The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	676170	753391	5167642	capsid,terminase,integrase,protease,head,tRNA,portal,tail	uncultured_Caudovirales_phage(71.43%)	74	699967:699985	716209:716227
WP_003031157.1|676170_677118_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.8	2.0e-08
WP_003031159.1|677132_677642_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_003031161.1|677771_678896_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003031162.1|678867_679341_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_008324985.1|679367_679910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003031166.1|679914_680487_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_003031168.1|680488_681310_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003031169.1|681306_681564_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_003031171.1|681539_682094_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_003025300.1|688087_688846_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.1e-20
WP_003025299.1|688853_689957_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003025297.1|689966_691148_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003025295.1|691217_692243_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	9.0e-71
WP_003025292.1|692702_692924_-	membrane protein	NA	NA	NA	NA	NA
WP_003025288.1|693194_696308_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_003025285.1|696319_697480_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003025283.1|697899_698556_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
WP_003025279.1|698601_698766_-	DUF2556 family protein	NA	NA	NA	NA	NA
WP_008320694.1|698848_699733_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	3.6e-28
699967:699985	attL	GTGCAGTCAGTGGTGCAGT	NA	NA	NA	NA
WP_153983641.1|700022_701246_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	93.4	2.7e-231
WP_153983642.1|701242_702043_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	38.3	8.1e-35
WP_153983643.1|702143_702350_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	82.4	1.5e-25
WP_162009219.1|703131_703344_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	50.9	1.2e-09
WP_078309651.1|703336_703522_+	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	85.2	8.3e-20
WP_001547834.1|703514_703742_+	hypothetical protein	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	100.0	1.6e-33
WP_153983645.1|703738_704107_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	99.2	6.1e-62
WP_153983646.1|704103_705468_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	97.1	3.4e-259
WP_045329600.1|705690_705945_+	hypothetical protein	NA	A0A2H4JEE4	uncultured_Caudovirales_phage	98.8	3.2e-38
WP_023332888.1|705957_706257_+	hypothetical protein	NA	A0A2H4JB54	uncultured_Caudovirales_phage	100.0	1.1e-48
WP_153983647.1|706488_707655_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	94.1	4.6e-204
WP_153983648.1|707706_708267_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	98.4	1.3e-100
WP_153983649.1|708268_709504_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	98.8	3.5e-239
WP_112018966.1|709500_709839_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	95.5	5.0e-55
WP_112018967.1|709835_710129_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	97.9	3.6e-49
WP_112018968.1|710128_710572_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	95.9	2.9e-82
WP_162009211.1|710564_710717_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	98.0	5.2e-20
WP_000113647.1|710847_711204_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_153983650.1|711187_712849_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.7	0.0e+00
WP_153983651.1|712862_716168_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	58.7	1.8e-285
WP_153983652.1|716320_716695_-	hypothetical protein	NA	NA	NA	NA	NA
716209:716227	attR	GTGCAGTCAGTGGTGCAGT	NA	NA	NA	NA
WP_000462905.1|717204_717501_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_003025224.1|717526_718492_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003025221.1|718852_719734_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_003025218.1|719745_721197_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_003025216.1|721186_721429_-	YhdT family protein	NA	NA	NA	NA	NA
WP_003025213.1|721536_722886_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003025210.1|722896_723367_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003025208.1|723759_724359_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_003025204.1|725483_726458_-	oxidoreductase	NA	NA	NA	NA	NA
WP_003025202.1|726683_728624_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_153752135.1|728632_728953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000913396.1|728930_729974_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_003025198.1|730040_731063_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003025196.1|731063_731552_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003025192.1|731559_732153_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003025190.1|732142_733612_+	ribonuclease G	NA	NA	NA	NA	NA
WP_003025186.1|733723_737539_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_003025183.1|737700_739146_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_003839896.1|739232_740162_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_003025177.1|740346_740550_+	AaeX family protein	NA	NA	NA	NA	NA
WP_003025174.1|740557_741490_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_003025171.1|741495_743463_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_003025168.1|743582_743861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003025165.1|743918_744185_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_003025162.1|744561_745032_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_003025158.1|745468_746404_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003025154.1|746460_747528_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_003025151.1|747617_748985_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	2.5e-20
WP_003025147.1|749153_749552_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_003025144.1|749744_750872_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_003025141.1|751090_751519_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003025138.1|751534_751927_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003025132.1|752243_752882_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_003025130.1|752887_753391_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	7.3e-26
>prophage 2
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	776076	783727	5167642		Thermobifida_phage(16.67%)	10	NA	NA
WP_003025085.1|776076_776931_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_003025083.1|776976_777468_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003025078.1|777551_777839_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
WP_003025074.1|777861_779295_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003025073.1|779341_780067_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_003025070.1|780073_780622_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_003025068.1|780590_781166_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003025065.1|781162_781729_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.3	4.2e-54
WP_003025063.1|781749_782736_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_003025060.1|782749_783727_-	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	23.3	4.8e-05
>prophage 3
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	932058	942063	5167642	portal,integrase	Moraxella_phage(16.67%)	12	926369:926381	934251:934263
926369:926381	attL	TAATGATCATTTA	NA	NA	NA	NA
WP_118929543.1|932058_933459_+|integrase	site-specific integrase	integrase	A0A0R6PGY7	Moraxella_phage	31.5	4.4e-44
WP_153983656.1|933455_934238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983657.1|934384_934576_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
934251:934263	attR	TAAATGATCATTA	NA	NA	NA	NA
WP_001118612.1|934958_935135_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_118929373.1|935127_935487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045330990.1|935518_935803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045330937.1|935799_936183_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_153983658.1|936179_938852_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.4	1.6e-58
WP_118929541.1|939253_940015_+	septation initiation protein	NA	NA	NA	NA	NA
WP_061357369.1|940014_940287_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	44.9	1.4e-07
WP_058712693.1|940641_941004_-	hypothetical protein	NA	B2ZY70	Ralstonia_phage	42.2	3.0e-13
WP_153983659.1|941007_942063_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.1	1.1e-169
>prophage 4
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	1049362	1069505	5167642	transposase,integrase	Escherichia_phage(50.0%)	25	1048260:1048319	1076303:1077072
1048260:1048319	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_022542389.1|1049362_1050367_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000429836.1|1050445_1050880_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|1050951_1051302_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|1051315_1051591_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|1051626_1052049_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|1052100_1053795_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|1053812_1054175_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|1054171_1054408_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|1054443_1055112_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|1055150_1056455_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|1056501_1057206_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|1057395_1058211_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|1058361_1059066_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|1059126_1059963_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|1059962_1060766_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043265.1|1060826_1061642_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|1061949_1062801_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|1063556_1064261_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|1064493_1065354_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|1065366_1065909_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|1066390_1066582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|1066605_1066833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|1066883_1068020_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|1067986_1068136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000971921.1|1068134_1069505_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
1076303:1077072	attR	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACCGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTCCGCCATTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGATACGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCCC	NA	NA	NA	NA
>prophage 5
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	1654014	1700570	5167642	terminase,holin,integrase,tail,transposase	Salmonella_phage(59.18%)	53	1638347:1638362	1668919:1668934
1638347:1638362	attL	AGCTGGAAGCCAAAGA	NA	NA	NA	NA
WP_153983680.1|1654014_1655481_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	4.4e-87
WP_003037760.1|1655544_1657122_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_108961756.1|1657314_1658568_+|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	88.7	6.8e-214
WP_045717171.1|1658564_1658744_-	hypothetical protein	NA	T1SA82	Salmonella_phage	96.6	3.5e-23
WP_108961755.1|1658740_1659334_-	adenine methylase	NA	T1SA14	Salmonella_phage	94.9	3.0e-111
WP_153983681.1|1659330_1660398_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	98.6	2.8e-200
WP_153983682.1|1660394_1660553_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	76.9	1.4e-15
