The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043547	Planctomycetales bacterium 10988 chromosome, complete genome	6649480	255738	304356	6649480	transposase	Paenibacillus_phage(28.57%)	35	NA	NA
WP_162010181.1|255738_256290_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153988178.1|256199_256577_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	43.9	2.5e-23
WP_153987192.1|256890_258870_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	21.3	1.6e-07
WP_153987193.1|258973_259477_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_153987194.1|259490_260840_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_162010182.1|260967_262287_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_153991463.1|262734_264129_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	22.3	2.8e-06
WP_153987196.1|264154_265342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987197.1|265341_266481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987198.1|266666_267737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153991464.1|268173_269316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987199.1|269406_269799_-	DoxX family protein	NA	NA	NA	NA	NA
WP_153987200.1|269927_273215_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_153987201.1|273269_274976_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_153987202.1|275027_275564_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_153987203.1|275823_276507_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153987204.1|276503_277910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987205.1|277986_281220_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.5	1.7e-51
WP_153987206.1|281491_282760_-	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_153991465.1|282983_283520_-	superoxide dismutase family protein	NA	W6JIT4	Anomala_cuprea_entomopoxvirus	36.7	1.6e-18
WP_153987207.1|283773_285714_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_153987208.1|285710_285953_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_153987209.1|286369_287062_-	intradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_153991466.1|287388_288795_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_153991467.1|288868_290023_-	ThuA domain-containing protein	NA	NA	NA	NA	NA
WP_153987210.1|290045_291479_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_153987211.1|291570_294774_-	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_162010183.1|295231_297571_+	DUF1592 domain-containing protein	NA	NA	NA	NA	NA
WP_153987213.1|297584_298964_+	DUF1552 domain-containing protein	NA	NA	NA	NA	NA
WP_153987214.1|299030_300413_+	DUF1552 domain-containing protein	NA	NA	NA	NA	NA
WP_153987107.1|300512_301391_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.2	3.6e-20
WP_153987106.1|301381_301882_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153987215.1|302311_303274_+	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_162010184.1|303517_303895_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	45.9	1.1e-23
WP_162010185.1|303804_304356_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP043547	Planctomycetales bacterium 10988 chromosome, complete genome	6649480	348106	409951	6649480	transposase,integrase	Leptospira_phage(25.0%)	45	371335:371351	417487:417503
WP_162010189.1|348106_349153_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_153987246.1|349139_349373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162010190.1|350203_351757_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153987248.1|351828_352047_-	topoisomerase II	NA	NA	NA	NA	NA
WP_153987249.1|352584_353853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987250.1|353849_355352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987251.1|357750_359166_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153987252.1|359610_361143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987253.1|361779_372354_+	VCBS repeat-containing protein	NA	S5W9C6	Leptospira_phage	34.5	1.6e-08
371335:371351	attL	TTCCTCTCCGAAGACCC	NA	NA	NA	NA
WP_153987254.1|372359_372848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987255.1|372952_373429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987256.1|373425_373710_+	DUF5076 domain-containing protein	NA	NA	NA	NA	NA
WP_153987257.1|373867_375517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987258.1|375519_376122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987259.1|376293_377871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987260.1|377836_378406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987261.1|378586_378991_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_153987262.1|379289_379853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987263.1|380196_380550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987264.1|381406_382840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987265.1|382812_383616_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153987266.1|384154_385318_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_153987267.1|385539_386778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987268.1|387255_387747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987269.1|387776_388982_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_153987270.1|389455_389917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987271.1|390542_391775_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IUW9	uncultured_Mediterranean_phage	30.0	4.9e-39
WP_153987272.1|391779_392697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987273.1|393013_393298_+	DUF1580 domain-containing protein	NA	NA	NA	NA	NA
WP_153987274.1|393423_394179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987275.1|394181_395591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987276.1|395587_395977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987277.1|396290_397289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987278.1|397255_398545_+	hypothetical protein	NA	A0A142KBX8	Gordonia_phage	32.2	8.8e-15
WP_153987279.1|399003_399435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987280.1|399520_399844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162010191.1|399997_400276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987282.1|400429_400573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987283.1|400614_401163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987284.1|401391_402552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987285.1|402894_403077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987286.1|403094_407609_+	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_153987287.1|407979_408123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987288.1|408565_409036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987107.1|409072_409951_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.2	3.6e-20
417487:417503	attR	GGGTCTTCGGAGAGGAA	NA	NA	NA	NA
>prophage 3
NZ_CP043547	Planctomycetales bacterium 10988 chromosome, complete genome	6649480	463437	538341	6649480	transposase,protease	uncultured_Mediterranean_phage(40.0%)	48	NA	NA
WP_153987325.1|463437_466845_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_153987326.1|467282_470249_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_153987327.1|470178_472188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987329.1|473513_479387_-	FG-GAP repeat protein	NA	NA	NA	NA	NA
