The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043486	Escherichia coli strain SL112 chromosome, complete genome	4789695	197062	270320	4789695	protease,tRNA,plate,transposase	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_001346129.1|197062_198415_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|198444_200877_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|200998_201484_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|201487_202513_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|202617_203073_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|203076_203865_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|203864_205013_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|205009_205606_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|205642_209125_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|209137_210097_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001021030.1|210195_212337_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|212393_212783_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|212847_214146_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|214194_214455_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|214441_214642_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|214807_215353_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|215349_215772_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|215785_216496_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001297208.1|216650_217475_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|217528_219247_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|219357_220065_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|220061_220466_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|220583_221399_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|221438_222092_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|222084_223116_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140175.1|223303_223879_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997038.1|229546_230350_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_153986216.1|230346_231261_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|231501_232302_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211687.1|232379_233150_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|233197_234556_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052707.1|234627_235383_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001298887.1|235416_236139_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|236135_236603_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|236667_237399_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|237938_238724_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|238860_239340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908052.1|239349_240264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|240307_240790_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087745.1|240813_242166_-	membrane protein	NA	NA	NA	NA	NA
WP_122986077.1|242176_245611_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240545.1|245719_247132_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|247136_247880_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614350.1|247876_250684_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	27.9	1.2e-80
WP_000343298.1|250692_251454_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246449.1|251458_252790_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|252792_253317_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|253313_254594_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|254618_255701_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|255664_257515_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|257518_257932_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056978.1|257938_259414_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|259464_259689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037395.1|259723_260224_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|260921_261440_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103316.1|261649_263791_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001350059.1|263866_267916_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.4e-20
WP_001350058.1|267875_268313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420794.1|269183_270320_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP043486	Escherichia coli strain SL112 chromosome, complete genome	4789695	292273	331953	4789695	head,tail,plate,transposase	Escherichia_phage(60.38%)	54	NA	NA
WP_000859525.1|292273_292669_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
WP_000514023.1|292823_293519_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	99.1	9.5e-133
WP_001300256.1|293469_293658_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	100.0	1.3e-31
WP_000905064.1|293752_294334_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	99.5	1.6e-104
WP_001112250.1|294363_295359_+	hypothetical protein	NA	A0A077SK37	Escherichia_phage	94.7	6.4e-183
WP_000972171.1|295361_295895_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	98.9	1.2e-95
WP_000972119.1|295923_296451_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	98.3	1.2e-92
WP_000499360.1|296453_297968_-|tail	tail protein	tail	C9DGQ8	Escherichia_phage	90.2	1.7e-259
WP_000301695.1|297967_298510_-	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	99.4	4.8e-100
WP_000331815.1|298500_299583_-|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	98.9	1.1e-204
WP_000130548.1|299583_300021_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	100.0	1.0e-79
WP_000442748.1|300017_300611_-|plate	phage baseplate assembly protein	plate	A0A0C4UQZ3	Shigella_phage	99.0	1.2e-107
WP_000072824.1|300598_301738_-|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	98.9	3.4e-212
WP_000461070.1|301730_303218_-	DMT family permease	NA	A0A0C4UR32	Shigella_phage	98.2	6.6e-240
WP_000147074.1|303222_305295_-	tape measure protein	NA	C9DGQ1	Escherichia_phage	96.4	3.8e-312
WP_000344073.1|305439_305874_-	hypothetical protein	NA	C9DGP9	Escherichia_phage	97.9	3.8e-71
WP_000918402.1|305883_306240_-|tail	tail protein	tail	C9DGP8	Escherichia_phage	94.9	4.2e-60
WP_001280310.1|306249_307737_-|tail	tail protein	tail	C9DGP7	Escherichia_phage	99.6	1.3e-280
WP_001438403.1|307733_307937_-	DUF2635 domain-containing protein	NA	A0A0C4UR31	Shigella_phage	98.5	1.1e-28
WP_000888926.1|307923_308472_-	DUF1834 family protein	NA	C9DGP5	Escherichia_phage	99.5	1.9e-104
WP_001104973.1|308471_308897_-	DUF1320 family protein	NA	C9DGP4	Escherichia_phage	97.2	8.8e-73
WP_000017158.1|308893_309304_-	hypothetical protein	NA	C9DGP3	Escherichia_phage	98.5	6.1e-63
WP_000637410.1|309370_310288_-|head	head protein	head	C9DGP2	Escherichia_phage	99.3	5.2e-179
