The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	338288	397364	5207876	capsid,transposase,integrase	Sodalis_phage(14.29%)	58	342595:342611	404929:404945
WP_003019184.1|338288_339251_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.2	2.7e-69
WP_003019187.1|339481_340297_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003019190.1|340345_340996_+	LysE family translocator	NA	NA	NA	NA	NA
WP_003019192.1|341321_342563_+	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
342595:342611	attL	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_003019195.1|342643_343834_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_003019196.1|343864_345097_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_003019198.1|345316_346243_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003019200.1|346318_347599_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_003019202.1|347612_348077_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003019203.1|348174_349362_+	MFS transporter	NA	NA	NA	NA	NA
WP_003019205.1|349552_349954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322158.1|350017_351025_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	49.7	8.2e-85
WP_008322159.1|351216_351420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003033268.1|352068_352842_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_003033266.1|352974_354450_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.6	5.8e-47
WP_003033263.1|354528_355713_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_003033260.1|355972_357316_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_003033257.1|357365_358061_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_003033254.1|358053_359481_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_003033252.1|359491_360211_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_003029921.1|360792_362346_+	L-lactate permease	NA	NA	NA	NA	NA
WP_003031569.1|362827_363685_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_003031571.1|363696_364962_-	tyrosine permease	NA	NA	NA	NA	NA
WP_003031573.1|365151_366522_-	tyrosine phenol-lyase	NA	NA	NA	NA	NA
WP_003031575.1|367300_367663_+	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_003031576.1|367906_368581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003031578.1|368582_368930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019450.1|369308_370289_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_153983877.1|370333_370612_+	cytoplasmic protein USSDB7A	NA	NA	NA	NA	NA
WP_100216202.1|370974_372142_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
WP_143993159.1|373257_373449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983820.1|373579_374611_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_153983821.1|374627_374990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143993162.1|374986_375211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057056066.1|375935_376274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983878.1|376266_376530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983822.1|376660_377122_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_153983823.1|377115_377841_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153983824.1|378049_378205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157809232.1|379935_380496_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153983825.1|380492_380714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142673817.1|381109_381661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322865.1|381839_382280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322868.1|382515_382737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322871.1|383365_384079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983826.1|384163_385258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322874.1|385496_386519_+	DNA methyltransferase	NA	Q96718	Paramecium_bursaria_Chlorella_virus	27.9	8.8e-26
WP_008322875.1|386572_388825_+	N-6 DNA methylase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	22.2	5.1e-10
WP_008322876.1|388817_389411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322877.1|389476_389929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322880.1|390374_390812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983827.1|390780_391962_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_008322888.1|392492_392879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322889.1|392897_393212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322891.1|393265_393691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062150.1|393787_394174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016155585.1|394188_396063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322896.1|396059_397364_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
404929:404945	attR	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 2
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	1469559	1546780	5207876	protease,integrase,capsid,head,tail,tRNA,portal,terminase	uncultured_Caudovirales_phage(71.43%)	74	1493356:1493374	1509598:1509616
WP_003031157.1|1469559_1470507_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.8	2.0e-08
