The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041192	Bacillus velezensis strain BvL03 chromosome, complete genome	3984544	629580	639471	3984544		Synechococcus_phage(50.0%)	9	NA	NA
WP_146276266.1|629580_630873_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_014417101.1|630948_631668_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.3	1.7e-47
WP_003155758.1|631667_631922_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_007609853.1|631918_632602_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_146276268.1|632585_634814_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.9	7.2e-158
WP_060674456.1|634789_636220_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
WP_003155753.1|636311_637352_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	2.4e-63
WP_003155752.1|637348_637936_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.3	1.0e-26
WP_146276270.1|637932_639471_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	8.7e-78
>prophage 2
NZ_CP041192	Bacillus velezensis strain BvL03 chromosome, complete genome	3984544	1185215	1217516	3984544	plate,holin,tail,terminase,portal	Bacillus_phage(32.26%)	44	NA	NA
WP_087920760.1|1185215_1186352_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_003154881.1|1186341_1186476_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003154880.1|1186617_1187571_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_007610770.1|1187609_1187987_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
WP_146276565.1|1188095_1188701_+	hypothetical protein	NA	A0A0Y0AJU6	Bacillus_phage	46.8	1.1e-41
WP_162885922.1|1188690_1188840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154873.1|1188855_1189446_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154871.1|1189594_1189933_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_033574556.1|1190124_1190304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039251804.1|1190293_1191121_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.5	2.9e-19
WP_063174228.1|1191020_1191821_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.1	6.1e-59
WP_165698137.1|1191820_1191988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039251797.1|1192085_1192427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154859.1|1192416_1192620_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_146276567.1|1192733_1193246_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.9	2.9e-22
WP_146276569.1|1193358_1194156_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	49.8	1.2e-59
WP_146276571.1|1194152_1195451_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.4	3.2e-150
WP_088005490.1|1195499_1196891_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.6	3.0e-138
WP_015417286.1|1196910_1197756_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	57.6	4.3e-55
WP_007407274.1|1197782_1198718_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_146276573.1|1198734_1199118_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_007610806.1|1199114_1199471_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_146276575.1|1199467_1199971_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	40.4	4.6e-36
WP_069473357.1|1199967_1200414_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_003154839.1|1200410_1200620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146276577.1|1200619_1202017_+|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	40.4	1.2e-81
WP_003154837.1|1202018_1202462_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|1202538_1202985_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|1203026_1203179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146276579.1|1203166_1208695_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	44.4	9.5e-42
WP_077722098.1|1208687_1209347_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	44.2	3.1e-08
WP_146276581.1|1209360_1210338_+|portal	phage portal protein	portal	A0A1L6BY20	Clostridium_phage	30.9	3.7e-34
WP_146276583.1|1210337_1210604_+	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	3.4e-06
WP_020955689.1|1210707_1211133_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	2.5e-11
WP_070081679.1|1211125_1212172_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.1	1.0e-69
WP_007407262.1|1212155_1212734_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.0	3.1e-12
WP_003154822.1|1212730_1213003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146276585.1|1213005_1214628_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	39.3	3.1e-41
WP_070081681.1|1214640_1215012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154819.1|1215016_1215214_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	4.3e-14
WP_146276587.1|1215270_1216032_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_146276589.1|1216083_1216347_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	1.1e-22
WP_003154813.1|1216360_1216624_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_024085195.1|1216637_1217516_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	4.8e-81
>prophage 3
NZ_CP041192	Bacillus velezensis strain BvL03 chromosome, complete genome	3984544	1771575	1777789	3984544		Bacillus_phage(50.0%)	7	NA	NA
WP_003154061.1|1771575_1771968_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
WP_003154060.1|1771927_1774030_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.0	0.0e+00
WP_024085331.1|1774047_1775037_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.3	2.5e-155
WP_044053225.1|1775085_1775706_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	1.2e-46
WP_146276822.1|1775755_1776514_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	1.1e-52
WP_003154054.1|1776547_1776772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015417523.1|1776820_1777789_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 4