WP_162010193.1|480782_482780_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_153987331.1|483649_484345_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_153987332.1|484341_484785_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153987333.1|485046_486657_+	FG-GAP repeat protein	NA	NA	NA	NA	NA
WP_153987334.1|486924_487839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987335.1|487846_489826_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_162010194.1|489836_491705_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	33.5	4.3e-39
WP_174241907.1|495954_496338_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162010195.1|496343_496733_-|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	38.4	1.0e-11
WP_153987339.1|497086_497698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987340.1|498069_499083_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153987341.1|499242_500715_+	DUF1254 domain-containing protein	NA	M1H738	Paramecium_bursaria_Chlorella_virus	26.5	6.9e-32
WP_153987342.1|500765_502334_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_153987343.1|502767_512634_+	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_153987344.1|512811_513354_-	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_153987345.1|513409_513715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987346.1|514064_515423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987347.1|515586_516465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987348.1|516881_517721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162010577.1|519129_519948_+	DUF1588 domain-containing protein	NA	NA	NA	NA	NA
WP_153987350.1|519947_520154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162010196.1|520220_520748_+	DUF1552 domain-containing protein	NA	NA	NA	NA	NA
WP_153987352.1|520867_521758_-	hypothetical protein	NA	A0A1B1IUW9	uncultured_Mediterranean_phage	26.1	6.5e-17
WP_153987353.1|522670_523108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987354.1|523785_523968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987355.1|524499_524691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162010197.1|525070_525397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987357.1|525936_526623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987358.1|526619_526829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987359.1|526825_527272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987360.1|527277_527901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987361.1|528186_528699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987362.1|528729_528906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987363.1|528981_529167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987364.1|529242_529515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987365.1|529956_531039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162010198.1|531152_533591_+	Helicase associated domain protein	NA	NA	NA	NA	NA
WP_153987367.1|533587_535006_+	ParB N-terminal domain-containing protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	26.6	9.9e-28
WP_153987368.1|535384_535672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987369.1|535856_536291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987370.1|536468_536693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987371.1|536741_537140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987372.1|537448_537958_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162010199.1|537951_538341_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP043547	Planctomycetales bacterium 10988 chromosome, complete genome	6649480	546279	608540	6649480	integrase,transposase	Brevibacillus_phage(12.5%)	51	545717:545731	580545:580559
545717:545731	attL	CACGGGCGTCAGCAA	NA	NA	NA	NA
WP_153987380.1|546279_547215_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	30.5	5.4e-30
WP_162010203.1|547391_547652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987382.1|547648_548269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987383.1|548314_548602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987384.1|548657_548855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987385.1|548908_549463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987386.1|549829_551299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987387.1|551524_551857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987388.1|551832_552456_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_153987389.1|552452_552845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987390.1|552841_553051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987391.1|553425_553563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987392.1|553574_554834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987393.1|555106_555409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987394.1|555353_556826_+	recombinase family protein	NA	D2IZV7	Enterococcus_phage	24.1	1.1e-08
WP_153987395.1|556862_558527_+	recombinase family protein	NA	NA	NA	NA	NA
WP_153987396.1|558595_560566_+	recombinase family protein	NA	NA	NA	NA	NA
WP_153987397.1|561056_561425_+	DUF1257 domain-containing protein	NA	NA	NA	NA	NA
WP_153987398.1|561421_561616_+	DUF2997 domain-containing protein	NA	NA	NA	NA	NA
WP_153987399.1|561699_563190_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	28.8	3.5e-47
WP_153987400.1|563275_563530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987305.1|563545_563767_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153987306.1|563920_564367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987307.1|564486_565437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987308.1|565452_565695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987401.1|565746_566145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987402.1|566229_566442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987403.1|566448_566712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987404.1|566711_567848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987405.1|569307_569598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153991474.1|569607_569781_+	hypothetical protein	NA	A0A2P1CGF5	Mycobacterium_phage	61.2	5.2e-08
WP_153987406.1|570034_570973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987407.1|571249_571714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987408.1|571710_572850_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	25.8	6.3e-17
WP_153987409.1|572887_576115_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_153987410.1|576050_576665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987411.1|576634_579640_-	site-specific DNA-methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	26.3	2.8e-27
WP_153991475.1|579657_582525_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	48.8	8.7e-265
580545:580559	attR	CACGGGCGTCAGCAA	NA	NA	NA	NA
WP_153987412.1|584260_584848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987413.1|585004_585601_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	29.1	1.6e-11