WP_000716025.1|310284_311370_-	hypothetical protein	NA	C9DGP0	Escherichia_phage	98.3	5.2e-194
WP_001350023.1|311566_312037_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	99.4	3.8e-85
WP_001136431.1|312033_313353_-|head	phage head morphogenesis protein	head	C9DGN7	Escherichia_phage	98.2	1.5e-248
WP_000532638.1|313333_314872_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	99.0	1.5e-295
WP_001097325.1|314871_316527_-	hypothetical protein	NA	C9DGN5	Escherichia_phage	97.8	0.0e+00
WP_000375394.1|316534_317110_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	100.0	9.1e-97
WP_000606409.1|317121_317412_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	100.0	7.4e-47
WP_000364295.1|317408_317708_-	DUF2730 family protein	NA	C9DGN2	Escherichia_phage	100.0	5.8e-47
WP_001001316.1|317707_317902_-	hypothetical protein	NA	C9DGN1	Escherichia_phage	100.0	6.2e-34
WP_001350022.1|318060_318447_-	hypothetical protein	NA	C9DGN0	Escherichia_phage	97.7	2.2e-62
WP_000907405.1|318430_318946_-	lysozyme	NA	C9DGM9	Escherichia_phage	99.4	1.9e-93
WP_001163387.1|319040_319463_-	positive regulator of late transcription	NA	C9DGM8	Escherichia_phage	99.3	2.2e-76
WP_000004161.1|319604_319967_-	hypothetical protein	NA	C9DGM6	Escherichia_phage	99.2	4.1e-63
WP_000515807.1|319959_320178_-	hypothetical protein	NA	C9DGM5	Escherichia_phage	100.0	5.6e-39
WP_000133853.1|320255_320645_-	hypothetical protein	NA	A0A0C4UR27	Shigella_phage	98.4	2.3e-67
WP_000091782.1|320641_321193_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	96.7	1.2e-98
WP_000431116.1|321263_321530_+	hypothetical protein	NA	Q38493	Escherichia_phage	98.9	2.3e-39
WP_001058561.1|321468_321771_-	hypothetical protein	NA	A0A0C4UQY6	Shigella_phage	99.0	1.4e-48
WP_000429765.1|321772_321955_-	hypothetical protein	NA	A0A0C4UR26	Shigella_phage	83.3	1.4e-24
WP_000465551.1|321941_322472_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	97.2	6.4e-97
WP_000227260.1|322471_323002_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	95.5	4.2e-96
WP_001107930.1|323100_323625_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	100.0	1.5e-90
WP_000255655.1|323644_323944_-	hypothetical protein	NA	C9DGL7	Escherichia_phage	99.0	2.8e-49
WP_001101152.1|323944_324364_-	hypothetical protein	NA	C9DGL6	Escherichia_phage	95.7	8.7e-73
WP_001151288.1|324378_324642_-	hypothetical protein	NA	A0A0C4UQU1	Shigella_phage	96.6	2.5e-38
WP_000968312.1|324886_325114_-	hypothetical protein	NA	C9DGL3	Escherichia_phage	100.0	3.2e-37
WP_001026710.1|325129_326068_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	98.1	1.3e-169
WP_000424754.1|326106_328098_-|transposase	transposase	transposase	C9DGL1	Escherichia_phage	93.5	0.0e+00
WP_000337186.1|328099_328327_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	66.7	4.8e-17
WP_001474801.1|328562_329087_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001143092.1|329508_331953_-	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	42.6	1.6e-33
>prophage 3
NZ_CP043486	Escherichia coli strain SL112 chromosome, complete genome	4789695	1443112	1496734	4789695	integrase,plate,tail,holin,terminase	Escherichia_phage(76.79%)	61	1443937:1443952	1499009:1499024
WP_001307164.1|1443112_1444345_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
1443937:1443952	attL	TCAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_000040852.1|1445629_1446865_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1446866_1447082_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1447160_1447370_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1447362_1447557_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1447613_1448423_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105152.1|1448415_1451016_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	1.8e-248
WP_001349884.1|1451117_1451393_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	6.3e-40
WP_000245530.1|1451467_1451644_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.4	6.3e-25
WP_000560220.1|1451637_1451859_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	100.0	6.2e-38
WP_001169153.1|1452279_1452432_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000233319.1|1452862_1453282_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|1453361_1453616_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693802.1|1453612_1454035_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_000899746.1|1454047_1454905_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788973.1|1454911_1455658_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_000450660.1|1455680_1456442_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.7e-114
WP_001151237.1|1456457_1456880_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	7.4e-64
WP_000228824.1|1457063_1458191_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000569066.1|1458183_1459293_+	DUF3696 domain-containing protein	NA	NA	NA	NA	NA
WP_000064766.1|1459289_1460267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813259.1|1460897_1461053_+	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	96.1	5.5e-17
WP_000940320.1|1461521_1462121_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_000228041.1|1462120_1462411_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	4.3e-47
WP_000640164.1|1462407_1462944_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	6.3e-68
WP_001349882.1|1464214_1464607_+|holin	holin	holin	Q8W636	Enterobacteria_phage	96.2	8.4e-54
WP_000950573.1|1464596_1464872_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	5.5e-44
WP_000014545.1|1464874_1465252_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	97.6	3.0e-64
WP_001291099.1|1465853_1466642_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	41.1	2.5e-49
WP_001204039.1|1466634_1467567_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	7.1e-83
WP_000126790.1|1467544_1467754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089432.1|1467757_1468849_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	92.1	1.0e-144
WP_000021163.1|1468838_1470167_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	98.9	8.4e-263
WP_021036437.1|1470185_1471622_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	95.6	2.6e-265
WP_024190735.1|1471680_1472400_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	97.9	6.2e-135
WP_000059667.1|1472380_1473703_+	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	95.2	6.8e-188
WP_001349881.1|1473695_1474313_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	100.0	5.9e-118
WP_001272365.1|1474327_1475356_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.4	3.3e-190
WP_000780861.1|1475413_1475884_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	100.0	2.5e-84
WP_000175376.1|1475883_1476324_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_000762302.1|1476320_1476761_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	98.6	2.2e-82