WP_016046630.1|1660545_1660845_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	100.0	1.1e-48
WP_000816432.1|1660954_1661203_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	81.7	1.5e-32
WP_003037791.1|1661249_1662191_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	90.4	4.5e-162
WP_003037794.1|1662187_1663009_-	exonuclease VIII/RecE-like protein	NA	A0A193GYK2	Enterobacter_phage	98.5	9.8e-161
WP_003037797.1|1663005_1663308_-	hypothetical protein	NA	T1SA88	Salmonella_phage	96.0	5.5e-45
WP_153983683.1|1663315_1664275_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	64.3	2.7e-45
WP_153983684.1|1664645_1665242_-	helix-turn-helix domain-containing protein	NA	Q858D7	Salmonella_phage	98.5	2.2e-106
WP_001278768.1|1665397_1665631_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	100.0	1.2e-39
WP_052930708.1|1665778_1665979_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	74.2	4.3e-22
WP_153983685.1|1665994_1666789_+	primosomal protein	NA	Q286X4	Escherichia_phage	73.8	3.0e-90
WP_153983686.1|1666785_1667571_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	88.9	5.5e-137
WP_080313187.1|1667688_1668033_+	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	97.4	6.3e-61
WP_153983687.1|1668453_1668711_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	90.6	1.0e-36
WP_153983688.1|1668707_1669223_+	hypothetical protein	NA	A0A220NQV2	Salmonella_phage	33.5	4.9e-09
1668919:1668934	attR	AGCTGGAAGCCAAAGA	NA	NA	NA	NA
WP_127516700.1|1669224_1669593_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	96.7	4.1e-66
WP_153983689.1|1669589_1670021_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	68.3	2.0e-27
WP_153983690.1|1670135_1670474_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	89.3	1.3e-50
WP_153983867.1|1670577_1671174_+|terminase	terminase small subunit	terminase	Q858H4	Salmonella_phage	99.0	6.7e-103
WP_153983691.1|1671170_1672652_+|terminase	terminase	terminase	M1F3C4	Salmonella_phage	97.6	4.3e-292
WP_086550318.1|1672695_1673115_-	hypothetical protein	NA	A0A2H4ZJ80	Enterobacter_phage	87.8	8.8e-17
WP_000334867.1|1673950_1674157_+	hypothetical protein	NA	T1SA67	Salmonella_phage	100.0	5.7e-09
WP_153983692.1|1674171_1675842_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	96.9	3.1e-307
WP_053388643.1|1675838_1676135_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	81.6	7.6e-39
WP_153983693.1|1676137_1676833_+	peptidase	NA	Q858G9	Salmonella_phage	77.4	1.7e-65
WP_049014925.1|1676847_1677834_+	phage protein	NA	A0A193GZ49	Enterobacter_phage	86.3	3.9e-164
WP_153983694.1|1677885_1678326_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	90.4	4.1e-65
WP_049014922.1|1678336_1678717_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	51.2	5.2e-24
WP_153983695.1|1678768_1679092_+	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	72.8	1.7e-36
WP_108961738.1|1679091_1679697_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	98.5	2.6e-110
WP_153983696.1|1679696_1682174_+	hypothetical protein	NA	Q858G3	Salmonella_phage	97.6	0.0e+00
WP_153983697.1|1682173_1682638_+	hypothetical protein	NA	T1SA73	Salmonella_phage	94.8	3.2e-84
WP_153983698.1|1682637_1683180_+	hypothetical protein	NA	T1SA02	Salmonella_phage	93.3	5.4e-67
WP_153983699.1|1683192_1685721_+	hypothetical protein	NA	Q858G0	Salmonella_phage	97.7	0.0e+00
WP_153983700.1|1685720_1687286_+	hypothetical protein	NA	Q858F9	Salmonella_phage	73.8	3.0e-243
WP_153983701.1|1687285_1690042_+	hypothetical protein	NA	Q858F8	Salmonella_phage	94.7	0.0e+00
WP_003838319.1|1691069_1691222_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	85.7	1.5e-14
WP_153983703.1|1691290_1691977_-	BRO-like protein	NA	G9L6E2	Escherichia_phage	65.5	9.8e-82
WP_001187608.1|1692290_1692551_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	83.3	1.2e-35
WP_032933742.1|1694111_1695038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001275998.1|1695205_1695610_+	membrane protein	NA	T1SA79	Salmonella_phage	100.0	9.9e-66
WP_016046623.1|1695596_1695905_+|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	100.0	2.6e-50
WP_153983704.1|1695894_1696521_+	glycoside hydrolase family 19 protein	NA	T1SBJ3	Salmonella_phage	89.4	4.7e-107
WP_108961729.1|1696517_1697006_+	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	66.7	1.4e-50
WP_003037905.1|1697205_1698084_-	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_071524479.1|1698448_1698652_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	71.4	4.3e-17
WP_001567660.1|1699547_1700570_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	1922688	1999319	5167642	capsid,terminase,integrase,protease,plate,tail,transposase	Pseudomonas_phage(23.91%)	83	1944232:1944246	2000401:2000415
WP_003027622.1|1922688_1923639_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.0	4.3e-67
WP_003027620.1|1923822_1925013_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_003027619.1|1925009_1926269_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_003027617.1|1926258_1927887_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_003027615.1|1928157_1929516_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_003027612.1|1929519_1930587_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	44.6	3.9e-08
WP_003027609.1|1930760_1931015_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	76.1	2.4e-25
WP_003027605.1|1931014_1932145_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	1.3e-174
WP_003027604.1|1932255_1934541_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	6.0e-285
WP_003027601.1|1935029_1935758_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_044701169.1|1935916_1938553_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.1	2.8e-92
WP_003027595.1|1938674_1941521_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.2	3.2e-41
WP_003027592.1|1941633_1942284_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_003027590.1|1942300_1944970_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
1944232:1944246	attL	TGTCCAGCGGCATAC	NA	NA	NA	NA
WP_003027588.1|1945708_1946824_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.4	8.4e-115
WP_003027586.1|1946939_1947992_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_003027584.1|1948071_1949136_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A2P1EL10	Moumouvirus	52.9	1.1e-18
WP_003027582.1|1949135_1949786_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	34.3	2.9e-06
WP_003027580.1|1949861_1951505_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.8	2.8e-10
WP_003027576.1|1951610_1953047_+	magnesium transporter	NA	NA	NA	NA	NA
WP_003027573.1|1953009_1954257_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	49.0	8.0e-82
WP_008323420.1|1954535_1956197_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_003027568.1|1956289_1956787_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_003027564.1|1957199_1957691_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_003027560.1|1957680_1957944_+	chaperone NapD	NA	NA	NA	NA	NA
WP_003027558.1|1957940_1960427_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_003027555.1|1960433_1961129_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_003027552.1|1961115_1961979_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_003027550.1|1961975_1962425_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_003027548.1|1962434_1963037_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_003027545.1|1963057_1963678_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	1.1e-12
WP_003027542.1|1963674_1964334_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_003027538.1|1964410_1965148_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_153983709.1|1965144_1965300_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_153983710.1|1965401_1965962_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	73.5	1.1e-73
WP_048231919.1|1966072_1966441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983711.1|1966450_1967524_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	34.9	9.2e-10
WP_096218656.1|1967523_1968096_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	42.2	4.1e-33
WP_060570681.1|1968092_1969160_-|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	43.8	9.6e-68
WP_060570682.1|1969159_1969510_-	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	60.0	2.6e-30
WP_060570683.1|1969599_1970205_-|plate	phage baseplate assembly protein	plate	F6MIL4	Haemophilus_phage	56.4	2.0e-30
WP_060570684.1|1970188_1971406_-|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	37.4	3.3e-72
WP_127785760.1|1971389_1972721_-	multidrug DMT transporter permease	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	26.0	1.3e-32
WP_045261511.1|1972717_1974958_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	35.3	1.4e-68
WP_045261512.1|1975092_1975485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023311695.1|1975485_1975860_-	hypothetical protein	NA	F6MIK8	Haemophilus_phage	54.9	9.6e-31
WP_045261513.1|1975873_1977292_-|tail	tail sheath protein	tail	B7SDP8	Haemophilus_phage	42.2	2.7e-86
WP_023311742.1|1977278_1977500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023311741.1|1977486_1978146_-	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	35.4	2.5e-21
WP_021567602.1|1978145_1978574_-	DUF1320 family protein	NA	A0A1B0T6F3	Thiobacimonas_phage	35.1	5.1e-12
WP_045261516.1|1978577_1978985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021567604.1|1978984_1979893_-	hypothetical protein	NA	A0A2H4J778	uncultured_Caudovirales_phage	63.9	3.8e-105
WP_045261517.1|1979906_1980299_-	hypothetical protein	NA	A0A2P9JZJ1	Alteromonadaceae_phage	48.0	4.1e-24
WP_096218649.1|1980310_1981426_-	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	41.2	1.6e-57
WP_063161512.1|1981481_1981691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047063499.1|1981807_1982350_-	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	37.1	3.7e-23
WP_085406139.1|1982346_1983606_-|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	34.8	1.1e-51
WP_063161511.1|1983592_1985161_-	DUF935 domain-containing protein	NA	A0A0U5KSI0	unidentified_phage	44.6	1.0e-126
WP_153983712.1|1985163_1986816_-|terminase	phage terminase large subunit	terminase	H6V8N6	Pseudomonas_phage	66.1	3.8e-212
WP_153983713.1|1986820_1987030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038637812.1|1987022_1987523_-	DUF1804 family protein	NA	L7P7L4	Pseudomonas_phage	53.4	5.2e-48
WP_021567611.1|1987524_1987809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000171281.1|1987805_1988048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032663807.1|1988056_1988689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023311729.1|1988654_1988918_-	DUF2644 domain-containing protein	NA	A0A2D1GNW8	Pseudomonas_phage	57.3	4.8e-13
WP_023311911.1|1988914_1989559_-	glycoside hydrolase family 19 protein	NA	A0A248XCW5	Klebsiella_phage	56.8	2.5e-63
WP_032663808.1|1989637_1990144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023311913.1|1990143_1990578_-	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	47.0	5.2e-28
WP_072001475.1|1990522_1990999_-	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	63.0	9.6e-44
WP_072049704.1|1991060_1991276_-	hypothetical protein	NA	A0A2D1GNS9	Pseudomonas_phage	64.8	2.0e-20
WP_023311916.1|1991453_1991669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983714.1|1991661_1992027_-	DUF4406 domain-containing protein	NA	A0A1V0E824	Vibrio_phage	52.2	5.7e-20
WP_153983716.1|1992612_1993332_-	DUF2786 domain-containing protein	NA	A0A0S4L2R2	Pseudomonas_phage	32.2	1.5e-16
WP_153983717.1|1993342_1993558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032663812.1|1993636_1993828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038637769.1|1993817_1994051_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063617270.1|1994052_1994697_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	64.6	9.3e-74