NZ_CP041192	Bacillus velezensis strain BvL03 chromosome, complete genome	3984544	2074863	2089806	3984544		Bacillus_phage(100.0%)	18	NA	NA
WP_003153662.1|2074863_2075040_-	hypothetical protein	NA	O64196	Bacillus_phage	93.1	6.5e-22
WP_146277040.1|2075391_2075745_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_063636671.1|2076196_2076433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048367415.1|2076556_2076931_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	51.2	9.9e-28
WP_003153657.1|2077164_2077617_-	hypothetical protein	NA	O64117	Bacillus_phage	77.3	2.8e-61
WP_003153656.1|2077960_2079097_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	76.7	8.2e-166
WP_003153655.1|2079086_2079269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003153654.1|2080677_2081037_-	hypothetical protein	NA	O64028	Bacillus_phage	60.5	1.3e-32
WP_146277042.1|2081042_2081510_-	DUF4879 domain-containing protein	NA	O64027	Bacillus_phage	55.8	2.3e-42
WP_165698151.1|2081652_2081742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146277044.1|2082017_2082353_-	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	57.3	2.7e-24
WP_146277046.1|2082567_2083029_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_146277048.1|2083122_2083719_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	80.3	6.3e-85
WP_146277050.1|2083720_2085472_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	66.8	7.5e-227
WP_146277484.1|2085507_2085942_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_003153650.1|2086188_2087169_+	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	75.1	5.5e-78
WP_070081995.1|2087297_2087618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069448828.1|2088138_2089806_+	recombinase family protein	NA	O64015	Bacillus_phage	90.4	1.9e-275
>prophage 5
NZ_CP041192	Bacillus velezensis strain BvL03 chromosome, complete genome	3984544	2224186	2230438	3984544		Staphylococcus_phage(66.67%)	9	NA	NA
WP_003153378.1|2224186_2224780_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
WP_003153377.1|2224769_2225525_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	6.5e-10
WP_003153376.1|2225732_2225822_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_077722539.1|2225909_2226431_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153373.1|2226496_2226871_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|2226986_2227451_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_003153371.1|2227483_2228680_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
WP_007409425.1|2228694_2229342_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
WP_071391670.1|2229322_2230438_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	2.6e-55
>prophage 6
NZ_CP041192	Bacillus velezensis strain BvL03 chromosome, complete genome	3984544	2908276	2989353	3984544	plate,holin,protease,integrase,capsid,tail,terminase,portal	Bacillus_phage(44.44%)	104	2920377:2920423	2989492:2989538
WP_003152181.1|2908276_2909485_-|holin	choline dehydrogenase	holin	NA	NA	NA	NA
WP_003152180.1|2909501_2910974_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_146277402.1|2911174_2911729_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070082729.1|2911889_2912429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058906302.1|2912592_2913261_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_077722742.1|2913294_2914140_-	GW domain-containing glycosaminoglycan-binding protein	NA	A0A0K2CP65	Brevibacillus_phage	45.2	1.1e-26
WP_102422047.1|2914281_2915457_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_071392221.1|2915674_2916316_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_146277404.1|2916383_2916704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070082263.1|2917919_2919050_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	40.6	1.8e-64
WP_015387806.1|2919370_2919574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146277406.1|2919940_2920204_+	hypothetical protein	NA	NA	NA	NA	NA
2920377:2920423	attL	GGTATGGAGCCAAGGGGGCTCGAACCCCTGACCTCTACGCTGCCAGC	NA	NA	NA	NA
WP_153986682.1|2920564_2921356_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	29.8	2.9e-16
WP_025851527.1|2921530_2921737_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025851529.1|2921756_2922008_+	hypothetical protein	NA	A0A2H4J8H2	uncultured_Caudovirales_phage	50.8	1.3e-10
WP_153986683.1|2922083_2922419_+	YolD-like family protein	NA	O64030	Bacillus_phage	34.7	3.4e-11
WP_153986684.1|2922434_2922995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351583.1|2923088_2923346_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	5.0e-23
WP_153986685.1|2923366_2924278_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	91.7	4.5e-159
WP_013351581.1|2924354_2924564_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
WP_153986686.1|2924567_2924768_-	XkdX family protein	NA	NA	NA	NA	NA
WP_082998420.1|2924769_2925054_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	44.7	9.5e-15
WP_162008372.1|2925068_2926649_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	51.9	1.0e-57
WP_099320064.1|2926664_2929229_-	peptidase G2	NA	D6R401	Bacillus_phage	74.2	0.0e+00
WP_045208611.1|2929243_2930644_-	endopeptidase	NA	A6M966	Geobacillus_virus	31.2	8.6e-40
WP_033575353.1|2930655_2932080_-	glycoside hydrolase family 73	NA	A0A2H4JBY6	uncultured_Caudovirales_phage	44.7	3.6e-62
WP_153986687.1|2932086_2934885_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	37.9	3.4e-96
WP_045208617.1|2935217_2935589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470939.1|2935646_2936201_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	4.0e-49