WP_003031159.1|1470521_1471031_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_003031161.1|1471160_1472285_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003031162.1|1472256_1472730_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_008324985.1|1472756_1473299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003031166.1|1473303_1473876_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_003031168.1|1473877_1474699_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003031169.1|1474695_1474953_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_003031171.1|1474928_1475483_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_003025300.1|1481476_1482235_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.1e-20
WP_003025299.1|1482242_1483346_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003025297.1|1483355_1484537_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003025295.1|1484606_1485632_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	9.0e-71
WP_003025292.1|1486091_1486313_-	membrane protein	NA	NA	NA	NA	NA
WP_003025288.1|1486583_1489697_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_003025285.1|1489708_1490869_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003025283.1|1491288_1491945_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
WP_003025279.1|1491990_1492155_-	DUF2556 family protein	NA	NA	NA	NA	NA
WP_008320694.1|1492237_1493122_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	3.6e-28
1493356:1493374	attL	GTGCAGTCAGTGGTGCAGT	NA	NA	NA	NA
WP_153983641.1|1493411_1494635_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	93.4	2.7e-231
WP_153983642.1|1494631_1495432_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	38.3	8.1e-35
WP_153983643.1|1495532_1495739_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	82.4	1.5e-25
WP_162009219.1|1496520_1496733_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	50.9	1.2e-09
WP_078309651.1|1496725_1496911_+	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	85.2	8.3e-20
WP_001547834.1|1496903_1497131_+	hypothetical protein	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	100.0	1.6e-33
WP_153983645.1|1497127_1497496_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	99.2	6.1e-62
WP_153983646.1|1497492_1498857_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	97.1	3.4e-259
WP_045329600.1|1499079_1499334_+	hypothetical protein	NA	A0A2H4JEE4	uncultured_Caudovirales_phage	98.8	3.2e-38
WP_023332888.1|1499346_1499646_+	hypothetical protein	NA	A0A2H4JB54	uncultured_Caudovirales_phage	100.0	1.1e-48
WP_153983647.1|1499877_1501044_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	94.1	4.6e-204
WP_153983648.1|1501095_1501656_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	98.4	1.3e-100
WP_153983649.1|1501657_1502893_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	98.8	3.5e-239
WP_112018966.1|1502889_1503228_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	95.5	5.0e-55
WP_112018967.1|1503224_1503518_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	97.9	3.6e-49
WP_112018968.1|1503517_1503961_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	95.9	2.9e-82
WP_162009211.1|1503953_1504106_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	98.0	5.2e-20
WP_000113647.1|1504236_1504593_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_153983650.1|1504576_1506238_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.7	0.0e+00
WP_153983651.1|1506251_1509557_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	58.7	1.8e-285
WP_153983652.1|1509709_1510084_-	hypothetical protein	NA	NA	NA	NA	NA
1509598:1509616	attR	GTGCAGTCAGTGGTGCAGT	NA	NA	NA	NA
WP_000462905.1|1510593_1510890_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_003025224.1|1510915_1511881_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003025221.1|1512241_1513123_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_003025218.1|1513134_1514586_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_003025216.1|1514575_1514818_-	YhdT family protein	NA	NA	NA	NA	NA
WP_003025213.1|1514925_1516275_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003025210.1|1516285_1516756_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003025208.1|1517148_1517748_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_003025204.1|1518872_1519847_-	oxidoreductase	NA	NA	NA	NA	NA
WP_003025202.1|1520072_1522013_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_153752135.1|1522021_1522342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000913396.1|1522319_1523363_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_003025198.1|1523429_1524452_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003025196.1|1524452_1524941_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003025192.1|1524948_1525542_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003025190.1|1525531_1527001_+	ribonuclease G	NA	NA	NA	NA	NA
WP_003025186.1|1527112_1530928_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_003025183.1|1531089_1532535_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_003839896.1|1532621_1533551_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_003025177.1|1533735_1533939_+	AaeX family protein	NA	NA	NA	NA	NA
WP_003025174.1|1533946_1534879_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_003025171.1|1534884_1536852_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_003025168.1|1536971_1537250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003025165.1|1537307_1537574_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_003025162.1|1537950_1538421_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_003025158.1|1538857_1539793_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003025154.1|1539849_1540917_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_003025151.1|1541006_1542374_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	2.5e-20