WP_153987414.1|585657_585864_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153987415.1|586341_595395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987416.1|595448_602969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987417.1|603562_604042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162010204.1|604038_604188_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153987418.1|604269_604413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987419.1|604612_604888_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_153987420.1|604999_605185_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153987421.1|606285_607218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987422.1|607417_607612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162010205.1|607805_608540_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP043547	Planctomycetales bacterium 10988 chromosome, complete genome	6649480	620708	686421	6649480	integrase,transposase	Paenibacillus_phage(42.86%)	48	619730:619745	641666:641681
619730:619745	attL	TGATCAAAATCCGCTT	NA	NA	NA	NA
WP_153987433.1|620708_621599_+|integrase	phage integrase SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_162010208.1|621642_622233_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153987435.1|622316_626579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987436.1|626620_626992_-	Hint domain-containing protein	NA	A0A2K9VC86	Lactobacillus_phage	39.2	9.0e-05
WP_153987437.1|627092_627974_-	immunity 49 family protein	NA	NA	NA	NA	NA
WP_153987438.1|627996_650952_-	hypothetical protein	NA	NA	NA	NA	NA
641666:641681	attR	TGATCAAAATCCGCTT	NA	NA	NA	NA
WP_153987439.1|651792_652953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987440.1|653159_653840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987441.1|654633_655401_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153987442.1|655604_656564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987332.1|656764_657208_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153987331.1|657204_657900_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162010209.1|657927_658596_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153987444.1|658619_658766_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	54.2	1.1e-09
WP_153987445.1|658921_659248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987446.1|659260_659491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987447.1|659649_660537_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_174241908.1|661105_661489_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153987449.1|661494_661884_-|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	38.4	7.9e-12
WP_153987450.1|661977_662118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162010210.1|662143_662467_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_153987452.1|662575_662947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174241909.1|663092_663287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987453.1|664864_665026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987454.1|665242_665392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987455.1|665561_666329_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_153991478.1|666361_667234_-	ectoine hydroxylase	NA	NA	NA	NA	NA
WP_153987456.1|667334_667718_-	ectoine synthase	NA	NA	NA	NA	NA
WP_153991479.1|667831_669094_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.7	8.9e-20
WP_153991480.1|669145_669619_-	diaminobutyrate acetyltransferase	NA	NA	NA	NA	NA
WP_153991481.1|669894_671382_+	sodium/proline symporter	NA	NA	NA	NA	NA
WP_162010211.1|671625_672615_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_153987458.1|672969_673374_-	bifunctional nuclease family protein	NA	NA	NA	NA	NA
WP_153987459.1|673694_674078_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153987460.1|674083_674473_-|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.6	5.7e-10
WP_153987461.1|674530_675022_-	DsrE family protein	NA	NA	NA	NA	NA
WP_153987462.1|675137_676325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987463.1|676708_677506_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_153991482.1|677558_678104_-	DUF3124 domain-containing protein	NA	NA	NA	NA	NA
WP_153987464.1|678593_681014_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_153987465.1|681142_681391_+	DUF3302 domain-containing protein	NA	NA	NA	NA	NA
WP_153987466.1|681387_682515_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_162010212.1|682593_683145_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153988178.1|683054_683432_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	43.9	2.5e-23
WP_153987469.1|684741_685398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987470.1|685583_685961_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	43.9	5.7e-23
WP_162010213.1|685870_686215_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162010214.1|686211_686421_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043547	Planctomycetales bacterium 10988 chromosome, complete genome	6649480	860795	871590	6649480	transposase	Acidithiobacillus_phage(66.67%)	7	NA	NA
WP_153987106.1|860795_861296_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153987107.1|861286_862165_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.2	3.6e-20
WP_162010228.1|862112_862736_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162010229.1|862645_863023_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	45.0	4.3e-23
WP_153987580.1|863259_868395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987581.1|870133_871099_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.2	4.0e-20
WP_153987106.1|871089_871590_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043547	Planctomycetales bacterium 10988 chromosome, complete genome	6649480	875190	910811	6649480	transposase,integrase,tRNA	uncultured_Mediterranean_phage(22.22%)	31	887342:887401	899055:899213
WP_153987585.1|875190_876054_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_153987586.1|876707_879536_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	44.9	7.7e-173
WP_153987587.1|879712_882016_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_153987588.1|882181_883252_+	ribonucleotide-diphosphate reductase subunit beta	NA	U5Q1G6	Bacillus_phage	26.9	3.0e-29
WP_153987589.1|883626_885129_+	TolC family protein	NA	NA	NA	NA	NA
WP_153987590.1|885306_886053_+	AAA family ATPase	NA	Q8JL10	Natrialba_phage	31.8	2.0e-11
WP_153987591.1|886045_887101_+	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	34.3	8.5e-16
887342:887401	attL	GGGACCAGAAGGTCGCAGGTTCGAATCCTGTCTCCCCGACTTTTCCTAACTCTATTCTGA	NA	NA	NA	NA
WP_153987592.1|887500_888688_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IUW9	uncultured_Mediterranean_phage	30.6	1.4e-38
WP_162010232.1|890225_890615_+|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	38.4	7.9e-12
WP_162010233.1|890554_891004_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153987595.1|891110_892505_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	38.1	7.6e-89
WP_153987596.1|892684_892981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987597.1|892987_894601_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_153987598.1|895297_896182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987599.1|896244_896697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987592.1|897767_898955_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IUW9	uncultured_Mediterranean_phage	30.6	1.4e-38