WP_033575287.1|2936225_2936615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033575286.1|2936621_2937029_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	53.7	1.4e-30
WP_033575285.1|2937025_2937361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153986688.1|2937361_2937748_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.8	3.5e-20
WP_099320068.1|2937762_2937981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247785.1|2937983_2938238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045208630.1|2938289_2939393_-	DUF5309 family protein	NA	A0A2I7S650	Vibrio_phage	27.6	1.7e-30
WP_045208632.1|2939404_2940076_-|protease	Clp protease ClpB	protease	A0A2H4IZP8	uncultured_Caudovirales_phage	46.0	7.8e-15
WP_153986689.1|2940165_2940990_-|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	52.4	1.0e-72
WP_153986690.1|2940989_2942621_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	56.7	4.3e-168
WP_153986691.1|2942623_2943055_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	52.1	3.8e-31
WP_153986692.1|2943071_2944826_-|terminase	phage terminase large subunit	terminase	A0A2H4J484	uncultured_Caudovirales_phage	71.6	4.4e-251
WP_153986693.1|2944908_2945457_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.1	2.4e-38
WP_153986748.1|2945654_2945873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153986694.1|2947017_2947287_-	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	50.6	6.7e-18
WP_153986695.1|2948712_2949735_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	44.1	1.9e-12
WP_153986696.1|2949834_2950059_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153986697.1|2950190_2950988_+	hypothetical protein	NA	O64134	Bacillus_phage	48.8	5.4e-55
WP_153986698.1|2950987_2952754_+	right-handed parallel beta-helix repeat-containing protein	NA	F8WPS8	Bacillus_phage	47.0	2.8e-144
WP_165698141.1|2952813_2952960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153986699.1|2953165_2953366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153986700.1|2953471_2953909_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.9	1.8e-52
WP_013351549.1|2954039_2954219_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	81.4	1.3e-22
WP_153986701.1|2954365_2955166_-	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	53.8	5.9e-70
WP_165698142.1|2955253_2955796_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	43.2	4.6e-18
WP_153986703.1|2955788_2956178_-	RNA polymerase subunit sigma	NA	A0A0N9RZI0	Paenibacillus_phage	44.2	2.5e-18
WP_153986704.1|2956257_2956638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162008368.1|2956610_2957513_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8CX13	Bacillus_phage	75.3	4.0e-131
WP_153986706.1|2957746_2958319_-	dephospho-CoA kinase	NA	J9Q953	Bacillus_phage	44.6	5.6e-38
WP_153986707.1|2958315_2959158_-	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	46.9	7.2e-26
WP_153986708.1|2959158_2959329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153986709.1|2959344_2959968_-	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	57.8	4.5e-25
WP_153986749.1|2959937_2960744_-	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	65.6	2.3e-85
WP_153986710.1|2960980_2961529_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	55.5	2.9e-44
WP_153986711.1|2961525_2961672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153986750.1|2961768_2962734_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	78.4	3.4e-144
WP_153986712.1|2962893_2963061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153986713.1|2963080_2965186_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	79.0	0.0e+00
WP_094247768.1|2965182_2965707_-	hypothetical protein	NA	A0A2K9VD13	Lactobacillus_phage	47.9	1.0e-22
WP_153986714.1|2965652_2966051_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	55.3	2.4e-27
WP_153986715.1|2966056_2966242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153986716.1|2966238_2966478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153986717.1|2966483_2966846_-	DUF1523 domain-containing protein	NA	A0A140HLL8	Bacillus_phage	36.8	8.7e-13
WP_153986718.1|2966845_2967379_-	hypothetical protein	NA	A0A2H4IZL3	uncultured_Caudovirales_phage	43.5	5.6e-32
WP_153986719.1|2967529_2968609_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	44.8	5.9e-57
WP_153986720.1|2968605_2968902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153986721.1|2968894_2969611_-	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	43.8	4.0e-33
WP_153986722.1|2969612_2970524_-	hypothetical protein	NA	A0A0K2CNU9	Brevibacillus_phage	55.5	6.3e-84
WP_153986751.1|2970523_2973310_-	hypothetical protein	NA	A0A0N9S7Z3	Paenibacillus_phage	36.8	3.6e-90
WP_153986723.1|2973365_2973515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153986724.1|2973680_2974940_-	hypothetical protein	NA	A0A142F1R1	Bacillus_phage	29.8	7.2e-22
WP_094247564.1|2974953_2975223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247563.1|2975222_2975657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153986725.1|2975691_2976447_-	single-stranded DNA-binding protein	NA	A0A0N9SJW5	Paenibacillus_phage	50.0	1.0e-55
WP_153986726.1|2976684_2977203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030631.1|2977497_2978106_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094247561.1|2978415_2979642_-	hypothetical protein	NA	A0A288WGA2	Bacillus_phage	38.0	1.4e-67
WP_076982979.1|2979790_2980036_+	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	41.2	2.8e-07
WP_153986727.1|2980052_2981048_-	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	45.9	1.3e-71
WP_153986728.1|2981182_2982577_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.5	9.8e-129