WP_001139506.1|1476747_1477692_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.4	2.2e-172
WP_000506600.1|1477691_1479029_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	96.2	1.0e-244
WP_000613371.1|1479052_1479484_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	99.3	2.8e-74
WP_000703979.1|1479480_1480098_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	98.0	4.2e-108
WP_000016439.1|1480161_1482150_+	transglycosylase SLT domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	94.4	0.0e+00
WP_000056323.1|1482153_1482822_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	98.6	4.3e-122
WP_000209259.1|1482818_1483085_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	94.3	2.7e-43
WP_001271172.1|1483084_1484092_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	96.1	1.2e-189
WP_000063616.1|1484091_1484805_+|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	96.6	1.8e-126
WP_001261334.1|1485501_1485849_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	94.8	4.1e-60
WP_014640615.1|1485824_1486199_-	hypothetical protein	NA	A0A0U2QL80	Escherichia_phage	95.8	6.8e-61
WP_000733802.1|1486239_1486779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001349878.1|1486800_1488027_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	98.8	5.8e-226
WP_001199732.1|1488010_1488637_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	99.0	2.2e-120
WP_000600270.1|1488633_1490187_+	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	79.2	4.6e-228
WP_000902859.1|1490189_1490735_+|tail	tail assembly protein	tail	Q8W612	Enterobacteria_phage	76.4	3.8e-76
WP_000117760.1|1490758_1493899_+	shikimate transporter	NA	A0A0U2SH60	Escherichia_phage	71.2	0.0e+00
WP_000701877.1|1493913_1494486_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.3	1.8e-76
WP_001082294.1|1495025_1495460_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837909.1|1495600_1496734_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
1499009:1499024	attR	GCGCGCTTTTTTCTGA	NA	NA	NA	NA
>prophage 4
NZ_CP043486	Escherichia coli strain SL112 chromosome, complete genome	4789695	1640116	1737608	4789695	transposase,head,capsid,portal,lysis,tail,terminase	Enterobacteria_phage(40.0%)	109	NA	NA
WP_153986231.1|1640116_1641298_-|transposase	IS4 family transposase	transposase	Q9E8P4	Bluetongue_virus	96.8	4.0e-224
WP_000060493.1|1642644_1643406_-	acid stress response transcriptional regulator YdeO	NA	NA	NA	NA	NA
WP_000543389.1|1643480_1643678_-	two-component system connector SafA	NA	NA	NA	NA	NA
WP_000726699.1|1643925_1646205_-	acid resistance putative oxidoreductase YdeP	NA	NA	NA	NA	NA
WP_000520679.1|1646538_1647453_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000825458.1|1647512_1648016_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000876770.1|1648028_1648559_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001349924.1|1648572_1651224_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001195166.1|1651265_1651976_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001296758.1|1652336_1652900_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001125454.1|1653851_1655174_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001296726.1|1655173_1655440_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001083595.1|1655648_1657049_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
WP_001339197.1|1661180_1662389_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001022785.1|1662570_1664244_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001296721.1|1664299_1664611_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001349922.1|1664638_1665961_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722571.1|1666075_1666387_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577184.1|1666585_1667284_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087220.1|1667328_1668228_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054196.1|1668422_1669610_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|1669736_1669832_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592814.1|1670050_1670941_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
WP_000671744.1|1671195_1671588_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024810.1|1671863_1672382_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001299399.1|1672426_1674472_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|1674608_1675355_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|1675443_1676130_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|1676307_1676511_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527779.1|1676546_1678007_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.1e-42
WP_000347482.1|1678095_1679379_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1679983_1680097_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1680165_1680399_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_016230953.1|1680715_1680895_+	recombinase family protein	NA	NA	NA	NA	NA
WP_001339197.1|1680863_1682072_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_077631333.1|1682170_1682644_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.6	9.6e-20
WP_000885611.1|1682741_1683317_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000279140.1|1683316_1686391_-	membrane protein	NA	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_001233072.1|1686455_1687055_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	9.7e-110
WP_000033679.1|1687125_1690539_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
WP_000090891.1|1690599_1691232_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_001349921.1|1691168_1691912_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	6.8e-145
WP_001152622.1|1691917_1692616_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.6e-132
WP_000847360.1|1692615_1692945_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	9.6e-59
WP_000840335.1|1692941_1695503_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.3	0.0e+00
WP_000459457.1|1695495_1695930_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479150.1|1695911_1696334_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	98.6	1.3e-71
WP_001349920.1|1696349_1697090_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|1697097_1697493_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000985119.1|1697489_1698068_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000753007.1|1698079_1698433_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000158921.1|1698444_1698843_-	hypothetical protein	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	4.5e-63
WP_000063280.1|1698884_1699910_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_153986232.1|1699965_1700298_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.4e-54
WP_000123305.1|1700307_1701627_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	2.5e-235
WP_001349919.1|1701607_1703209_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	5.9e-311