WP_153987600.1|899249_900782_+	hypothetical protein	NA	NA	NA	NA	NA
899055:899213	attR	TCAGAATAGAGTTAGGAAAAGTCGGGGAGACAGGATTCGAACCTGCGACCTTCTGGTCCCGAACGCAGAACCAAAAATTAAATGTGTTGTTTATCAACGACTTACGTCAAGCGGTGATACCATTTCTGCTCCCGGTCTGGTACAAAAGGTATCTCCAAA	NA	NA	NA	NA
WP_162010234.1|901133_902105_-	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_153987602.1|902212_902695_-	TIGR03067 domain-containing protein	NA	NA	NA	NA	NA
WP_153987603.1|902863_903190_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_153987604.1|903286_904171_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_153987605.1|904557_904926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987606.1|905246_905624_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_153987607.1|905776_906448_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_153987608.1|906459_907011_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_162010235.1|907007_907136_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_153987610.1|907110_907593_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_153991491.1|908304_909321_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_153987611.1|909712_909883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987612.1|910008_910398_+|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.6	1.1e-10
WP_162010236.1|910337_910811_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP043547	Planctomycetales bacterium 10988 chromosome, complete genome	6649480	1663241	1729784	6649480	integrase,protease,transposase	Cyanophage(14.29%)	44	1683822:1683876	1730062:1730116
WP_153988137.1|1663241_1663751_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_153988138.1|1663747_1664686_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.4	5.9e-37
WP_153988139.1|1664812_1666909_-	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	25.2	8.6e-52
WP_153988140.1|1667237_1667960_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_153988141.1|1668141_1668771_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_153988142.1|1669131_1669695_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_153988143.1|1669967_1671542_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_153988144.1|1671883_1672111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153988145.1|1672149_1675074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162010296.1|1675024_1675669_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_153988147.1|1676528_1678673_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_153988148.1|1678752_1679700_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_153988149.1|1680000_1680240_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_153988150.1|1680236_1680683_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_153988151.1|1680729_1680891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153988152.1|1680905_1681916_-	DnaJ domain-containing protein	NA	A0A1V0SF83	Hokovirus	31.3	9.9e-14
WP_162010297.1|1682302_1683103_+	glucose 1-dehydrogenase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	34.1	1.9e-23
WP_153988154.1|1683126_1683567_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
1683822:1683876	attL	TTCAGGTTCTAGTGGGGGCAACCCCGTGGAGGTTCAAGTCCTCTCTTCGGCACTA	NA	NA	NA	NA
WP_153988155.1|1684063_1685305_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153988156.1|1685307_1687503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153988157.1|1687743_1688037_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153988158.1|1688578_1691239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987348.1|1691423_1692263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153988159.1|1692722_1693610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153988160.1|1694342_1694714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153988161.1|1694695_1695988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153988162.1|1695984_1707513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153988163.1|1707710_1713560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153988164.1|1713643_1714843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153988165.1|1714802_1715369_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_162010298.1|1715453_1716128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153988167.1|1716140_1716644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153988168.1|1716711_1717794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153988169.1|1717851_1718067_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153988170.1|1718126_1720229_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_174241911.1|1720381_1720765_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153988172.1|1720770_1721160_-|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.6	2.0e-10
WP_153988173.1|1721274_1721766_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153987106.1|1721871_1722372_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153988174.1|1722362_1723487_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.2	4.6e-20
WP_153988176.1|1723797_1728555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162010214.1|1728946_1729156_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162010299.1|1729152_1729497_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153988178.1|1729406_1729784_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	43.9	2.5e-23
1730062:1730116	attR	TTCAGGTTCTAGTGGGGGCAACCCCGTGGAGGTTCAAGTCCTCTCTTCGGCACTA	NA	NA	NA	NA
>prophage 9
NZ_CP043547	Planctomycetales bacterium 10988 chromosome, complete genome	6649480	3265313	3329945	6649480	transposase	Mycobacterium_phage(28.57%)	46	NA	NA
WP_153989227.1|3265313_3266348_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_153989228.1|3266384_3267587_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	23.9	7.9e-10
WP_162010378.1|3267843_3268287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162010379.1|3268390_3271354_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_162010380.1|3271532_3272816_-	glycosyltransferase family 1 protein	NA	Q2NP60	Hyphantria_cunea_nuclear_polyhedrosis_virus	29.9	3.7e-05
WP_153989232.1|3273123_3273723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987452.1|3275390_3275762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162010210.1|3275870_3276194_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_153987450.1|3276219_3276360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153989233.1|3276453_3276843_+|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.6	9.7e-10
WP_153987955.1|3276848_3277232_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162010381.1|3277718_3277985_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153989235.1|3277967_3278780_-|transposase	transposase	transposase	K4ICS3	Acidithiobacillus_phage	42.1	5.3e-18
WP_153989236.1|3280106_3281342_-	DNA topoisomerase IV subunit A	NA	NA	NA	NA	NA
WP_153989237.1|3281334_3283320_-	DNA topoisomerase VI subunit B	NA	NA	NA	NA	NA
WP_153989238.1|3284281_3284713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153989239.1|3284842_3285262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153989240.1|3285525_3286557_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_153989241.1|3286631_3287693_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_153989242.1|3287689_3288643_+	ribokinase	NA	NA	NA	NA	NA
