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3850295_3850916_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3850908_3851079_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3851075_3851258_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3851955_3852636_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3852632_3852815_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3852787_3852979_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3852989_3853271_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3853369_3853591_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_085948178.1|3853915_3855129_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 17
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	4436402	4494764	5553138	plate,transposase,integrase	Enterobacteria_phage(23.53%)	52	4435973:4435987	4473867:4473881
4435973:4435987	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130487.1|4436402_4437584_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4438546_4439290_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355475.1|4440113_4440887_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4440944_4441499_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_154074650.1|4441671_4441824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154074651.1|4442116_4442305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788819.1|4443532_4443844_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251067.1|4444795_4445089_-	hypothetical protein	NA	A2SY75	Escherichia_phage	99.0	1.4e-45
WP_000437875.1|4445207_4445408_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4445508_4446222_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_001303805.1|4448866_4449112_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4450181_4451435_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4451446_4452550_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4452837_4453893_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4453931_4454333_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4454390_4455635_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4455726_4456185_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4456445_4457903_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_077626217.1|4457959_4458496_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4458428_4458695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4459001_4459454_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4459463_4459862_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_000554757.1|4459864_4460158_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4460209_4461265_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001301640.1|4461335_4462106_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4462065_4463805_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4464622_4465396_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4465581_4465842_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4465860_4466121_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4466276_4467017_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4466987_4467755_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4467859_4468438_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4468677_4471122_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|4471164_4471638_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4471791_4472562_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4472679_4473852_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4473932_4474118_+	protein YncO	NA	NA	NA	NA	NA
4473867:4473881	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_000247943.1|4474032_4474296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4474497_4476258_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4476260_4477397_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001496339.1|4478142_4478670_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000339420.1|4478738_4480247_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_000995683.1|4480428_4481145_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_149026308.1|4481284_4485517_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103335.1|4485592_4487734_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_001142958.1|4487943_4488462_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4489158_4489659_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4489693_4489918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4489968_4491360_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4491450_4491864_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4491867_4493718_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4493681_4494764_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 18
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	4936209	4995237	5553138	transposase,protease	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4936209_4937562_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4937655_4938207_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4938362_4939736_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4939911_4940910_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4940942_4941938_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4941924_4942947_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4942960_4944463_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4944602_4945559_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4945868_4946399_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4946478_4946829_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4946822_4947074_-	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_001219160.1|4947285_4947627_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4947629_4951409_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4951405_4953139_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4953344_4953983_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4954305_4955649_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4955744_4955951_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4956275_4956830_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|4956892_4957831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4958042_4958783_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4958972_4960916_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4961033_4961414_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4961502_4962363_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4962470_4963436_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4963543_4964206_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4964250_4965663_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4965971_4966592_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4966809_4967448_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4967582_4968791_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4968798_4969230_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4969852_4970647_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4970717_4971167_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4971208_4971436_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4971440_4971755_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4971761_4972157_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4972483_4972759_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4972887_4973574_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4973573_4974428_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4974437_4975088_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4975101_4975566_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4975575_4975881_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4975896_4977294_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|4978820_4979576_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4979572_4980322_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4980503_4980833_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4980981_4981257_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4981373_4982999_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4983082_4984246_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4984248_4984887_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4984896_4985295_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4985312_4985972_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4986022_4986721_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4986739_4987141_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4987267_4987999_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4988179_4990621_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4990659_4991085_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_097721622.1|4991289_4992588_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	3.8e-66
WP_001089295.1|4992691_4992889_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4992970_4993975_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4993977_4995237_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 19
NZ_CP045975	Escherichia coli strain AUSMDU00002545 chromosome, complete genome	5553138	5132117	5146782	5553138	tail,integrase,tRNA	Enterobacteria_phage(40.0%)	17	5127958:5127973	5145487:5145502
5127958:5127973	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5132117_5133533_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000891404.1|5134764_5135007_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5135140_5136178_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5136266_5137364_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5137425_5137674_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5137834_5138476_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5138557_5139187_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5139259_5139832_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5139943_5140213_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5140214_5141528_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5141592_5142192_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5143513_5144050_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5144040_5144391_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5144387_5144672_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5145007_5145205_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5145549_5145831_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5145487:5145502	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000956557.1|5146248_5146782_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP045976	Escherichia coli strain AUSMDU00002545 plasmid pAUSMDU00002545_01, complete sequence	94640	23816	91751	94640	integrase,transposase,protease	Escherichia_phage(22.22%)	54	37546:37559	92630:92643
WP_001358886.1|23816_26513_-|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302181.1|27382_28381_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000550559.1|28454_30176_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000975743.1|30265_31372_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001302199.1|31371_32193_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_071525077.1|32794_32974_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001171554.1|35740_36121_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|36117_36465_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|36514_38053_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
37546:37559	attL	CATCCCGTCAGCAC	NA	NA	NA	NA
WP_085948178.1|39467_40680_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_085950648.1|42155_42251_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.8e-07
WP_001172748.1|43261_43651_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000592771.1|43694_45905_-	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001302179.1|46081_46267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105064.1|47607_47814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421248.1|47908_48184_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001178089.1|48183_48468_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000130945.1|49381_50239_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001370046.1|50231_50306_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083831.1|50541_50796_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000766796.1|51035_51374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302200.1|51411_51621_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001233853.1|51666_52128_-	endonuclease	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
WP_001302189.1|52372_52585_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000840472.1|52717_53278_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704522.1|53380_54241_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000205762.1|54299_55046_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000581721.1|57304_66814_-	toxin B	NA	NA	NA	NA	NA
WP_001453090.1|68565_68997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302184.1|71219_71378_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000845909.1|72465_72900_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000117168.1|72954_74913_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000005995.1|74978_75212_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000290823.1|75268_75721_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_001310283.1|76022_76460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302171.1|76545_77109_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_000199442.1|77155_78517_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|78568_78799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303399.1|79286_79676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027495.1|79794_79986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271685.1|79982_80405_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_010891293.1|80451_80754_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001310284.1|80849_81422_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_001358893.1|82116_82671_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104869.1|82564_82786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|82786_83470_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
WP_010891292.1|83546_83852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000273919.1|83855_84758_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817031.1|85452_86424_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000772446.1|86423_87590_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852148.1|88177_88933_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_085948178.1|89008_90221_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_077631973.1|90187_90268_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_000016989.1|90944_91751_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
92630:92643	attR	GTGCTGACGGGATG	NA	NA	NA	NA