WP_000198149.1|1703205_1703412_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027259.1|1703408_1705334_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453611.1|1705308_1705854_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001368374.1|1706242_1706476_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1706533_1706944_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1707095_1707269_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1707440_1707596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1707675_1707741_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1707743_1707932_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1707942_1708155_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1708517_1709015_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1709011_1709545_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1709541_1709853_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1709857_1710073_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1710826_1711042_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1711342_1711555_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1711609_1711699_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1711976_1712729_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265199.1|1712742_1713792_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_012304870.1|1713793_1714072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1714138_1714390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1714606_1714762_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1714833_1715121_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1715120_1715360_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1715384_1715690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1715892_1716225_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|1716661_1717975_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|1718152_1718335_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_072096395.1|1718309_1718528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310834.1|1719641_1719998_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001151262.1|1719994_1720417_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054512.1|1720457_1721423_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705358.1|1721403_1721925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1721908_1722139_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1722222_1722630_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1722796_1722952_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1723111_1723330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329848.1|1723333_1723498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1723897_1724086_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1724082_1724274_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048348.1|1724366_1726844_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001296941.1|1726931_1727168_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_153986233.1|1727202_1728483_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
WP_001339197.1|1728652_1729861_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_023352561.1|1729870_1729951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836076.1|1730008_1731028_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	1.3e-16
WP_001295394.1|1731039_1732254_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1732459_1732786_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|1732920_1733262_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1733296_1733857_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1733859_1734570_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1734677_1734983_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041685.1|1735181_1737608_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.7e-214
>prophage 5
NZ_CP043486	Escherichia coli strain SL112 chromosome, complete genome	4789695	2235083	2298360	4789695	integrase,head,plate,capsid,tRNA,portal,lysis,tail,holin,terminase	Escherichia_phage(43.48%)	73	2240141:2240168	2271091:2271118
WP_000675150.1|2235083_2236487_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137869.1|2236483_2237206_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000929408.1|2237396_2237729_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2237937_2238234_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2238235_2238532_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|2238634_2239996_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
2240141:2240168	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2240268_2240487_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882938.1|2240567_2241731_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000978889.1|2241730_2242210_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069967.1|2242224_2244672_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	98.8	0.0e+00
WP_000785970.1|2244664_2244784_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2244816_2245092_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2245148_2245667_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286686.1|2245679_2246870_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
WP_000905100.1|2246929_2247523_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
WP_000049773.1|2247968_2248409_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	61.9	2.7e-48
WP_000805553.1|2248380_2248974_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	63.0	1.3e-58
WP_000216987.1|2248973_2250257_-|tail	tail protein	tail	M1TAS6	Escherichia_phage	64.6	6.6e-156
WP_001285343.1|2250253_2250865_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_001121496.1|2250857_2251766_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	2.8e-161
WP_000127163.1|2251770_2252118_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093712.1|2252114_2252750_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	6.5e-112
WP_001001780.1|2252816_2253269_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_000917179.1|2253261_2253729_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	100.0	3.0e-82
WP_000040682.1|2253836_2254262_-|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	100.0	7.7e-69
WP_000736570.1|2254249_2254675_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	2.9e-60
WP_001144178.1|2254689_2255187_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	3.4e-92
WP_000123123.1|2255186_2255468_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|2255471_2255675_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_001350080.1|2255674_2256184_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	2.1e-89
WP_000203430.1|2256283_2257027_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	96.0	2.3e-121