WP_003025147.1|1542542_1542941_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_003025144.1|1543133_1544261_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_003025141.1|1544479_1544908_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003025138.1|1544923_1545316_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003025132.1|1545632_1546271_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_003025130.1|1546276_1546780_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	7.3e-26
>prophage 3
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	1569465	1577116	5207876		Thermobifida_phage(16.67%)	10	NA	NA
WP_003025085.1|1569465_1570320_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_003025083.1|1570365_1570857_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003025078.1|1570940_1571228_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
WP_003025074.1|1571250_1572684_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003025073.1|1572730_1573456_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_003025070.1|1573462_1574011_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_003025068.1|1573979_1574555_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003025065.1|1574551_1575118_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.3	4.2e-54
WP_003025063.1|1575138_1576125_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_003025060.1|1576138_1577116_-	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	23.3	4.8e-05
>prophage 4
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	1725447	1735452	5207876	portal,integrase	Moraxella_phage(16.67%)	12	1719758:1719770	1727640:1727652
1719758:1719770	attL	TAATGATCATTTA	NA	NA	NA	NA
WP_118929543.1|1725447_1726848_+|integrase	site-specific integrase	integrase	A0A0R6PGY7	Moraxella_phage	31.5	4.4e-44
WP_153983656.1|1726844_1727627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983657.1|1727773_1727965_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1727640:1727652	attR	TAAATGATCATTA	NA	NA	NA	NA
WP_001118612.1|1728347_1728524_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_118929373.1|1728516_1728876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045330990.1|1728907_1729192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045330937.1|1729188_1729572_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_153983658.1|1729568_1732241_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.4	1.6e-58
WP_118929541.1|1732642_1733404_+	septation initiation protein	NA	NA	NA	NA	NA
WP_061357369.1|1733403_1733676_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	44.9	1.4e-07
WP_058712693.1|1734030_1734393_-	hypothetical protein	NA	B2ZY70	Ralstonia_phage	42.2	3.0e-13
WP_153983659.1|1734396_1735452_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.1	1.1e-169
>prophage 5
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	1847212	1863799	5207876	transposase,integrase	Escherichia_phage(50.0%)	19	1841649:1841708	1868365:1869134
1841649:1841708	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_000935452.1|1847212_1848517_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|1848563_1849268_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|1849457_1850273_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|1850423_1851128_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|1851188_1852025_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|1852024_1852828_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043265.1|1852888_1853704_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|1854011_1854863_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|1855618_1856323_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|1856555_1857416_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|1857428_1857971_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|1858452_1858644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|1858667_1858895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|1858945_1860082_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|1860048_1860198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000971921.1|1860196_1861567_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_014342213.1|1861708_1861834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|1862387_1863248_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|1863397_1863799_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
1868365:1869134	attR	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACCGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTCCGCCATTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGATACGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCCC	NA	NA	NA	NA
>prophage 6
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	2444667	2491223	5207876	integrase,terminase,holin,tail,transposase	Salmonella_phage(59.18%)	53	2429000:2429015	2459572:2459587
2429000:2429015	attL	AGCTGGAAGCCAAAGA	NA	NA	NA	NA
WP_153983680.1|2444667_2446134_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	4.4e-87
WP_003037760.1|2446197_2447775_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_108961756.1|2447967_2449221_+|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	88.7	6.8e-214
WP_045717171.1|2449217_2449397_-	hypothetical protein	NA	T1SA82	Salmonella_phage	96.6	3.5e-23
WP_108961755.1|2449393_2449987_-	adenine methylase	NA	T1SA14	Salmonella_phage	94.9	3.0e-111
WP_153983681.1|2449983_2451051_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	98.6	2.8e-200
WP_153983682.1|2451047_2451206_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	76.9	1.4e-15