WP_038637762.1|1994686_1994893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023311925.1|1994905_1995196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038637759.1|1995206_1996100_-	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	59.8	4.7e-100
WP_150319569.1|1996111_1998157_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	48.2	7.8e-175
WP_023311692.1|1998156_1998414_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	64.6	2.1e-16
WP_023311691.1|1998548_1999319_+	helix-turn-helix transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	37.5	6.1e-40
2000401:2000415	attR	GTATGCCGCTGGACA	NA	NA	NA	NA
>prophage 7
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	2088417	2096836	5167642	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_003027357.1|2088417_2089365_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	1.2e-21
WP_003027356.1|2089348_2090080_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|2090060_2090168_-	protein YohO	NA	NA	NA	NA	NA
WP_003027351.1|2090219_2090951_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.0e-105
WP_003027348.1|2091176_2092862_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
WP_003027347.1|2092858_2093578_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003027346.1|2093624_2094095_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
WP_003027345.1|2094137_2094596_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	68.0	5.6e-49
WP_003027344.1|2094802_2096836_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
>prophage 8
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	2151498	2161076	5167642	tRNA,protease	Bacillus_phage(28.57%)	8	NA	NA
WP_003036815.1|2151498_2153445_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	1.6e-39
WP_003036813.1|2153519_2153744_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003036810.1|2154067_2154388_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036804.1|2154418_2156695_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_003036803.1|2156964_2158326_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.6	3.4e-203
WP_003036800.1|2158485_2158818_-	YegP family protein	NA	NA	NA	NA	NA
WP_003036797.1|2158953_2159676_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_003036792.1|2159672_2161076_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.6	1.0e-32
>prophage 9
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	2370173	2509657	5167642	capsid,terminase,holin,integrase,protease,head,tRNA,portal,tail	Escherichia_phage(28.57%)	164	2450201:2450231	2498268:2498298
WP_003034673.1|2370173_2371907_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	1.7e-85
WP_003034677.1|2372145_2372712_+	VOC family protein	NA	NA	NA	NA	NA
WP_003034680.1|2372714_2373461_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_003034682.1|2373704_2374673_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003034686.1|2374669_2375413_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.3	3.2e-25
WP_003034689.1|2375453_2375849_-	membrane protein	NA	NA	NA	NA	NA
WP_153983725.1|2375901_2376672_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	78.7	1.4e-55
WP_153983726.1|2376653_2377967_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	80.3	7.9e-213
WP_016150522.1|2378022_2378259_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	94.9	4.2e-40
WP_071684370.1|2378414_2378726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071684371.1|2378725_2379355_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	82.8	2.7e-94
WP_162009501.1|2379351_2379465_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	86.5	5.6e-11
WP_142972741.1|2379560_2379785_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	64.4	2.5e-18
WP_058660498.1|2379781_2380348_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	37.8	5.7e-27
WP_142972742.1|2380344_2381094_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	85.9	5.5e-118
WP_162009500.1|2381105_2381684_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	72.0	1.7e-74
WP_071684375.1|2381664_2382099_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	73.8	7.9e-53
WP_162009502.1|2382095_2382218_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	91.9	5.0e-13
WP_142972744.1|2382537_2382894_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	49.6	5.4e-23
WP_047500077.1|2383769_2383961_-	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	61.1	9.5e-11
WP_047500075.1|2383961_2384174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047500074.1|2384365_2385055_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	59.7	4.2e-72
WP_047500072.1|2385165_2385393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142972746.1|2385394_2385592_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000064516.1|2385588_2386521_+	hypothetical protein	NA	C5IHL2	Burkholderia_virus	37.0	2.9e-36
WP_142972747.1|2386628_2388500_+	AAA family ATPase	NA	Q5G8S8	Enterobacteria_phage	59.5	8.3e-224
WP_071684502.1|2388502_2388826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983727.1|2388822_2389626_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.4	5.7e-113
WP_153983728.1|2389948_2390389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983729.1|2390385_2391678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008784467.1|2392129_2392516_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	92.2	1.0e-56
WP_008784468.1|2392502_2392784_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	48.9	7.0e-18
WP_153983730.1|2392783_2393398_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	81.9	1.1e-92
WP_104651375.1|2393405_2393675_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	69.0	6.5e-21
WP_104651374.1|2393631_2393838_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	82.1	1.3e-18
WP_104651373.1|2393815_2394046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104651372.1|2394065_2394299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048217952.1|2394286_2394637_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	80.2	2.7e-51
WP_003841734.1|2394793_2395291_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	73.9	9.7e-63
WP_016150488.1|2395290_2397048_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	89.2	0.0e+00
WP_008323320.1|2397058_2397244_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	57.6	2.9e-12
WP_016150487.1|2397243_2398473_+|portal	phage portal protein	portal	U5P411	Shigella_phage	83.2	1.5e-205
WP_016150486.1|2398459_2399113_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	85.5	2.3e-104
WP_016150485.1|2399126_2400335_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	82.9	6.2e-188
WP_048221283.1|2400636_2400960_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.0	8.6e-20
WP_153983731.1|2400969_2401308_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
WP_038642098.1|2401304_2401754_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	85.9	6.5e-66
WP_065944737.1|2401750_2402098_+	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	76.5	1.7e-45
WP_153983732.1|2402155_2402599_+	hypothetical protein	NA	S4TNM8	Salmonella_phage	85.0	3.7e-66
WP_001549114.1|2402607_2402991_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_023305929.1|2402999_2403278_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	96.7	8.1e-43
WP_032648715.1|2403324_2403690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983733.1|2403751_2407243_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	87.8	0.0e+00
WP_153983734.1|2407245_2407584_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	58.9	2.1e-37
WP_153983735.1|2407580_2408339_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.2	8.6e-95
WP_153983736.1|2408341_2409052_+	peptidase P60	NA	F1C573	Cronobacter_phage	70.2	1.7e-97
WP_153983737.1|2409051_2409639_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.4	1.4e-47
WP_153983738.1|2409692_2412884_+	DUF1983 domain-containing protein	NA	O64335	Escherichia_phage	67.2	0.0e+00
WP_048231682.1|2412883_2413195_+	hypothetical protein	NA	Q5G8V9	Enterobacteria_phage	93.2	1.5e-50
WP_048231685.1|2413194_2413848_+	hypothetical protein	NA	Q5G8V8	Enterobacteria_phage	92.6	2.3e-112
WP_153983739.1|2413910_2415305_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	52.4	3.2e-111
WP_153983740.1|2415438_2415681_-	DinI-like family protein	NA	Q6UAW0	Klebsiella_phage	77.9	5.8e-29
WP_003034861.1|2416034_2416601_-	hydrolase	NA	NA	NA	NA	NA
WP_003034862.1|2416889_2418662_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003034863.1|2418663_2419107_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003034865.1|2419135_2419879_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003034867.1|2419913_2420435_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003034869.1|2420515_2421127_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003034872.1|2421135_2422146_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
WP_008323688.1|2422224_2423010_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_003034877.1|2423006_2423762_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	6.5e-18
WP_003034880.1|2423840_2424785_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_003034883.1|2424800_2426120_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
WP_153983741.1|2426239_2427211_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_003034890.1|2427255_2428698_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_003034893.1|2428816_2429686_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003034896.1|2430053_2431529_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	8.3e-78
WP_003034898.1|2431762_2433574_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_003034901.1|2433608_2434250_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003034904.1|2434316_2435495_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_003034906.1|2435626_2435917_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_008323661.1|2436038_2436392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003034913.1|2436486_2437146_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_008323658.1|2437208_2439287_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_003034918.1|2439277_2439940_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	31.1	7.0e-08
WP_003034921.1|2439963_2440620_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003034925.1|2440726_2440957_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
WP_003844143.1|2441105_2442857_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	33.3	7.2e-44
WP_008323654.1|2443165_2444002_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_003844141.1|2444308_2444887_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	36.5	3.2e-17
WP_003844140.1|2445240_2446143_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.0	5.5e-16
WP_008322661.1|2446460_2446652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032934884.1|2447144_2447735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003844137.1|2447889_2448099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003034928.1|2448357_2448732_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_003034931.1|2448735_2449608_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_003034934.1|2449628_2449967_+	YebY family protein	NA	NA	NA	NA	NA
2450201:2450231	attL	ACAGGAATCGTATTCGGTCTCTTTTTATGTG	NA	NA	NA	NA
WP_137398750.1|2450303_2451389_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.4	3.6e-147
WP_032170291.1|2451357_2451630_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	64.4	1.9e-28
WP_153983742.1|2451693_2451936_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	88.6	1.5e-32
WP_153983868.1|2451975_2453088_-	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	93.2	9.1e-194
WP_153983743.1|2453099_2455862_-	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	67.1	0.0e+00
WP_153983745.1|2456169_2456367_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_039270078.1|2456687_2456903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103285403.1|2457359_2458514_-	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	27.8	1.9e-32