WP_001248584.1|2257030_2258104_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.7	7.4e-201
WP_001085948.1|2258162_2259017_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000156872.1|2259190_2260963_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038162.1|2260962_2261991_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	6.2e-197
WP_001350078.1|2262049_2262622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000744812.1|2262614_2264048_-	AAA family ATPase	NA	A0A2I7RNF1	Vibrio_phage	30.1	3.9e-40
WP_000268602.1|2265212_2267489_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
WP_000027664.1|2267478_2267754_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113270.1|2267750_2267975_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277968.1|2267977_2268277_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	4.2e-45
WP_071842580.1|2268276_2268459_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.3	7.2e-24
WP_000217680.1|2268507_2269008_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	99.4	1.7e-91
WP_001081582.1|2269185_2269461_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2269582_2269882_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|2269997_2271011_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001352710.1|2271275_2271593_-	hypothetical protein	NA	NA	NA	NA	NA
2271091:2271118	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2271998_2272898_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|2272979_2273759_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|2273858_2274899_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490714.1|2274946_2276302_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|2276305_2276590_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|2276620_2277073_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853892.1|2277082_2278345_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000289788.1|2278373_2279228_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129568.1|2279537_2280590_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858498.1|2280846_2282124_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846224.1|2282120_2283125_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011957.1|2283121_2284087_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2284060_2284807_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297420.1|2284858_2285677_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000822274.1|2285741_2286542_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195605.1|2286538_2287327_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2287549_2287822_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134569.1|2287942_2288767_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|2288985_2289324_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000405707.1|2289405_2290440_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945468.1|2290455_2292936_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677395.1|2292951_2293626_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|2293706_2294249_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|2294541_2294823_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|2295085_2296195_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|2296326_2298360_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 6
NZ_CP043486	Escherichia coli strain SL112 chromosome, complete genome	4789695	2310871	2320312	4789695		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001349937.1|2310871_2312008_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001349936.1|2312004_2314005_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001295429.1|2314129_2314591_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2314630_2315101_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2315147_2315867_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2315863_2317549_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2317770_2318502_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2318561_2318669_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2318649_2319381_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569367.1|2319385_2320312_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	9.7e-24
>prophage 7
NZ_CP043486	Escherichia coli strain SL112 chromosome, complete genome	4789695	2818152	2825620	4789695	integrase,transposase	Escherichia_phage(66.67%)	6	2815940:2815953	2823053:2823066
2815940:2815953	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_000162574.1|2818152_2818635_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001341819.1|2819377_2820607_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|2820645_2821062_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|2821133_2822882_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000577254.1|2822883_2824602_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
2823053:2823066	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
WP_000878218.1|2824753_2825620_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 8
NZ_CP043486	Escherichia coli strain SL112 chromosome, complete genome	4789695	2900587	2907727	4789695		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|2900587_2903149_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|2903254_2903911_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272549.1|2903961_2904759_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|2904924_2905833_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2905829_2907092_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2907088_2907727_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 9
NZ_CP043486	Escherichia coli strain SL112 chromosome, complete genome	4789695	4175181	4266786	4789695	protease,integrase,head,transposase,plate,capsid,tRNA,portal,lysis,tail,holin,terminase	Escherichia_virus(41.3%)	94	4205843:4205889	4238522:4238568