WP_153991605.1|3288821_3289664_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_153989243.1|3289660_3291214_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	1.3e-12
WP_153989244.1|3291242_3292307_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_153989245.1|3292349_3293375_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_153989246.1|3293382_3294405_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_153989247.1|3294500_3295565_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_153989248.1|3295561_3298102_+	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_153991606.1|3298123_3298507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153989249.1|3298506_3299151_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_153989250.1|3299155_3300295_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_153989251.1|3300328_3301000_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_153989252.1|3301095_3303045_-	aconitate hydratase	NA	NA	NA	NA	NA
WP_153989253.1|3303431_3303932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153989254.1|3304120_3305758_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_153989255.1|3305772_3307209_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_153989256.1|3307310_3311354_-	general secretion pathway protein GspD	NA	NA	NA	NA	NA
WP_153989257.1|3311972_3312833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153989258.1|3313309_3314092_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_153989259.1|3314175_3314988_+	ATP-binding cassette domain-containing protein	NA	M1H3A1	Paramecium_bursaria_Chlorella_virus	25.6	3.0e-05
WP_153989260.1|3314984_3317015_-	protein kinase	NA	A0A0U2U263	Niemeyer_virus	25.9	1.1e-11
WP_153989261.1|3320033_3321425_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_153989262.1|3321529_3323968_-	DUF1549 domain-containing protein	NA	NA	NA	NA	NA
WP_153989263.1|3324455_3325865_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_153989264.1|3325940_3327488_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_153991607.1|3327542_3329063_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_153987106.1|3329444_3329945_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP043547	Planctomycetales bacterium 10988 chromosome, complete genome	6649480	3641589	3651074	6649480	portal,head	uncultured_marine_virus(33.33%)	12	NA	NA
WP_153989484.1|3641589_3643422_-	hypothetical protein	NA	A0A0F7L9V3	uncultured_marine_virus	25.6	6.4e-11
WP_153989485.1|3643434_3643722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153989486.1|3643745_3644159_-	hypothetical protein	NA	D7NW62	Streptomyces_phage	40.8	2.5e-16
WP_153989487.1|3644219_3644636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153989488.1|3644687_3645086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153989489.1|3645104_3645512_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_153989490.1|3645512_3645992_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_153989491.1|3645984_3646353_-|head	phage head closure protein	head	A6M954	Geobacillus_virus	29.6	7.3e-07
WP_153989492.1|3646364_3647348_-	hypothetical protein	NA	A0A0F7L790	uncultured_marine_virus	38.2	5.6e-54
WP_153989493.1|3647420_3648149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153989494.1|3648229_3649510_-	signal peptide peptidase SppA	NA	G8DCP1	Silicibacter_phage	33.1	1.5e-19
WP_153989495.1|3649502_3651074_-|portal	phage portal protein	portal	A0A088C529	Shewanella_sp._phage	19.9	1.9e-11
>prophage 11
NZ_CP043547	Planctomycetales bacterium 10988 chromosome, complete genome	6649480	3865192	3977305	6649480	transposase,protease	Tetraselmis_virus(18.18%)	53	NA	NA
WP_153987106.1|3865192_3865693_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153987107.1|3865683_3866562_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.2	3.6e-20
WP_162010405.1|3866832_3868239_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	26.5	3.6e-30
WP_153989652.1|3868296_3869724_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_153989653.1|3869760_3874050_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_153989654.1|3874360_3874918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153989655.1|3875164_3876127_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2K9L4U8	Tupanvirus	46.6	5.8e-72
WP_162010406.1|3876289_3876772_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_162010407.1|3877184_3877424_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_162010408.1|3877529_3877805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153989658.1|3878154_3879927_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_153989659.1|3880519_3884011_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_153988178.1|3884243_3884621_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	43.9	2.5e-23
WP_162010409.1|3884530_3885082_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153989661.1|3885163_3885403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162010410.1|3885415_3885529_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153991632.1|3885587_3886892_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_153989662.1|3887157_3888411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153989663.1|3888435_3888975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153991633.1|3889306_3890476_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_153989664.1|3890623_3891013_-	immunity 22 family protein	NA	NA	NA	NA	NA
WP_153989665.1|3891061_3891511_-	immunity 22 family protein	NA	NA	NA	NA	NA
WP_153991634.1|3891714_3893358_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_153991635.1|3893561_3894800_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_162010411.1|3896053_3921643_+	DUF4347 domain-containing protein	NA	E3SSU6	Prochlorococcus_phage	29.6	5.8e-09
WP_153991636.1|3921721_3923404_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_153989667.1|3923758_3925147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153989668.1|3925151_3926057_-	FAD-dependent thymidylate synthase	NA	A0A0N7KVT4	Yellowstone_lake_phycodnavirus	55.8	4.1e-59
WP_153989669.1|3926171_3929090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153989670.1|3929217_3930576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153989671.1|3931290_3932997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153989672.1|3933140_3934493_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	31.2	4.4e-41
WP_153989673.1|3935038_3935437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153989674.1|3935513_3936017_-	DUF1569 domain-containing protein	NA	NA	NA	NA	NA
WP_153991637.1|3936161_3938837_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.2	2.2e-100
WP_153989675.1|3939987_3940923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153989676.1|3941013_3943383_-	DUF4340 domain-containing protein	NA	NA	NA	NA	NA
WP_153989677.1|3943483_3946657_-	Gldg family protein	NA	NA	NA	NA	NA
WP_153991638.1|3946842_3947574_-	ATP-binding cassette domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.2	1.7e-23