WP_099531231.1|2458535_2459204_-	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	67.8	3.0e-91
WP_099531219.1|2459346_2459556_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	81.2	8.8e-26
WP_099531221.1|2459595_2460135_+	regulator	NA	K7PJT7	Enterobacteria_phage	84.4	2.7e-79
WP_153983869.1|2460319_2461312_+	replication protein	NA	A5VW95	Enterobacteria_phage	75.0	2.7e-48
WP_153983747.1|2461295_2461988_+	phage replication protein	NA	G8C7U6	Escherichia_phage	60.9	1.5e-77
WP_153983748.1|2461999_2462752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983749.1|2462754_2463066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983870.1|2463425_2463650_+	hypothetical protein	NA	B8K1D2	Salmonella_phage	72.4	9.5e-18
WP_153983750.1|2464288_2464564_+	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	84.7	5.8e-33
WP_153983751.1|2464560_2465229_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	71.1	3.2e-53
WP_153983752.1|2465663_2466263_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	95.0	8.0e-104
WP_153983753.1|2466262_2466469_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	69.1	4.5e-22
WP_153983754.1|2466471_2467080_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	62.6	3.5e-46
WP_001568781.1|2467076_2467217_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	95.7	1.2e-18
WP_153983755.1|2467213_2467996_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	74.6	1.1e-108
WP_060683741.1|2468153_2468564_-	hypothetical protein	NA	K7P7K4	Enterobacteria_phage	96.3	3.3e-69
WP_071701194.1|2468913_2469402_+	hypothetical protein	NA	A0A2P0PA94	Pectobacterium_phage	46.4	2.4e-18
WP_016066213.1|2469446_2469725_+|holin	holin	holin	K7PGZ9	Enterobacteria_phage	100.0	6.0e-46
WP_153983756.1|2469696_2470245_+	glycoside hydrolase family protein	NA	K7PM52	Enterobacteria_phage	96.2	2.2e-100
WP_153983757.1|2470223_2470748_+	DUF2514 family protein	NA	A0A291LBG9	Klebsiella_phage	33.8	5.1e-06
WP_136398002.1|2471162_2471837_+	Fur-regulated protein	NA	M9NZE9	Enterobacteria_phage	71.1	9.0e-88
WP_019076560.1|2471957_2472596_+	hypothetical protein	NA	I6S676	Salmonella_phage	87.7	1.0e-109
WP_153983758.1|2472627_2473116_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	77.2	9.2e-50
WP_153983759.1|2473112_2474684_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.5	4.3e-306
WP_153983760.1|2474688_2476092_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	91.3	1.7e-242
WP_153983761.1|2476093_2477200_+	hypothetical protein	NA	G8C7P5	Escherichia_phage	90.5	1.5e-188
WP_153983762.1|2477520_2478273_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	92.0	4.3e-123
WP_016156686.1|2478290_2479430_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	84.0	4.8e-174
WP_128317024.1|2479765_2480248_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	86.9	3.9e-77
WP_115186742.1|2480249_2480603_+	hypothetical protein	NA	G8C7Q0	Escherichia_phage	90.6	1.3e-53
WP_054623473.1|2480605_2481205_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	88.4	2.3e-98
WP_016247123.1|2481194_2481644_+	DUF4128 domain-containing protein	NA	G8C7Q2	Escherichia_phage	89.9	2.3e-71
WP_115186741.1|2481690_2482623_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	91.9	6.3e-156
WP_016247125.1|2482688_2483027_+	hypothetical protein	NA	G8C7Q5	Escherichia_phage	92.9	2.1e-53
WP_025759422.1|2483044_2483332_+	hypothetical protein	NA	I6PD79	Cronobacter_phage	61.5	9.3e-18
WP_153983764.1|2483331_2486487_+|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	72.7	0.0e+00
WP_128317018.1|2486543_2486930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058659081.1|2487017_2487368_+	hypothetical protein	NA	G8C7R0	Escherichia_phage	92.2	4.0e-55
WP_153983765.1|2487364_2488138_+|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	90.2	3.5e-136
WP_153983766.1|2488150_2488882_+	peptidase P60	NA	G8C7R2	Escherichia_phage	89.7	4.2e-139
WP_038641010.1|2488869_2489469_+|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	92.0	2.5e-97
WP_153983767.1|2489524_2492734_+	DUF1983 domain-containing protein	NA	G8C7R4	Escherichia_phage	69.1	0.0e+00
WP_048231682.1|2492733_2493045_+	hypothetical protein	NA	Q5G8V9	Enterobacteria_phage	93.2	1.5e-50
WP_048231685.1|2493044_2493698_+	hypothetical protein	NA	Q5G8V8	Enterobacteria_phage	92.6	2.3e-112
WP_153983739.1|2493760_2495155_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	52.4	3.2e-111
WP_088902117.1|2495288_2495531_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	4.4e-29
WP_121581545.1|2495608_2496028_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.9	2.7e-34
WP_153983768.1|2496029_2497298_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	81.5	1.0e-204
WP_153983871.1|2497290_2497962_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	2.0e-79
WP_003034937.1|2498446_2499088_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.5	8.7e-56
2498268:2498298	attR	ACAGGAATCGTATTCGGTCTCTTTTTATGTG	NA	NA	NA	NA
WP_003034941.1|2499088_2499280_-	YebW family protein	NA	NA	NA	NA	NA
WP_029139506.1|2499382_2499619_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_008322657.1|2499719_2501141_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_003034947.1|2501220_2503854_-	PqiB family protein	NA	NA	NA	NA	NA
WP_003034950.1|2503822_2505106_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_003034953.1|2505234_2505732_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003034957.1|2505828_2506515_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_003034960.1|2506534_2508583_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	1.2e-87
WP_153983769.1|2508775_2509657_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 10
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	2641558	2710023	5167642	capsid,terminase,holin,integrase,protease,head,tail,portal	Enterobacteria_phage(61.54%)	79	2631817:2631831	2663568:2663582
2631817:2631831	attL	AGCTTGCTGAAAAGC	NA	NA	NA	NA
WP_003020678.1|2641558_2643568_-	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	45.3	4.2e-64
WP_008322520.1|2644067_2645261_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	84.4	5.1e-203
WP_008322518.1|2645253_2645454_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	82.5	1.9e-25
WP_008322517.1|2645499_2645742_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	82.3	2.6e-29
WP_008322509.1|2645781_2646822_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	75.6	5.9e-155
WP_008322507.1|2646836_2649392_-	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	47.9	1.7e-232
WP_008322503.1|2649704_2649911_-	phage encoded cell division inhibitor protein	NA	K7PM31	Enterobacteria_phage	98.5	9.6e-33
WP_008322501.1|2650229_2650454_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	66.2	5.2e-16
WP_008322489.1|2650653_2651556_-	serine dehydrogenasease	NA	NA	NA	NA	NA
WP_149335231.1|2651749_2651848_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_008322488.1|2651860_2652559_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	79.3	1.0e-102
WP_008322487.1|2652669_2652891_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	67.6	1.1e-21
WP_008322486.1|2652916_2653456_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	86.0	5.0e-81
WP_008322485.1|2653623_2654571_+	phage protein	NA	G9L6A8	Escherichia_phage	30.1	6.4e-23
WP_008322484.1|2654573_2655323_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	86.7	4.8e-122
WP_008322482.1|2655341_2655653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983770.1|2655649_2656459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322480.1|2656455_2656815_+	hypothetical protein	NA	A0A193GYX5	Enterobacter_phage	91.4	1.9e-07
WP_008322479.1|2656816_2657236_+	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	74.1	2.5e-59
WP_008322478.1|2657232_2657883_+	hypothetical protein	NA	K7PGV7	Enterobacterial_phage	50.0	2.9e-06
WP_008322477.1|2658318_2658918_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	96.0	7.7e-107
WP_008322467.1|2659126_2659735_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	63.7	5.3e-47
WP_008322465.1|2659731_2659866_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	100.0	1.4e-13
WP_008322464.1|2659862_2660678_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	96.7	1.1e-140
WP_032934886.1|2660835_2661246_-	hypothetical protein	NA	K7P7K4	Enterobacteria_phage	99.3	2.1e-71
WP_001568784.1|2661496_2661775_+|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
WP_008322460.1|2661746_2662295_+	lysozyme	NA	K7PM52	Enterobacteria_phage	96.2	3.8e-100
WP_032652448.1|2662291_2662798_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_008322456.1|2663485_2663872_+	hypothetical protein	NA	NA	NA	NA	NA
2663568:2663582	attR	AGCTTGCTGAAAAGC	NA	NA	NA	NA
WP_000453624.1|2664342_2664888_+|terminase	terminase small subunit	terminase	E4WL18	Enterobacteria_phage	100.0	1.2e-95
WP_008322455.1|2664862_2666785_+|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	97.5	0.0e+00
WP_003034782.1|2666784_2666991_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	95.5	3.2e-28
WP_003826190.1|2666987_2668580_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	92.1	9.7e-290
WP_008322451.1|2668560_2669886_+	S49 family peptidase	NA	O64320	Escherichia_phage	78.7	4.9e-186
WP_003826193.1|2669895_2670228_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	82.7	5.0e-47
WP_008322450.1|2670295_2671321_+|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	92.4	4.3e-182
WP_008322448.1|2671366_2671771_+	DNA-packaging protein FI	NA	K7PM13	Enterobacteria_phage	52.2	1.4e-22
WP_008322446.1|2671782_2672136_+|tail	tail attachment protein	tail	K7P6U9	Enterobacteria_phage	75.2	2.0e-46
WP_008322445.1|2672145_2672700_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	91.4	8.0e-74
WP_003034811.1|2672696_2673095_+|tail	tail protein	tail	K7P7G5	Enterobacteria_phage	82.6	1.2e-60
WP_008322443.1|2673102_2673840_+|tail	tail protein	tail	O64327	Escherichia_phage	69.4	1.6e-93
WP_008322442.1|2673876_2674284_+|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	60.7	5.9e-26
WP_071524448.1|2674292_2674613_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	69.8	2.7e-34
WP_008322440.1|2674590_2677107_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	70.6	0.0e+00
WP_008322439.1|2677110_2677458_+	hypothetical protein	NA	K7PJT2	Enterobacteria_phage	69.6	2.3e-39
WP_008322437.1|2678211_2678922_+	peptidase P60	NA	K7P6F5	Enterobacteria_phage	94.1	8.2e-140
WP_008322436.1|2678951_2679377_+	hypothetical protein	NA	K7PLY8	Enterobacterial_phage	36.9	6.6e-12
WP_008322435.1|2679432_2680023_+|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	77.9	1.0e-74
WP_008322431.1|2680153_2680399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322430.1|2680562_2683733_+	host specificity protein J	NA	O64335	Escherichia_phage	85.6	0.0e+00
WP_008322429.1|2683978_2684251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322428.1|2684247_2684886_+	hypothetical protein	NA	A0A1X7QGJ8	Escherichia_phage	30.8	6.5e-11
WP_008322427.1|2684958_2686383_+	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	51.1	1.0e-112
WP_008322426.1|2686517_2686760_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	4.4e-29
WP_003826234.1|2686838_2687228_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	1.0e-51
WP_008322424.1|2687911_2688670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322423.1|2688954_2689626_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.5	1.4e-80
WP_003020675.1|2689777_2690074_-	YciI family protein	NA	NA	NA	NA	NA
WP_003020673.1|2690298_2691018_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_003020670.1|2691082_2691484_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_003020667.1|2691649_2692189_-	septation protein A	NA	NA	NA	NA	NA
WP_003020663.1|2692243_2692987_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_003020660.1|2693385_2694039_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_003020658.1|2694607_2695324_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003020655.1|2695396_2695855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003020652.1|2696094_2696370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003020649.1|2696556_2698041_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.8	8.3e-17