WP_000560983.1|4175181_4175619_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|4175663_4176605_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001162704.1|4176668_4177577_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|4177805_4178117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|4178117_4178408_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295676.1|4179012_4179231_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086388.1|4179449_4179692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027702.1|4180021_4180951_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|4180947_4181583_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|4181579_4182482_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_011310337.1|4182494_4185545_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753583.1|4185738_4186572_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001317404.1|4186724_4187765_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931314.1|4187814_4189563_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001019466.1|4189562_4190633_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446010.1|4190622_4192074_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729595.1|4192084_4192531_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619503.1|4192831_4193146_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179764.1|4193155_4193980_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211486.1|4194221_4195481_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144046.1|4195477_4196947_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217162.1|4197234_4198071_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001350036.1|4198054_4198993_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063504.1|4198989_4200024_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|4200308_4200929_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166050.1|4201188_4202172_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|4202320_4202995_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4203100_4204474_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4204470_4205169_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4205318_4205819_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4205843:4205889	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023383.1|4206004_4206985_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4C5	Escherichia_virus	100.0	1.0e-185
WP_001192857.1|4207054_4207348_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|4207500_4207773_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_000217679.1|4207942_4208443_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_000557702.1|4208506_4208731_+	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	100.0	6.1e-33
WP_001277905.1|4208730_4209033_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	100.0	3.5e-47
WP_001113263.1|4209032_4209257_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
WP_000027664.1|4209253_4209529_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268589.1|4209518_4211804_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	99.9	0.0e+00
WP_014640573.1|4211803_4212256_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	6.1e-80
WP_001143634.1|4212704_4213643_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
WP_153986268.1|4213639_4214677_-	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	99.7	1.1e-198
WP_000368931.1|4214669_4215743_-	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
WP_000038147.1|4216158_4217193_-|portal	phage portal protein	portal	Q7Y4E8	Escherichia_virus	100.0	2.4e-201
WP_000156872.1|4217192_4218965_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085948.1|4219138_4219993_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000203430.1|4221129_4221873_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	96.0	2.3e-121
WP_001350080.1|4221972_4222482_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	2.1e-89
WP_000846399.1|4222481_4222685_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|4222688_4222970_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144178.1|4222969_4223467_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	3.4e-92
WP_000736570.1|4223481_4223907_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	2.9e-60
WP_000040682.1|4223894_4224320_+|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	100.0	7.7e-69
WP_000917179.1|4224427_4224895_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	100.0	3.0e-82
WP_001001780.1|4224887_4225340_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_001093706.1|4225406_4226042_+|plate	phage baseplate assembly protein V	plate	Q7Y4D8	Escherichia_virus	100.0	2.4e-106
WP_000127163.1|4226038_4226386_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121482.1|4226390_4227299_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.0e-162
WP_001285313.1|4227291_4227822_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	1.3e-102
WP_000104720.1|4227832_4229842_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	99.6	0.0e+00
WP_001164149.1|4229845_4230373_+|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	98.3	5.6e-93
WP_000014362.1|4230588_4231488_+	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	100.0	6.2e-169
WP_001286683.1|4231807_4232998_+|tail	phage tail sheath protein	tail	Q7Y4D1	Escherichia_virus	99.7	8.1e-225
WP_001251408.1|4233010_4233529_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|4233585_4233861_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4233893_4234013_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001283070.1|4234005_4236453_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	100.0	0.0e+00
WP_000978900.1|4236467_4236947_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	100.0	5.1e-85
WP_000882968.1|4236946_4238110_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	98.4	1.3e-206
WP_000468308.1|4238191_4238410_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|4238646_4239549_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4238522:4238568	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|4239729_4240692_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|4241011_4242001_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000708994.1|4242107_4242863_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4242917_4243685_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|4243792_4244392_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155254.1|4244492_4244933_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|4245144_4245444_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|4245470_4245899_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796320.1|4245903_4246650_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4246746_4247757_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|4247892_4249401_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4249423_4250269_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4250693_4250939_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4251023_4251509_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|4251601_4252528_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|4252594_4253926_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4253935_4254466_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000068834.1|4254558_4255518_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000644904.1|4255609_4256635_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_001350069.1|4256790_4258989_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000710769.1|4259191_4259404_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000797341.1|4264962_4265571_-	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000399648.1|4265805_4266786_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