WP_153989678.1|3948247_3949054_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_153989679.1|3949141_3950482_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_153989680.1|3950697_3952116_+	HD domain-containing protein	NA	A0A2K9L0X9	Tupanvirus	29.3	2.0e-20
WP_153989681.1|3952307_3955829_+	FG-GAP repeat protein	NA	NA	NA	NA	NA
WP_153989682.1|3956093_3959612_+	FG-GAP repeat protein	NA	NA	NA	NA	NA
WP_153989683.1|3959861_3963440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153989684.1|3963442_3964204_-	hypothetical protein	NA	A0A292GAJ3	Xanthomonas_phage	30.8	1.4e-20
WP_153989685.1|3964322_3965555_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_153989686.1|3966067_3969046_+	protein kinase	NA	NA	NA	NA	NA
WP_153989687.1|3969202_3971116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153989688.1|3971360_3972236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153989689.1|3972248_3973550_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_153989690.1|3973651_3975592_-	DUF1549 domain-containing protein	NA	NA	NA	NA	NA
WP_153989691.1|3975889_3977305_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 12
NZ_CP043547	Planctomycetales bacterium 10988 chromosome, complete genome	6649480	5026075	5165068	6649480	transposase,integrase,tRNA	Acidithiobacillus_phage(17.65%)	102	5097859:5097873	5147580:5147594
WP_153990424.1|5026075_5027089_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_153990425.1|5027081_5027615_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_153990426.1|5027716_5028070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153990427.1|5029134_5030550_+	magnesium chelatase	NA	NA	NA	NA	NA
WP_153990428.1|5030714_5032412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990429.1|5032660_5034421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990430.1|5034691_5036146_+	sigma 54-interacting transcriptional regulator	NA	W8CYM9	Bacillus_phage	27.3	4.9e-06
WP_153990431.1|5036218_5040244_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	31.4	6.9e-58
WP_153990432.1|5040569_5040824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990433.1|5040956_5041973_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	38.6	4.1e-60
WP_153990434.1|5042041_5043646_-	sulfotransferase	NA	NA	NA	NA	NA
WP_153990435.1|5043724_5044600_-	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_153990436.1|5044653_5044944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153990437.1|5045007_5045742_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_174241930.1|5045851_5046301_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_153990439.1|5046488_5047646_-	Sua5/YciO/YrdC/YwlC family protein	NA	NA	NA	NA	NA
WP_153990440.1|5048043_5048664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153990441.1|5048812_5049628_-	glucose 1-dehydrogenase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.9	9.8e-12
WP_153990442.1|5049999_5052723_+	glucosidase	NA	NA	NA	NA	NA
WP_153990443.1|5052807_5053164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990444.1|5053200_5055123_-	DUF4214 domain-containing protein	NA	NA	NA	NA	NA
WP_153990445.1|5055501_5056557_+	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_153990446.1|5057251_5059429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162010473.1|5059762_5060515_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_153990448.1|5060630_5061269_+	DUF1080 domain-containing protein	NA	NA	NA	NA	NA
WP_153990449.1|5061368_5061743_-	immunity 22 family protein	NA	NA	NA	NA	NA
WP_153990450.1|5061857_5062751_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_153990451.1|5063043_5063961_+	TIGR02996 domain-containing protein	NA	NA	NA	NA	NA
WP_153988178.1|5064574_5064952_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	43.9	2.5e-23
WP_162010409.1|5064861_5065413_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153990452.1|5065438_5065963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987440.1|5066756_5067437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153990453.1|5067643_5068780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153990454.1|5069122_5075332_+	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_153990455.1|5075654_5080112_+	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_153990456.1|5080394_5086592_+	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_153990457.1|5086944_5087106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987288.1|5087548_5088019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987107.1|5088055_5088934_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.2	3.6e-20
WP_153987106.1|5088924_5089425_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153990458.1|5089667_5090726_-	FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	44.9	1.6e-70
WP_153990459.1|5091018_5092923_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_153991676.1|5092973_5093333_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_153990460.1|5093657_5095295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990461.1|5095576_5096536_-	UbiA family prenyltransferase	NA	NA	NA	NA	NA
WP_153990462.1|5096539_5096749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162010474.1|5096805_5097915_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
5097859:5097873	attL	GCGAATCGGGGCCAA	NA	NA	NA	NA
WP_153990464.1|5098136_5099474_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_153990465.1|5100177_5100663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990466.1|5100699_5101053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990467.1|5101082_5101715_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_162010475.1|5102049_5102523_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153990469.1|5102462_5102852_-|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	37.5	8.8e-11
WP_162010476.1|5103244_5103427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162010477.1|5103631_5103919_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153991677.1|5103949_5105173_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y5X7	Haemophilus_phage	25.7	9.2e-06
WP_153990471.1|5105708_5106830_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_153990472.1|5107331_5109467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990473.1|5109476_5110208_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_153990474.1|5110204_5110606_+	DUF2304 family protein	NA	NA	NA	NA	NA
WP_153990475.1|5110694_5111666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990476.1|5111795_5112755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162010478.1|5113031_5113676_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_153990478.1|5113675_5114101_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_153990479.1|5114105_5114558_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_162010479.1|5114559_5117082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990481.1|5117118_5117748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990482.1|5117766_5118243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153990483.1|5118414_5120556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153990484.1|5121009_5122884_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_153990485.1|5122883_5123804_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_153990486.1|5123858_5125016_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_153990487.1|5125020_5126031_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.9	5.3e-15