WP_016046630.1|2451198_2451498_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	100.0	1.1e-48
WP_000816432.1|2451607_2451856_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	81.7	1.5e-32
WP_003037791.1|2451902_2452844_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	90.4	4.5e-162
WP_003037794.1|2452840_2453662_-	exonuclease VIII/RecE-like protein	NA	A0A193GYK2	Enterobacter_phage	98.5	9.8e-161
WP_003037797.1|2453658_2453961_-	hypothetical protein	NA	T1SA88	Salmonella_phage	96.0	5.5e-45
WP_153983683.1|2453968_2454928_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	64.3	2.7e-45
WP_153983684.1|2455298_2455895_-	helix-turn-helix domain-containing protein	NA	Q858D7	Salmonella_phage	98.5	2.2e-106
WP_001278768.1|2456050_2456284_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	100.0	1.2e-39
WP_052930708.1|2456431_2456632_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	74.2	4.3e-22
WP_153983685.1|2456647_2457442_+	primosomal protein	NA	Q286X4	Escherichia_phage	73.8	3.0e-90
WP_153983686.1|2457438_2458224_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	88.9	5.5e-137
WP_080313187.1|2458341_2458686_+	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	97.4	6.3e-61
WP_153983687.1|2459106_2459364_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	90.6	1.0e-36
WP_153983688.1|2459360_2459876_+	hypothetical protein	NA	A0A220NQV2	Salmonella_phage	33.5	4.9e-09
2459572:2459587	attR	AGCTGGAAGCCAAAGA	NA	NA	NA	NA
WP_127516700.1|2459877_2460246_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	96.7	4.1e-66
WP_153983689.1|2460242_2460674_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	68.3	2.0e-27
WP_153983690.1|2460788_2461127_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	89.3	1.3e-50
WP_153983867.1|2461230_2461827_+|terminase	terminase small subunit	terminase	Q858H4	Salmonella_phage	99.0	6.7e-103
WP_153983691.1|2461823_2463305_+|terminase	terminase	terminase	M1F3C4	Salmonella_phage	97.6	4.3e-292
WP_086550318.1|2463348_2463768_-	hypothetical protein	NA	A0A2H4ZJ80	Enterobacter_phage	87.8	8.8e-17
WP_000334867.1|2464603_2464810_+	hypothetical protein	NA	T1SA67	Salmonella_phage	100.0	5.7e-09
WP_153983692.1|2464824_2466495_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	96.9	3.1e-307
WP_053388643.1|2466491_2466788_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	81.6	7.6e-39
WP_153983693.1|2466790_2467486_+	peptidase	NA	Q858G9	Salmonella_phage	77.4	1.7e-65
WP_049014925.1|2467500_2468487_+	phage protein	NA	A0A193GZ49	Enterobacter_phage	86.3	3.9e-164
WP_153983694.1|2468538_2468979_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	90.4	4.1e-65
WP_049014922.1|2468989_2469370_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	51.2	5.2e-24
WP_153983695.1|2469421_2469745_+	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	72.8	1.7e-36
WP_108961738.1|2469744_2470350_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	98.5	2.6e-110
WP_153983696.1|2470349_2472827_+	hypothetical protein	NA	Q858G3	Salmonella_phage	97.6	0.0e+00
WP_153983697.1|2472826_2473291_+	hypothetical protein	NA	T1SA73	Salmonella_phage	94.8	3.2e-84
WP_153983698.1|2473290_2473833_+	hypothetical protein	NA	T1SA02	Salmonella_phage	93.3	5.4e-67
WP_153983699.1|2473845_2476374_+	hypothetical protein	NA	Q858G0	Salmonella_phage	97.7	0.0e+00
WP_153983700.1|2476373_2477939_+	hypothetical protein	NA	Q858F9	Salmonella_phage	73.8	3.0e-243
WP_153983701.1|2477938_2480695_+	hypothetical protein	NA	Q858F8	Salmonella_phage	94.7	0.0e+00
WP_003838319.1|2481722_2481875_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	85.7	1.5e-14
WP_153983703.1|2481943_2482630_-	BRO-like protein	NA	G9L6E2	Escherichia_phage	65.5	9.8e-82
WP_001187608.1|2482943_2483204_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	83.3	1.2e-35
WP_032933742.1|2484764_2485691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001275998.1|2485858_2486263_+	membrane protein	NA	T1SA79	Salmonella_phage	100.0	9.9e-66
WP_016046623.1|2486249_2486558_+|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	100.0	2.6e-50
WP_153983704.1|2486547_2487174_+	glycoside hydrolase family 19 protein	NA	T1SBJ3	Salmonella_phage	89.4	4.7e-107
WP_108961729.1|2487170_2487659_+	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	66.7	1.4e-50
WP_003037905.1|2487858_2488737_-	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_071524479.1|2489101_2489305_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	71.4	4.3e-17
WP_001567660.1|2490200_2491223_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	2710713	2787344	5207876	protease,integrase,terminase,capsid,plate,tail,transposase	Pseudomonas_phage(23.91%)	83	2732257:2732271	2788426:2788440
WP_003027622.1|2710713_2711664_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.0	4.3e-67
WP_003027620.1|2711847_2713038_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_003027619.1|2713034_2714294_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_003027617.1|2714283_2715912_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_003027615.1|2716182_2717541_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_003027612.1|2717544_2718612_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	44.6	3.9e-08
WP_003027609.1|2718785_2719040_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	76.1	2.4e-25
WP_003027605.1|2719039_2720170_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	1.3e-174
WP_003027604.1|2720280_2722566_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	6.0e-285