WP_003020647.1|2698047_2698854_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_003020645.1|2698853_2700047_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_003020643.1|2700057_2701416_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.0e-37
WP_003020639.1|2701419_2703015_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.6	3.2e-51
WP_003020636.1|2703014_2704577_-	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_071524452.1|2704671_2704734_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_003020630.1|2704851_2705730_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_003020628.1|2705726_2706347_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_003020625.1|2706447_2707323_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_003020622.1|2707406_2707997_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_003020620.1|2707993_2708755_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.7	3.0e-07
WP_032934880.1|2708976_2710023_+|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 11
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	2894863	2957043	5167642	plate,transposase	Escherichia_phage(25.0%)	55	NA	NA
WP_032425611.1|2894863_2895895_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_003020082.1|2896409_2897291_-	aromatic amino acid efflux DMT transporter YddG	NA	NA	NA	NA	NA
WP_085952501.1|2897578_2900626_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_003836226.1|2900639_2901524_+	formate dehydrogenase N subunit beta	NA	NA	NA	NA	NA
WP_003020054.1|2901516_2902173_+	formate dehydrogenase-N subunit gamma	NA	NA	NA	NA	NA
WP_003020048.1|2902302_2902905_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	4.5e-22
WP_003020045.1|2902984_2904700_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	25.7	5.8e-38
WP_003020042.1|2905009_2906707_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003020039.1|2906886_2907027_-	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
WP_003020036.1|2907254_2907686_+	peroxiredoxin OsmC	NA	NA	NA	NA	NA
WP_008322294.1|2907733_2908504_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003020031.1|2908515_2909907_-	GntP family permease	NA	NA	NA	NA	NA
WP_003020028.1|2909947_2910871_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003020025.1|2910860_2912066_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_003020022.1|2912076_2912733_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_003020020.1|2912735_2913443_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_003020016.1|2913585_2914476_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008322292.1|2914495_2915431_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.8	9.2e-14
WP_003020012.1|2915423_2916410_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.5	7.2e-17
WP_003020010.1|2916406_2917303_-	D,D-dipeptide ABC transporter permease	NA	NA	NA	NA	NA
WP_003020008.1|2917299_2918322_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003020006.1|2918366_2919929_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003020004.1|2919944_2920532_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
WP_003020002.1|2920546_2921413_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003019999.1|2921813_2922143_+	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_003019994.1|2922298_2924242_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.8	1.0e-11
WP_003836258.1|2924421_2924736_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003019985.1|2924728_2926000_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_003019982.1|2926054_2926573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003019978.1|2926569_2927937_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_003019974.1|2927949_2928237_-	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_008322283.1|2928371_2929697_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003019965.1|2929699_2931439_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	34.6	4.5e-30
WP_032932590.1|2931449_2936780_-	heme peroxidase	NA	NA	NA	NA	NA
WP_008322281.1|2937405_2938608_-	MFS transporter	NA	NA	NA	NA	NA
WP_003019956.1|2938754_2940221_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_083884615.1|2940378_2940753_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000019450.1|2940866_2941847_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_003019927.1|2942809_2943157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143186488.1|2943402_2943693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071687560.1|2943703_2944225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117255452.1|2944910_2945771_+	DNA-binding protein	NA	I6R977	Salmonella_phage	49.2	6.4e-62
WP_117255451.1|2945785_2947108_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	34.2	7.0e-68
WP_062958097.1|2947592_2947862_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071687562.1|2947864_2948128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071687563.1|2948114_2948474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071687565.1|2948670_2948856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983773.1|2948915_2949191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019450.1|2950126_2951107_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_071687568.1|2951700_2951958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008324315.1|2953037_2953991_+	hypothetical protein	NA	A0A1D8EQC7	Escherichia_phage	27.0	1.0e-07
WP_008324316.1|2953987_2954698_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_008324317.1|2954707_2955085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008324318.1|2955299_2955650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008324319.1|2955633_2957043_+|plate	baseplate component	plate	A0A2D0YGH8	Vibrio_phage	23.4	1.6e-17
>prophage 12
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	3023264	3030385	5167642	transposase	Stx2-converting_phage(33.33%)	6	NA	NA
WP_001000409.1|3023264_3024800_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_000609174.1|3024849_3025197_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|3025193_3025577_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_100216202.1|3025969_3027138_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
WP_008324000.1|3028590_3029757_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	46.3	1.4e-83
WP_003028915.1|3029767_3030385_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	5.6e-76
>prophage 13
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	3205488	3215526	5167642	tRNA	Cedratvirus(14.29%)	10	NA	NA
WP_003030561.1|3205488_3206268_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.3	1.2e-11
WP_008323845.1|3206264_3207707_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	5.9e-52
WP_003030564.1|3207768_3208482_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003030566.1|3208798_3209263_-	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	2.7e-14
WP_003030567.1|3209340_3210090_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_003030569.1|3210089_3210641_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003030570.1|3210701_3211682_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	1.5e-14
WP_003030571.1|3211835_3212135_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_008323842.1|3212139_3214527_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003030576.1|3214542_3215526_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
>prophage 14
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	3309451	3315031	5167642		uncultured_Caudovirales_phage(57.14%)	8	NA	NA
WP_003030760.1|3309451_3309877_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
WP_003030761.1|3309889_3311179_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	1.2e-165
WP_003030762.1|3311223_3311544_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
WP_008320415.1|3311629_3312328_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	3.8e-89
WP_008320414.1|3312404_3312638_-	DNA polymerase V subunit	NA	A0A222YZE2	Escherichia_phage	78.8	4.3e-21
WP_003030766.1|3312717_3312918_+	DinI-like family protein	NA	Q6UAW0	Klebsiella_phage	77.3	7.9e-24
WP_003030767.1|3313134_3313644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003030769.1|3313780_3315031_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	9.4e-22
>prophage 15
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	3506099	3587894	5167642	capsid,terminase,holin,integrase,plate,tail	Salmonella_phage(32.22%)	112	3546609:3546654	3587909:3587954
WP_153983786.1|3506099_3506468_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_153983787.1|3507744_3508002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983788.1|3508037_3508742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110498441.1|3508743_3510162_-|plate	baseplate J-like family protein	plate	A0A0U2RJZ0	Escherichia_phage	45.3	1.2e-54
WP_003833581.1|3510158_3510491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088760183.1|3510487_3511204_-	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	30.8	7.0e-22
WP_110498442.1|3511200_3512241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110498443.1|3512240_3512516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983789.1|3512512_3513223_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	38.1	5.3e-30
WP_110498445.1|3513222_3515049_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	41.9	4.9e-19
WP_110498446.1|3515172_3515748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983790.1|3515750_3516188_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	38.9	7.0e-25
WP_131445529.1|3516189_3517584_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	38.3	6.5e-72
WP_110498448.1|3517589_3518528_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	39.2	2.2e-52
WP_131445535.1|3518511_3518943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110498450.1|3518939_3519365_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	43.3	3.6e-26
WP_110498451.1|3519373_3519862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131445541.1|3519927_3520959_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	46.5	5.1e-74
WP_110498452.1|3520976_3521849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131445543.1|3521869_3523444_-	NUDIX domain-containing protein	NA	Q6UJ14	Burkholderia_virus	49.5	1.7e-20
WP_153983791.1|3523444_3524320_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	43.9	1.1e-53
WP_153983792.1|3524291_3525731_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	38.0	1.3e-91
WP_153983793.1|3525730_3527002_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.8	4.6e-85
WP_148977527.1|3526991_3527963_-|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	33.5	1.3e-23
WP_153983794.1|3528024_3528435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131445557.1|3528424_3528970_-	DUF2514 domain-containing protein	NA	A0A291AXG6	Shigella_phage	28.7	1.3e-07
WP_110498460.1|3528972_3529389_-	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	58.6	1.4e-43
WP_001648823.1|3529391_3529745_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.7	1.7e-53
WP_115643621.1|3530190_3530769_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	51.4	1.2e-43
WP_148977525.1|3530765_3531059_-	DUF1364 family protein	NA	A0A0U2KD41	Escherichia_phage	63.2	2.3e-32
WP_045441382.1|3531055_3531652_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	74.7	1.7e-82
WP_131445566.1|3532101_3532440_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.1	8.6e-47
WP_131445569.1|3532439_3534512_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	54.2	9.6e-205
WP_131445573.1|3534508_3534781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131445576.1|3534777_3535911_-	site-specific DNA-methyltransferase	NA	A0A060D598	Salmonella_phage	50.4	3.9e-99
WP_131445594.1|3535907_3536159_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	52.8	5.1e-12