WP_153991678.1|5126068_5127088_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.0	7.4e-17
WP_153990488.1|5127134_5127620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153990489.1|5127771_5129358_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_153990490.1|5129457_5130828_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_153990491.1|5131009_5133568_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_153990492.1|5133863_5138003_-	FG-GAP repeat protein	NA	NA	NA	NA	NA
WP_153990493.1|5138305_5140747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153990494.1|5141586_5143974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153991679.1|5145257_5146811_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_153991680.1|5146886_5149016_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.4	4.7e-106
5147580:5147594	attR	GCGAATCGGGGCCAA	NA	NA	NA	NA
WP_153990495.1|5149187_5149961_+	UvrB/UvrC motif-containing protein	NA	NA	NA	NA	NA
WP_162010481.1|5150444_5150666_+	carbon storage regulator	NA	H2BD56	Pseudomonas_phage	41.4	8.2e-06
WP_153990497.1|5151565_5152084_-	hypothetical protein	NA	K4ICS3	Acidithiobacillus_phage	39.8	3.0e-06
WP_153990498.1|5152121_5152436_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153990499.1|5152537_5153284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162010482.1|5153317_5153650_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_153990501.1|5153799_5154480_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A0P0IVM8	Acinetobacter_phage	35.8	5.3e-19
WP_153990502.1|5154476_5155550_+	FAD binding domain-containing protein	NA	NA	NA	NA	NA
WP_153990503.1|5155682_5157926_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_153990504.1|5157976_5159158_+	XdhC family protein	NA	NA	NA	NA	NA
WP_153990505.1|5159154_5159781_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_153990506.1|5159973_5160759_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162010483.1|5160988_5161945_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_153990508.1|5162078_5162669_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_162010484.1|5162736_5163372_-|transposase	transposase	transposase	K4I1H9	Acidithiobacillus_phage	50.0	5.8e-20
WP_162010485.1|5163337_5163616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987106.1|5163606_5164107_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162010486.1|5164106_5164781_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162010290.1|5164690_5165068_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	43.1	9.7e-23
>prophage 13
NZ_CP043547	Planctomycetales bacterium 10988 chromosome, complete genome	6649480	5532993	5602300	6649480	transposase	Acidithiobacillus_phage(20.0%)	57	NA	NA
WP_153990733.1|5532993_5533881_+|transposase	transposase	transposase	K4ICS3	Acidithiobacillus_phage	44.4	3.6e-20
WP_153989995.1|5534035_5534821_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153990734.1|5535044_5536340_-	glucose-1-phosphate adenylyltransferase	NA	A0A291LA53	Escherichia_phage	29.1	4.4e-06
WP_153990735.1|5536872_5537658_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_153990736.1|5538218_5540135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990737.1|5540247_5540844_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_153990738.1|5540938_5542177_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_153990739.1|5542438_5542678_-	acyl carrier protein	NA	A0A1P8VWH3	Flavobacterium_phage	40.8	1.2e-05
WP_153990740.1|5543187_5543958_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
WP_153990741.1|5544049_5544961_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_153990742.1|5545255_5546251_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_153990743.1|5546257_5546437_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_162010502.1|5546905_5549698_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_153990745.1|5550044_5550473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153990746.1|5550572_5552630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153991691.1|5552722_5554177_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_153990747.1|5554500_5556057_+	sulfatase-like hydrolase/transferase	NA	A0A1V0SA98	Catovirus	22.3	4.4e-21
WP_153990748.1|5556119_5557478_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_153990749.1|5557592_5558369_-	nucleotidyltransferase domain-containing protein	NA	K4K696	Caulobacter_phage	36.5	1.5e-09
WP_153990750.1|5558457_5559453_-	nucleotidyltransferase domain-containing protein	NA	G3M9V9	Bacillus_virus	28.7	4.8e-21
WP_153990751.1|5559626_5560898_-	MFS transporter	NA	NA	NA	NA	NA
WP_153990752.1|5561857_5562226_+	DUF1257 domain-containing protein	NA	NA	NA	NA	NA
WP_153990753.1|5562222_5562417_+	DUF2997 domain-containing protein	NA	NA	NA	NA	NA
WP_153990754.1|5562501_5563992_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	29.0	1.2e-47
WP_153990755.1|5564089_5565034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990756.1|5565044_5565233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987106.1|5565232_5565733_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153990757.1|5565723_5566842_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.2	4.6e-20
WP_153990758.1|5566902_5567301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990759.1|5567383_5567602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990760.1|5567662_5567836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990761.1|5567954_5569280_-	FG-GAP repeat protein	NA	NA	NA	NA	NA
WP_153990762.1|5569276_5571331_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_153990763.1|5571363_5574330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153987285.1|5574347_5574530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153990764.1|5574872_5576009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987440.1|5576215_5576896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990765.1|5577684_5578374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162010503.1|5579083_5580214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153991692.1|5583243_5583540_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_153990767.1|5583559_5585263_-	type I-MYXAN CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_153990768.1|5585238_5585967_-	type I-MYXAN CRISPR-associated protein Cas5/Cmx5/DevS	NA	NA	NA	NA	NA
WP_153990769.1|5585970_5586927_-	type I-B CRISPR-associated protein Cas7/Cst2/DevR	NA	NA	NA	NA	NA
WP_153990770.1|5586978_5588697_-	type I-MYXAN CRISPR-associated protein Cmx8	NA	NA	NA	NA	NA
WP_153990771.1|5588666_5591063_-	CRISPR-associated helicase Cas3'	NA	A0A2R2ZGW0	Clostridioides_phage	21.9	5.4e-10
WP_153990772.1|5591059_5591683_-	type I-MYXAN CRISPR-associated protein Cas6/Cmx6	NA	NA	NA	NA	NA
WP_162010504.1|5591699_5592119_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_153990774.1|5592450_5593452_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_153990775.1|5594016_5595987_+	recombinase family protein	NA	NA	NA	NA	NA
WP_153990776.1|5596475_5596844_+	DUF1257 domain-containing protein	NA	NA	NA	NA	NA
WP_153990777.1|5596840_5597035_+	DUF2997 domain-containing protein	NA	NA	NA	NA	NA
WP_153990778.1|5597118_5598609_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	28.0	2.5e-45