WP_003027601.1|2723054_2723783_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_044701169.1|2723941_2726578_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.1	2.8e-92
WP_003027595.1|2726699_2729546_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.2	3.2e-41
WP_003027592.1|2729658_2730309_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_003027590.1|2730325_2732995_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
2732257:2732271	attL	TGTCCAGCGGCATAC	NA	NA	NA	NA
WP_003027588.1|2733733_2734849_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.4	8.4e-115
WP_003027586.1|2734964_2736017_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_003027584.1|2736096_2737161_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A2P1EL10	Moumouvirus	52.9	1.1e-18
WP_003027582.1|2737160_2737811_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	34.3	2.9e-06
WP_003027580.1|2737886_2739530_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.8	2.8e-10
WP_003027576.1|2739635_2741072_+	magnesium transporter	NA	NA	NA	NA	NA
WP_003027573.1|2741034_2742282_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	49.0	8.0e-82
WP_008323420.1|2742560_2744222_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_003027568.1|2744314_2744812_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_003027564.1|2745224_2745716_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_003027560.1|2745705_2745969_+	chaperone NapD	NA	NA	NA	NA	NA
WP_003027558.1|2745965_2748452_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_003027555.1|2748458_2749154_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_003027552.1|2749140_2750004_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_003027550.1|2750000_2750450_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_003027548.1|2750459_2751062_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_003027545.1|2751082_2751703_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	1.1e-12
WP_003027542.1|2751699_2752359_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_003027538.1|2752435_2753173_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_153983709.1|2753169_2753325_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_153983710.1|2753426_2753987_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	73.5	1.1e-73
WP_003030316.1|2754097_2754466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153986006.1|2754475_2755549_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	34.9	9.2e-10
WP_096218656.1|2755548_2756121_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	42.2	4.1e-33
WP_060570681.1|2756117_2757185_-|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	43.8	9.6e-68
WP_060570682.1|2757184_2757535_-	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	60.0	2.6e-30
WP_060570683.1|2757624_2758230_-|plate	phage baseplate assembly protein	plate	F6MIL4	Haemophilus_phage	56.4	2.0e-30
WP_060570684.1|2758213_2759431_-|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	37.4	3.3e-72
WP_127785760.1|2759414_2760746_-	multidrug DMT transporter permease	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	26.0	1.3e-32
WP_045261511.1|2760742_2762983_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	35.3	1.4e-68
WP_045261512.1|2763117_2763510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023311695.1|2763510_2763885_-	hypothetical protein	NA	F6MIK8	Haemophilus_phage	54.9	9.6e-31
WP_045261513.1|2763898_2765317_-|tail	tail sheath protein	tail	B7SDP8	Haemophilus_phage	42.2	2.7e-86
WP_023311742.1|2765303_2765525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023311741.1|2765511_2766171_-	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	35.4	2.5e-21
WP_021567602.1|2766170_2766599_-	DUF1320 family protein	NA	A0A1B0T6F3	Thiobacimonas_phage	35.1	5.1e-12
WP_045261516.1|2766602_2767010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021567604.1|2767009_2767918_-	hypothetical protein	NA	A0A2H4J778	uncultured_Caudovirales_phage	63.9	3.8e-105
WP_045261517.1|2767931_2768324_-	hypothetical protein	NA	A0A2P9JZJ1	Alteromonadaceae_phage	48.0	4.1e-24
WP_096218649.1|2768335_2769451_-	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	41.2	1.6e-57
WP_063161512.1|2769506_2769716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047063499.1|2769832_2770375_-	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	37.1	3.7e-23
WP_085406139.1|2770371_2771631_-|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	34.8	1.1e-51
WP_063161511.1|2771617_2773186_-	DUF935 domain-containing protein	NA	A0A0U5KSI0	unidentified_phage	44.6	1.0e-126
WP_153983712.1|2773188_2774841_-|terminase	phage terminase large subunit	terminase	H6V8N6	Pseudomonas_phage	66.1	3.8e-212
WP_153983713.1|2774845_2775055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038637812.1|2775047_2775548_-	DUF1804 family protein	NA	L7P7L4	Pseudomonas_phage	53.4	5.2e-48
WP_021567611.1|2775549_2775834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000171281.1|2775830_2776073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032663807.1|2776081_2776714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023311729.1|2776679_2776943_-	DUF2644 domain-containing protein	NA	A0A2D1GNW8	Pseudomonas_phage	57.3	4.8e-13
WP_023311911.1|2776939_2777584_-	glycoside hydrolase family 19 protein	NA	A0A248XCW5	Klebsiella_phage	56.8	2.5e-63
WP_032663808.1|2777662_2778169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023311913.1|2778168_2778603_-	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	47.0	5.2e-28