WP_048241297.1|3536184_3536433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131445579.1|3536436_3537117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983795.1|3537155_3538544_-	replicative DNA helicase	NA	Q8HA30	Enterobacteria_phage	47.5	9.5e-108
WP_046595084.1|3538540_3539524_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	79.6	1.2e-43
WP_001648809.1|3539526_3539751_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	46.1	4.7e-09
WP_016152513.1|3539773_3540220_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.1	3.2e-25
WP_050186203.1|3540284_3540488_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	49.2	8.0e-08
WP_050186201.1|3540566_3540968_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	54.9	2.5e-37
WP_001648806.1|3541537_3541861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983796.1|3541906_3544180_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.5	2.9e-106
WP_001648803.1|3544179_3544734_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	6.1e-50
WP_016152506.1|3544736_3544919_+	hypothetical protein	NA	H9C155	Pectobacterium_phage	51.7	2.2e-09
WP_001648801.1|3545131_3545356_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_110498477.1|3545356_3546376_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.1	7.5e-94
3546609:3546654	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_061549414.1|3546840_3547386_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	87.2	3.1e-86
WP_153983797.1|3547461_3547830_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_153983798.1|3547839_3548961_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	61.5	1.2e-60
WP_061549416.1|3548960_3549641_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	81.4	2.5e-109
WP_153983799.1|3549637_3550837_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	82.7	1.8e-179
WP_016239889.1|3550837_3551191_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	76.1	1.1e-44
WP_048219596.1|3551190_3551931_-|plate	phage baseplate assembly protein V	plate	A0A0M5M1K7	Salmonella_phage	62.0	2.6e-72
WP_061549418.1|3551996_3552719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061549419.1|3552726_3553791_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	67.1	7.2e-140
WP_001160174.1|3553793_3554099_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	53.5	9.2e-24
WP_153983800.1|3554100_3554703_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	70.1	5.6e-65
WP_153983801.1|3554702_3556706_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	55.1	1.3e-193
WP_112899804.1|3556883_3557309_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	56.7	3.5e-37
WP_000257257.1|3557312_3557753_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	77.4	7.5e-59
WP_153983802.1|3557763_3558924_-	DUF3383 family protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	5.4e-157
WP_153983875.1|3558927_3559491_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.1	3.8e-79
WP_001515083.1|3559465_3559855_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	2.7e-68
WP_147679414.1|3559841_3560429_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	76.9	7.6e-75
WP_153983803.1|3560425_3560833_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.0	2.1e-71
WP_001040703.1|3560798_3561188_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	57.4	6.5e-30
WP_153983804.1|3561229_3562171_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	97.4	9.4e-176
WP_032177172.1|3562182_3562686_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	84.4	3.2e-74
WP_153983805.1|3562690_3563923_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	93.7	5.3e-219
WP_153983876.1|3563937_3564675_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	95.5	1.3e-108
WP_153983806.1|3564559_3566029_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	95.1	1.5e-268
WP_048219616.1|3566028_3567651_-	bacteriophage TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	4.5e-311
WP_153983807.1|3567653_3568127_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	68.0	3.6e-51
WP_001081498.1|3568158_3568779_-	hypothetical protein	NA	I6S676	Salmonella_phage	73.2	4.4e-89
WP_029403918.1|3568833_3569019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048219618.1|3569162_3569555_-	hypothetical protein	NA	A0A192Y6H8	Salmonella_phage	75.0	1.7e-46
WP_153983808.1|3569551_3570166_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	90.1	1.4e-98
WP_048219622.1|3570168_3570516_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	82.4	3.0e-47
WP_082138498.1|3570773_3571457_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	44.1	4.9e-41
WP_045354712.1|3571453_3571816_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	65.5	2.7e-38
WP_052674422.1|3571806_3572289_-	AsnC family protein	NA	A0A068CBG2	Acinetobacter_phage	51.5	5.2e-37
WP_044702921.1|3572285_3572585_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	88.0	5.1e-43
WP_061549425.1|3572574_3573027_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	53.1	3.4e-38
WP_061549426.1|3573267_3573606_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	85.7	4.9e-50
WP_061549427.1|3573598_3574000_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	75.0	1.5e-45
WP_082805395.1|3573992_3574679_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	85.4	9.6e-45
WP_061549428.1|3574680_3575376_-	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	32.3	5.0e-25
WP_153983809.1|3575372_3575540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048219627.1|3575536_3575827_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	65.2	1.8e-29
WP_153983810.1|3575826_3577224_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	63.8	3.3e-169
WP_108961704.1|3577220_3578033_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	45.0	7.9e-54
WP_000426372.1|3578501_3578822_-	hypothetical protein	NA	H6WRX6	Salmonella_phage	88.7	2.9e-44
WP_108961705.1|3578859_3579087_-	transcriptional regulator	NA	K7P6H5	Enterobacteria_phage	69.0	1.9e-18
WP_108961706.1|3579207_3579921_+	helix-turn-helix domain-containing protein	NA	M9NZE3	Enterobacteria_phage	83.1	1.7e-113
WP_061549435.1|3579932_3580361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061549442.1|3580474_3580684_+	hypothetical protein	NA	C6ZR45	Salmonella_phage	60.9	4.2e-12
WP_108961707.1|3580705_3580903_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	53.1	1.3e-10
WP_000501155.1|3581319_3581517_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_153983811.1|3581527_3581800_+	hypothetical protein	NA	S4TU79	Salmonella_phage	61.1	2.7e-27
WP_109863254.1|3581839_3582430_+	hypothetical protein	NA	A0A291AXG3	Shigella_phage	31.7	1.0e-10
WP_044702471.1|3582660_3583101_+	hypothetical protein	NA	Q6WYF0	Enterobacteria_phage	46.7	1.3e-26
WP_044702473.1|3583093_3583780_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	36.6	3.6e-15
WP_016243544.1|3583776_3584448_+	AAA family ATPase	NA	G9L667	Escherichia_phage	46.6	8.8e-51
WP_045399452.1|3584464_3585151_+	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	40.8	2.0e-26
WP_021571176.1|3585162_3585321_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	56.9	3.3e-09
WP_031275321.1|3585371_3586223_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	84.3	3.2e-138
WP_031275320.1|3586225_3586465_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	87.3	1.2e-31
WP_021242885.1|3586730_3587894_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	67.2	2.1e-153
3587909:3587954	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
>prophage 16
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	3926115	3985191	5167642	capsid,transposase,integrase	Sodalis_phage(14.29%)	58	3930422:3930438	3992756:3992772
WP_003019184.1|3926115_3927078_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.2	2.7e-69
WP_003019187.1|3927308_3928124_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003019190.1|3928172_3928823_+	LysE family translocator	NA	NA	NA	NA	NA
WP_003019192.1|3929148_3930390_+	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
3930422:3930438	attL	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_003019195.1|3930470_3931661_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_003019196.1|3931691_3932924_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_003019198.1|3933143_3934070_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003019200.1|3934145_3935426_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_003019202.1|3935439_3935904_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003019203.1|3936001_3937189_+	MFS transporter	NA	NA	NA	NA	NA
WP_003019205.1|3937379_3937781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322158.1|3937844_3938852_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	49.7	8.2e-85
WP_008322159.1|3939043_3939247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003033268.1|3939895_3940669_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_003033266.1|3940801_3942277_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.6	5.8e-47
WP_003033263.1|3942355_3943540_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_003033260.1|3943799_3945143_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_003033257.1|3945192_3945888_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_003033254.1|3945880_3947308_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_003033252.1|3947318_3948038_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_003029921.1|3948619_3950173_+	L-lactate permease	NA	NA	NA	NA	NA
WP_003031569.1|3950654_3951512_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_003031571.1|3951523_3952789_-	tyrosine permease	NA	NA	NA	NA	NA
WP_003031573.1|3952978_3954349_-	tyrosine phenol-lyase	NA	NA	NA	NA	NA
WP_003031575.1|3955127_3955490_+	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_003031576.1|3955733_3956408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003031578.1|3956409_3956757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019450.1|3957135_3958116_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_153983877.1|3958160_3958439_+	cytoplasmic protein USSDB7A	NA	NA	NA	NA	NA
WP_100216202.1|3958801_3959969_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
WP_143993159.1|3961084_3961276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983820.1|3961406_3962438_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_153983821.1|3962454_3962817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143993162.1|3962813_3963038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057056066.1|3963762_3964101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983878.1|3964093_3964357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983822.1|3964487_3964949_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_153983823.1|3964942_3965668_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153983824.1|3965876_3966032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157809232.1|3967762_3968323_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153983825.1|3968319_3968541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142673817.1|3968936_3969488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322865.1|3969666_3970107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322868.1|3970342_3970564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322871.1|3971192_3971906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983826.1|3971990_3973085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322874.1|3973323_3974346_+	DNA methyltransferase	NA	Q96718	Paramecium_bursaria_Chlorella_virus	27.9	8.8e-26
WP_008322875.1|3974399_3976652_+	N-6 DNA methylase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	22.2	5.1e-10