WP_153986729.1|2982573_2982828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153986730.1|2982824_2983352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153986731.1|2983348_2984131_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	54.6	3.0e-74
WP_094247744.1|2984299_2984656_-	hypothetical protein	NA	S6B1B0	Bacillus_phage	55.0	2.6e-25
WP_153986732.1|2984652_2985273_-	hypothetical protein	NA	A0A1P8CX46	Bacillus_phage	50.3	2.1e-30
WP_153986733.1|2985293_2985464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153986734.1|2985489_2985867_-	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	42.6	2.0e-20
WP_153986735.1|2985994_2986360_-	hypothetical protein	NA	R4JGJ3	Bacillus_phage	40.0	3.3e-12
WP_025851666.1|2986397_2986592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153986736.1|2986588_2986804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099320001.1|2986800_2986983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029974761.1|2987018_2987342_-	hypothetical protein	NA	A0A0S2MUA3	Bacillus_phage	37.8	1.7e-07
WP_153986737.1|2987331_2987496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025851674.1|2987728_2988148_-	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	58.7	2.7e-34
WP_153986738.1|2988294_2989353_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	26.7	2.9e-16
2989492:2989538	attR	GGTATGGAGCCAAGGGGGCTCGAACCCCTGACCTCTACGCTGCCAGC	NA	NA	NA	NA
>prophage 7
NZ_CP041192	Bacillus velezensis strain BvL03 chromosome, complete genome	3984544	3680053	3725025	3984544	lysis,coat,holin	Bacillus_phage(28.57%)	51	NA	NA
WP_003150986.1|3680053_3680509_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_146275763.1|3680505_3681354_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	7.0e-37
WP_070082545.1|3681374_3682322_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	7.7e-69
WP_017418672.1|3682324_3683062_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	1.1e-46
WP_146275765.1|3683089_3684094_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_165698146.1|3684095_3684836_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_146275768.1|3684828_3685950_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_102422054.1|3685949_3686813_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_146275770.1|3686813_3687983_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_146275772.1|3688005_3689430_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_024085938.1|3689434_3690205_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
WP_003150971.1|3690485_3691031_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_003150969.1|3691077_3691449_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_003150968.1|3691512_3692832_-	purine permease	NA	NA	NA	NA	NA
WP_146275774.1|3692850_3693273_-	DUF5327 family protein	NA	NA	NA	NA	NA
WP_012118732.1|3693331_3694015_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	44.7	3.2e-48
WP_146275776.1|3694029_3694836_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_071392445.1|3694920_3695448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146275778.1|3695492_3696128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003150960.1|3696120_3696459_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146275780.1|3696608_3697421_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003150958.1|3697451_3697691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146275782.1|3697790_3699233_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	23.8	3.3e-18
WP_153986743.1|3699229_3700612_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003150954.1|3700829_3701660_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_003150952.1|3701683_3701998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046560136.1|3702523_3704935_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	36.8	3.8e-19
WP_046560137.1|3704976_3705978_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021494748.1|3706141_3706891_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_007407709.1|3706994_3708182_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_146275786.1|3708383_3708881_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003150937.1|3709135_3709396_+	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_007614576.1|3709439_3709808_-	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003150930.1|3709809_3710424_-	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_012118743.1|3710438_3712388_-	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_014306059.1|3712415_3713381_-	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003150926.1|3713883_3714129_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_146275789.1|3714145_3715687_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_146275791.1|3715699_3715882_-	galactokinase	NA	NA	NA	NA	NA
WP_032857211.1|3715934_3716321_-	GtrA family protein	NA	NA	NA	NA	NA
WP_003150919.1|3716400_3717024_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029972917.1|3717359_3717521_+	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
WP_003150915.1|3717738_3718419_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024085947.1|3718418_3719093_+	streptomycin biosynthesis StrF domain-containing protein	NA	NA	NA	NA	NA
WP_094247393.1|3719111_3719714_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_146275793.1|3719800_3721057_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_003150910.1|3721469_3722144_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_063636530.1|3722140_3722959_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_003150908.1|3722961_3723870_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007407725.1|3723976_3724363_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_012118753.1|3724344_3725025_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