WP_072001475.1|2778547_2779024_-	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	63.0	9.6e-44
WP_072049704.1|2779085_2779301_-	hypothetical protein	NA	A0A2D1GNS9	Pseudomonas_phage	64.8	2.0e-20
WP_023311916.1|2779478_2779694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983714.1|2779686_2780052_-	DUF4406 domain-containing protein	NA	A0A1V0E824	Vibrio_phage	52.2	5.7e-20
WP_153983716.1|2780637_2781357_-	DUF2786 domain-containing protein	NA	A0A0S4L2R2	Pseudomonas_phage	32.2	1.5e-16
WP_153983717.1|2781367_2781583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032663812.1|2781661_2781853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038637769.1|2781842_2782076_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063617270.1|2782077_2782722_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	64.6	9.3e-74
WP_038637762.1|2782711_2782918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023311925.1|2782930_2783221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038637759.1|2783231_2784125_-	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	59.8	4.7e-100
WP_150319569.1|2784136_2786182_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	48.2	7.8e-175
WP_023311692.1|2786181_2786439_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	64.6	2.1e-16
WP_023311691.1|2786573_2787344_+	helix-turn-helix transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	37.5	6.1e-40
2788426:2788440	attR	GTATGCCGCTGGACA	NA	NA	NA	NA
>prophage 8
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	2876442	2884861	5207876	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_003027357.1|2876442_2877390_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	1.2e-21
WP_003027356.1|2877373_2878105_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|2878085_2878193_-	protein YohO	NA	NA	NA	NA	NA
WP_003027351.1|2878244_2878976_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.0e-105
WP_003027348.1|2879201_2880887_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
WP_003027347.1|2880883_2881603_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003027346.1|2881649_2882120_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
WP_003027345.1|2882162_2882621_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	68.0	5.6e-49
WP_003027344.1|2882827_2884861_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
>prophage 9
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	2939523	2949101	5207876	protease,tRNA	Bacillus_phage(28.57%)	8	NA	NA
WP_003036815.1|2939523_2941470_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	1.6e-39
WP_003036813.1|2941544_2941769_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003036810.1|2942092_2942413_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036804.1|2942443_2944720_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_003036803.1|2944989_2946351_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.6	3.4e-203
WP_003036800.1|2946510_2946843_-	YegP family protein	NA	NA	NA	NA	NA
WP_003036797.1|2946978_2947701_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_003036792.1|2947697_2949101_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.6	1.0e-32
>prophage 10
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	3160343	3289288	5207876	protease,integrase,capsid,holin,head,tail,tRNA,portal,terminase	Escherichia_phage(28.83%)	156	3240401:3240431	3288468:3288498
WP_003034673.1|3160343_3162077_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	1.7e-85
WP_003034677.1|3162315_3162882_+	VOC family protein	NA	NA	NA	NA	NA
WP_003034680.1|3162884_3163631_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_003034682.1|3163874_3164843_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003034686.1|3164839_3165583_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.3	3.2e-25
WP_003034689.1|3165623_3166019_-	membrane protein	NA	NA	NA	NA	NA
WP_153983725.1|3166071_3166842_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	78.7	1.4e-55
WP_153983726.1|3166823_3168137_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	80.3	7.9e-213
WP_016150522.1|3168192_3168429_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	94.9	4.2e-40
WP_071684370.1|3168584_3168896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071684371.1|3168895_3169525_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	82.8	2.7e-94
WP_162009501.1|3169521_3169635_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	86.5	5.6e-11
WP_142972741.1|3169730_3169955_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	64.4	2.5e-18
WP_058660498.1|3169951_3170518_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	37.8	5.7e-27
WP_142972742.1|3170514_3171264_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	85.9	5.5e-118
WP_162009500.1|3171275_3171854_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	72.0	1.7e-74
WP_071684375.1|3171834_3172269_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	73.8	7.9e-53
WP_162009502.1|3172265_3172388_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	91.9	5.0e-13
WP_142972744.1|3172707_3173064_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	49.6	5.4e-23
WP_047500077.1|3173939_3174131_-	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	61.1	9.5e-11
WP_047500075.1|3174131_3174344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047500074.1|3174535_3175225_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	59.7	4.2e-72
WP_047500072.1|3175335_3175563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142972746.1|3175564_3175762_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000064516.1|3175758_3176691_+	hypothetical protein	NA	C5IHL2	Burkholderia_virus	37.0	2.9e-36