WP_008322876.1|3976644_3977238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322877.1|3977303_3977756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322880.1|3978201_3978639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983827.1|3978607_3979789_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_008322888.1|3980319_3980706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322889.1|3980724_3981039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322891.1|3981092_3981518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062150.1|3981614_3982001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016155585.1|3982015_3983890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322896.1|3983886_3985191_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3992756:3992772	attR	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 17
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	4330207	4337119	5167642	transposase	Morganella_phage(33.33%)	9	NA	NA
WP_025987686.1|4330207_4331413_+|transposase	IS4 family transposase	transposase	Q9E8P4	Bluetongue_virus	72.0	9.9e-170
WP_004187429.1|4331744_4332002_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_020277900.1|4331970_4332336_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_004187425.1|4332428_4332863_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.3	1.2e-29
WP_015059993.1|4332811_4334116_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	50.1	7.8e-112
WP_004187413.1|4334238_4334448_-	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	42.0	7.0e-07
WP_004187411.1|4334450_4334669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117255451.1|4334921_4336244_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	34.2	7.0e-68
WP_117255452.1|4336258_4337119_-	DNA-binding protein	NA	I6R977	Salmonella_phage	49.2	6.4e-62
>prophage 18
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	4401481	4453945	5167642	capsid,terminase,integrase,head,tRNA,portal,tail	Cronobacter_phage(47.06%)	52	4385644:4385659	4453291:4453306
4385644:4385659	attL	CTGCCTGATGCGCTGC	NA	NA	NA	NA
WP_003035803.1|4401481_4402285_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_003035801.1|4402420_4403197_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_003035798.1|4403173_4404067_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_003035796.1|4404231_4404978_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003035793.1|4404974_4405157_-	protein YcaR	NA	NA	NA	NA	NA
WP_003035790.1|4405208_4406441_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003035787.1|4406482_4407460_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_003035784.1|4407456_4409205_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	2.4e-60
WP_003035783.1|4409241_4411506_-	ComEC family protein	NA	NA	NA	NA	NA
WP_003035780.1|4411712_4411997_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	39.1	9.2e-10
WP_003035776.1|4412156_4413830_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_003035772.1|4413943_4414627_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_153983834.1|4414798_4416082_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003035766.1|4416151_4417240_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.0	6.6e-80
WP_003035760.1|4417452_4418145_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_003035758.1|4418281_4420042_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_003035756.1|4420446_4421304_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_003035753.1|4421363_4423646_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	3.8e-162
WP_153983835.1|4424133_4425372_+	acyltransferase family protein	NA	A0A088CPR9	Enterobacteria_phage	28.8	7.3e-27
WP_153983836.1|4426509_4428207_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	58.9	1.4e-169
WP_048231835.1|4428206_4428716_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	48.5	1.9e-34
WP_048231758.1|4428762_4429461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048231836.1|4429492_4429867_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_153983837.1|4429881_4431531_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	61.7	1.7e-100
WP_048231759.1|4431551_4432085_-	protein phage	NA	F1BUK5	Cronobacter_phage	65.4	3.8e-65
WP_153983880.1|4432077_4433262_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	70.3	1.0e-158
WP_048231761.1|4433239_4433584_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.3	3.2e-33
WP_048231763.1|4433580_4435500_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	38.9	2.7e-113
WP_048231765.1|4435687_4435957_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	57.6	4.5e-22
WP_153983838.1|4436058_4436436_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	53.8	8.8e-24
WP_153983839.1|4436432_4436942_-	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	80.8	3.9e-75
WP_048231769.1|4436925_4437147_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.8	3.6e-09
WP_048231771.1|4437149_4437608_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	60.5	4.9e-45
WP_153983840.1|4437607_4439131_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	58.3	7.2e-109
WP_153983841.1|4439133_4439841_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	63.6	3.2e-75
WP_153983842.1|4439813_4440320_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.0	2.1e-36
WP_153983843.1|4440316_4440769_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	49.7	2.1e-32
WP_153983844.1|4440865_4441567_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	47.3	8.3e-52
WP_153983845.1|4441575_4442622_-|capsid	phage major capsid protein, P2 family	capsid	Q94MZ4	Haemophilus_virus	43.7	5.4e-71
WP_153983846.1|4442631_4443495_-|capsid	phage capsid protein	capsid	A5X9H4	Aeromonas_virus	37.0	3.3e-34
WP_153983847.1|4443676_4445458_+|terminase	terminase	terminase	A5X9H3	Aeromonas_virus	57.7	7.2e-201
WP_153983848.1|4445454_4446483_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	50.7	1.5e-102
WP_153983881.1|4446540_4446810_+	hypothetical protein	NA	F1BUM8	Cronobacter_phage	46.9	5.1e-18
WP_153983849.1|4446853_4447219_-	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	55.8	3.4e-33
WP_153983850.1|4447221_4447416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983851.1|4447418_4450082_-	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	46.8	1.6e-233
WP_153983852.1|4450342_4450903_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	34.4	6.5e-23
WP_153983853.1|4450912_4451248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983882.1|4451267_4451591_-	hypothetical protein	NA	Q1JS26	Enterobacteria_phage	65.3	5.9e-29
WP_153983854.1|4451727_4452027_+	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	82.8	6.7e-43
WP_153983855.1|4452120_4453116_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	79.8	5.7e-155
WP_048231800.1|4453147_4453945_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	7.8e-22
4453291:4453306	attR	CTGCCTGATGCGCTGC	NA	NA	NA	NA
>prophage 19
NZ_CP038658	Citrobacter freundii strain 680 chromosome, complete genome	5167642	5095046	5144346	5167642	capsid,transposase,integrase,protease	Stx2-converting_phage(33.33%)	41	5097752:5097769	5140239:5140256
WP_003838722.1|5095046_5095628_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_008321015.1|5095633_5096038_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_008321017.1|5096034_5096892_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_008321019.1|5096980_5098525_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
5097752:5097769	attL	GGCGAATGGCAAACCGAA	NA	NA	NA	NA
WP_008321021.1|5098536_5099673_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003838732.1|5099686_5099776_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_008321024.1|5099828_5100542_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008321026.1|5100734_5102204_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_003838738.1|5102327_5102777_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008321029.1|5102944_5103949_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.4e-23
WP_003838742.1|5104102_5105554_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_003838744.1|5105566_5106748_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_008321031.1|5106913_5108392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321033.1|5108919_5110122_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_008321035.1|5110242_5110443_-	glycogen synthase	NA	NA	NA	NA	NA
WP_008321037.1|5110672_5110882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321040.1|5111014_5112049_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_008321041.1|5112064_5112406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321043.1|5112974_5115134_-	hypothetical protein	NA	A0A2H4YH07	Raoultella_phage	36.2	6.6e-07
WP_008321044.1|5115182_5115578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321046.1|5115734_5116220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321048.1|5116233_5117151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321052.1|5117425_5117869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321055.1|5119908_5120469_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SCL7	Streptococcus_phage	34.6	1.8e-17
WP_008321059.1|5121149_5121542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321061.1|5122306_5123626_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	27.7	4.5e-06
WP_008321066.1|5124506_5125271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008321072.1|5125732_5126353_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_003029581.1|5126408_5127065_-	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	82.1	6.2e-09
WP_003029582.1|5127093_5127402_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_077258089.1|5127911_5128082_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003029584.1|5128310_5129234_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_003029587.1|5129399_5130917_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000345204.1|5131054_5132425_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_003029589.1|5132424_5133825_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.1	2.0e-20
WP_003029591.1|5133854_5134859_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_008321087.1|5138401_5139862_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001548946.1|5139862_5141884_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
5140239:5140256	attR	TTCGGTTTGCCATTCGCC	NA	NA	NA	NA
WP_001201739.1|5142033_5142417_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000609174.1|5142413_5142761_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001000409.1|5142810_5144346_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
>prophage 1
NZ_CP038659	Citrobacter freundii strain 680 plasmid p680_1, complete sequence	385971	12788	19031	385971		Cronobacter_phage(16.67%)	9	NA	NA
WP_127785450.1|12788_14051_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	48.7	5.8e-112
WP_049001160.1|14037_14475_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	51.2	3.7e-26
WP_127785448.1|14721_15138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983886.1|15332_15581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983912.1|15671_16178_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	71.2	1.2e-65
WP_127785444.1|17601_17907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044702780.1|17910_18198_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	86.3	1.9e-42
WP_127785442.1|18210_18477_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	77.4	1.7e-29
WP_153983887.1|18554_19031_+	nuclease	NA	A0A0R6PHV6	Moraxella_phage	41.5	8.2e-19
>prophage 2
NZ_CP038659	Citrobacter freundii strain 680 plasmid p680_1, complete sequence	385971	60729	90004	385971	integrase,transposase	Escherichia_phage(57.14%)	32	57278:57337	88770:88885
57278:57337	attL	TTTCATGATATATCTCCCAATTTGTGTAGGGCTTATTATGCACGCTTAAAAATAATAAAA	NA	NA	NA	NA
WP_136374471.1|60729_63738_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_044702628.1|64169_65030_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	25.2	1.9e-05