WP_153990779.1|5598694_5598949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990780.1|5599213_5600164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990781.1|5600179_5600422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153990782.1|5600448_5600973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987251.1|5600884_5602300_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP043547	Planctomycetales bacterium 10988 chromosome, complete genome	6649480	5845837	5878293	6649480	protease,plate,tail,tRNA	Klosneuvirus(25.0%)	22	NA	NA
WP_153990936.1|5845837_5847493_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_153990937.1|5848260_5849403_+	DUF2183 domain-containing protein	NA	NA	NA	NA	NA
WP_153990938.1|5849519_5850968_+|tail	lamin tail domain-containing protein	tail	NA	NA	NA	NA
WP_153990939.1|5850997_5851603_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_153990940.1|5851622_5853611_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	30.7	1.4e-64
WP_153990941.1|5853827_5856440_-	protein kinase	NA	A0A1E1EXF7	Acanthamoeba_castellanii_mimivirus	31.0	5.0e-17
WP_153990942.1|5856796_5858407_-	response regulator	NA	NA	NA	NA	NA
WP_153990943.1|5858855_5859929_-	protein kinase	NA	Q67624	IC4_retrovirus	33.3	4.9e-19
WP_153990944.1|5860348_5860939_-	RNAase	NA	NA	NA	NA	NA
WP_153990945.1|5861022_5862924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153990946.1|5862940_5863582_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_153990947.1|5863578_5865045_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_153990948.1|5865523_5867182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153990949.1|5867537_5867921_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_153990950.1|5867960_5869067_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_162010521.1|5869095_5870448_+	radical SAM protein	NA	NA	NA	NA	NA
WP_162010522.1|5870472_5871123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153990953.1|5871250_5873944_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	32.0	6.0e-90
WP_153990954.1|5874027_5874570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153990955.1|5874677_5875979_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_153990956.1|5875942_5877805_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_153990957.1|5877807_5878293_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 15
NZ_CP043547	Planctomycetales bacterium 10988 chromosome, complete genome	6649480	6230598	6308823	6649480	transposase,tRNA	uncultured_Mediterranean_phage(28.57%)	57	NA	NA
WP_153987331.1|6230598_6231294_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_153987332.1|6231290_6231734_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153991188.1|6232522_6233791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153991189.1|6233956_6234340_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_153991190.1|6234362_6235796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153991191.1|6236326_6236545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153991192.1|6236724_6239133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153991193.1|6239283_6240210_-	DUF3473 domain-containing protein	NA	NA	NA	NA	NA
WP_153991194.1|6240283_6240994_-	exosortase-associated EpsI family protein	NA	NA	NA	NA	NA
WP_162010543.1|6241554_6244788_-	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	32.6	4.0e-24
WP_153991195.1|6244928_6245333_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_153991196.1|6245426_6245585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153991726.1|6245756_6246869_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.4	1.5e-87
WP_153991197.1|6247292_6248621_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_153991198.1|6248844_6252126_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.2	3.1e-56
WP_162010544.1|6252138_6253806_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_153991200.1|6254611_6255493_-	recombinase RecA	NA	NA	NA	NA	NA
WP_153991201.1|6255606_6256710_-	alanine racemase	NA	NA	NA	NA	NA
WP_162010545.1|6257227_6257977_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_153991203.1|6258017_6259733_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A0H3TLZ4	Faustovirus	26.6	1.5e-14
WP_153991204.1|6259932_6260382_-	FG-GAP repeat protein	NA	NA	NA	NA	NA
WP_153991205.1|6260452_6260938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153991206.1|6260874_6261237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162010546.1|6261662_6262484_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_174241907.1|6263365_6263749_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153991208.1|6263754_6264177_-|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	37.5	1.9e-11
WP_153991209.1|6264224_6264620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153991210.1|6264808_6265459_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_153991211.1|6265991_6266462_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_153991212.1|6266793_6268716_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_162010547.1|6268734_6269544_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_153991214.1|6269842_6270751_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_153991728.1|6271095_6271581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153991215.1|6271772_6274919_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_153991216.1|6275197_6276115_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_153991217.1|6276251_6276662_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_153991218.1|6276674_6278780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153991219.1|6279096_6279309_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_153991220.1|6279457_6279736_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_153991221.1|6280011_6280218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153991222.1|6280334_6281156_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_153987331.1|6282826_6283522_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_153987332.1|6283518_6283962_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153991223.1|6284042_6285488_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_153991224.1|6285552_6288483_-	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_153991225.1|6288631_6290212_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_153991226.1|6290311_6291757_-	MFS transporter	NA	NA	NA	NA	NA
WP_153991227.1|6292112_6292550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153991228.1|6292741_6294244_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_153991229.1|6294259_6297433_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	24.7	5.9e-89
WP_153991230.1|6298599_6299922_+	DUF1552 domain-containing protein	NA	NA	NA	NA	NA
WP_162010548.1|6299992_6302461_+	DUF1592 domain-containing protein	NA	NA	NA	NA	NA
WP_153991232.1|6302557_6302917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153991233.1|6303490_6304102_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_162010549.1|6304436_6306968_+	protein kinase	NA	A0A1E1EXF7	Acanthamoeba_castellanii_mimivirus	28.7	6.5e-22
WP_153991235.1|6307003_6307810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153987106.1|6308322_6308823_+|transposase	transposase	transposase	NA	NA	NA	NA