WP_153983898.1|65026_66385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079939721.1|66389_67094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702631.1|67099_67399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079939720.1|67447_67963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702634.1|68909_69092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983899.1|69224_69641_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049001257.1|69637_69922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079939718.1|70069_70465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702641.1|70491_70701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079939717.1|71016_72087_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	37.2	3.3e-60
WP_079939716.1|72135_72408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983900.1|72529_74539_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_049001263.1|74607_74910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127785381.1|74955_75708_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_044702647.1|75727_75916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702648.1|75938_76136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702650.1|76801_77167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|77224_77929_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002904004.1|78065_78926_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|78946_79708_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|79969_80872_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_001067855.1|82505_83210_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|83818_84523_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011152976.1|84744_85404_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	99.1	4.2e-130
WP_001067855.1|85580_86285_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015057121.1|86175_87135_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_032490158.1|87290_87764_+	trimethoprim-resistant dihydrofolate reductase DfrA16	NA	G3MBI7	Bacillus_virus	30.8	1.4e-18
WP_001261740.1|87868_88660_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|88823_89171_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
88770:88885	attR	TTTTATTATTTTTAAGCGTGCATAATAAGCCCTACACAAATTGGGAGATATATCATGAAAGGCTGGCTTTTTCTTGTTATCGCAATAGTTGGCGAAGTAATCGCAACATCCGCATT	NA	NA	NA	NA
WP_000259031.1|89164_90004_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
>prophage 3
NZ_CP038659	Citrobacter freundii strain 680 plasmid p680_1, complete sequence	385971	113909	119178	385971		uncultured_Caudovirales_phage(100.0%)	6	NA	NA
WP_000927306.1|113909_115388_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_001066652.1|115406_116234_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000065802.1|116293_116719_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_000922628.1|116731_118021_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000941305.1|118066_118387_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000130816.1|118473_119178_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
>prophage 4
NZ_CP038659	Citrobacter freundii strain 680 plasmid p680_1, complete sequence	385971	282275	327387	385971	protease,integrase,transposase	Acinetobacter_phage(18.18%)	44	310149:310163	330868:330882
WP_000795949.1|282275_283451_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|283620_283833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232447.1|284193_285276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284318.1|285441_286941_-	kinase	NA	NA	NA	NA	NA
WP_000081059.1|286966_288604_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253656.1|288603_289644_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|289728_290367_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|290366_291008_-	TerD family protein	NA	NA	NA	NA	NA
WP_001253657.1|291030_291669_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|292131_292599_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_011152964.1|292616_293825_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_011152965.1|293835_294792_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001585166.1|294791_295871_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040058.1|295872_296646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280115.1|296638_297781_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_012695441.1|297790_298849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254137.1|299169_299751_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_044704557.1|299750_300908_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|300930_301386_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|301408_302449_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|302497_303076_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|303144_303720_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053340.1|304148_305390_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000374058.1|305480_305936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|306176_306368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151572.1|306459_306801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|307787_308042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117044432.1|309876_312885_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	68.9	0.0e+00
310149:310163	attL	AGCGCTTTCTGATCT	NA	NA	NA	NA
WP_058691239.1|312934_313495_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	82.3	1.7e-47
WP_072205433.1|313623_313968_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|314176_315190_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_013263789.1|315356_316157_+	subclass B1 metallo-beta-lactamase VIM-1	NA	NA	NA	NA	NA
WP_063840321.1|316264_316819_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001206317.1|316888_317680_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|317803_318151_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|318144_318984_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|319111_319612_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011899345.1|319668_320568_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|320570_322286_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_058691052.1|322495_323173_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	61.9	2.2e-73
WP_159777016.1|323290_323392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211823.1|323772_324759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|325679_326072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462754.1|326730_327387_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
330868:330882	attR	AGATCAGAAAGCGCT	NA	NA	NA	NA
>prophage 5
NZ_CP038659	Citrobacter freundii strain 680 plasmid p680_1, complete sequence	385971	333000	374923	385971	integrase,transposase	Escherichia_phage(33.33%)	53	340689:340748	358496:359629
WP_022542389.1|333000_334005_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|334083_337056_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|337058_337616_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845048.1|337912_338926_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000381802.1|339071_339605_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_001261740.1|339662_340454_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|340617_340965_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
340689:340748	attL	CGAGGGCTTTACTAAGCTTGCCCCTTCCGCCGTTGTCATAATCGGTTATGGCATCGCATT	NA	NA	NA	NA
WP_000259031.1|340958_341798_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|341925_342426_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|342932_343697_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001375131.1|343760_344018_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	61.9	8.9e-12
WP_000993245.1|344255_344468_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|344430_344550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|344533_344770_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|344766_345132_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|345149_346835_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|346873_347299_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|347326_347602_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294653.1|347617_348013_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|348084_348540_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001287391.1|349820_350225_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001100635.1|350402_350696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175475.1|350721_350958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000916941.1|350998_351454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001447900.1|351513_352179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371925.1|352236_352617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|356526_357231_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000259031.1|357445_358285_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_052238321.1|358278_358614_-	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_025999322.1|358506_358872_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_004193231.1|358875_359751_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
358496:359629	attR	AATGCGATGCCATAACCGATTATGACAACGGCGGAAGGGGCAAGCTTAGTAAAGCCCTCGGTGCGGCGGACATTATCCGCGAACAGGCTGAACAGCACGGCATTGCGCGGGTAACGGATGTCTGGCTGGAAGTCGGCGCACTGGCGGATGTTGAGGAGAGTGCACTGCATTTCTGTTTTGATATCGCCTGCCGTGATACCGTGGCGCAGGGCTGCACACTGCATATTGATGTTATCCCGGCACAGGCATGGTGCTGGGATTGCAGCCGTGAGGCCGAAATCATGCAGCACGCCGGATGCTGTCCGCACTGCGGCAGTGAACGGCTGCGCATCAGTGAAGGTGATGATTTGCGGGTAAAAAGCCTGGAAGGTGAGTGAGTTTTACGCCGCCGCCGTATTCAGCAGCCAGCGGGCGAATTGCTGCATGGCCGGGGTTTCCGTACGGGACTGTAACCGCGTCAGCCAGTAGCCGCCGAGGGTGATTTCTGCGGCAAACGGCTGTACCAGTGCGCCTGACTGTAACAGGCGGCTGAACATACATACCGGTGCGATCGCTACCCCGGCACCCAGTTGTGCCGCCTCGGCCATGGCCAGTGAGGTATCGAACACCATTACCGGCTGTGACGGGGAAGGCGGTGTGCCGCCCGCACAATCCAGCCAGCGGCTCCATTCATCCCGGCGGAATGAGCGCAGCAGGGTAAAGCGGTGAACATCATCCGGCTGCTGTAACTGTTCTGCAATGGCCGGTGAGCACAGCGGAGCGTGTGGTGCACTGAAAATCAGTTCCGCATCTGACTCATGCCACGCGCCGTTACCGAAACGGATCGTATAATCATGCCCTTCCGCCGCCGGGTCCACATGATTGTTATGGGTGGAGATATGCAGATCAATATGCGGATGGCTGTCATAGAATCCGGCCAGACGCGGCAGCAGCCAGCCTGCGGCAAATGTTCCCACCGCACCGACTTTCACCCGCTCACGGAACTGCCCGTGAGAAAAACACTCCAGAGTATCCGCAATCCGGTCAAACGCCTCATTGAGCACCGGCAGTAATCCCTCACCTTCATGGGTCAGCACCAGCCCGCGCGAGACGCGGGTAAACAGCACACAGCCGAGTTGTTCTTCCAGCGCCCTG	NA	NA	NA	NA
WP_012579084.1|359936_360593_-	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_000050481.1|360856_362398_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|362696_363401_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_044702652.1|363614_364058_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_153983903.1|364106_364379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079939710.1|364427_364871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983914.1|364993_365662_+	N-6 DNA methylase	NA	H7BVT3	unidentified_phage	32.4	1.7e-09
WP_079939709.1|366121_366454_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_153983904.1|366728_367166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079939771.1|367346_367802_+	DUF1419 domain-containing protein	NA	NA	NA	NA	NA
WP_079939706.1|367870_368428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940151.1|369463_369895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983905.1|370078_370510_+	antirestriction protein	NA	NA	NA	NA	NA
WP_079940149.1|370524_370875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940148.1|370888_371218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940147.1|371227_371602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940146.1|371591_372110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702669.1|372257_372539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702670.1|372645_372909_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_153983906.1|372899_373130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983907.1|373382_373601_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_087893729.1|373650_374923_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