WP_142972747.1|3176798_3178670_+	AAA family ATPase	NA	Q5G8S8	Enterobacteria_phage	59.5	8.3e-224
WP_071684502.1|3178672_3178996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983727.1|3178992_3179796_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.4	5.7e-113
WP_153983728.1|3180118_3180559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983729.1|3180555_3181848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008784467.1|3182299_3182686_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	92.2	1.0e-56
WP_008784468.1|3182672_3182954_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	48.9	7.0e-18
WP_153983730.1|3182953_3183568_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	81.9	1.1e-92
WP_104651375.1|3183575_3183845_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	69.0	6.5e-21
WP_104651374.1|3183801_3184008_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	82.1	1.3e-18
WP_104651373.1|3183985_3184216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104651372.1|3184235_3184469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048217952.1|3184456_3184807_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	80.2	2.7e-51
WP_003841734.1|3184963_3185461_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	73.9	9.7e-63
WP_016150488.1|3185460_3187218_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	89.2	0.0e+00
WP_008323320.1|3187228_3187414_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	57.6	2.9e-12
WP_016150487.1|3187413_3188643_+|portal	phage portal protein	portal	U5P411	Shigella_phage	83.2	1.5e-205
WP_016150486.1|3188629_3189283_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	85.5	2.3e-104
WP_016150485.1|3189296_3190505_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	82.9	6.2e-188
WP_153986030.1|3190543_3190840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048221283.1|3190836_3191160_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.0	8.6e-20
WP_153983731.1|3191169_3191508_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
WP_038642098.1|3191504_3191954_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	85.9	6.5e-66
WP_065944737.1|3191950_3192298_+	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	76.5	1.7e-45
WP_153983732.1|3192355_3192799_+	hypothetical protein	NA	S4TNM8	Salmonella_phage	85.0	3.7e-66
WP_001549114.1|3192807_3193191_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_023305929.1|3193199_3193478_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	96.7	8.1e-43
WP_032648715.1|3193524_3193890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983733.1|3193951_3197443_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	87.8	0.0e+00
WP_153983734.1|3197445_3197784_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	58.9	2.1e-37
WP_153983735.1|3197780_3198539_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.2	8.6e-95
WP_153983736.1|3198541_3199252_+	peptidase P60	NA	F1C573	Cronobacter_phage	70.2	1.7e-97
WP_153983737.1|3199251_3199839_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.4	1.4e-47
WP_153983738.1|3199892_3203084_+	DUF1983 domain-containing protein	NA	O64335	Escherichia_phage	67.2	0.0e+00
WP_048231682.1|3203083_3203395_+	hypothetical protein	NA	Q5G8V9	Enterobacteria_phage	93.2	1.5e-50
WP_048231685.1|3203394_3204048_+	hypothetical protein	NA	Q5G8V8	Enterobacteria_phage	92.6	2.3e-112
WP_153983739.1|3204110_3205505_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	52.4	3.2e-111
WP_153983740.1|3205638_3205881_-	DinI-like family protein	NA	Q6UAW0	Klebsiella_phage	77.9	5.8e-29
WP_003034861.1|3206234_3206801_-	hydrolase	NA	NA	NA	NA	NA
WP_003034862.1|3207089_3208862_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003034863.1|3208863_3209307_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003034865.1|3209335_3210079_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003034867.1|3210113_3210635_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003034869.1|3210715_3211327_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003034872.1|3211335_3212346_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
WP_008323688.1|3212424_3213210_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_003034877.1|3213206_3213962_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	6.5e-18
WP_003034880.1|3214040_3214985_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_003034883.1|3215000_3216320_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
WP_003034887.1|3216439_3217411_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_003034890.1|3217455_3218898_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_003034893.1|3219016_3219886_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003034896.1|3220253_3221729_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	8.3e-78
WP_003034898.1|3221962_3223774_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_003034901.1|3223808_3224450_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003034904.1|3224516_3225695_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_003034906.1|3225826_3226117_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_008323661.1|3226238_3226592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003034913.1|3226686_3227346_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_008323658.1|3227408_3229487_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_003034918.1|3229477_3230140_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	31.1	7.0e-08
WP_003034921.1|3230163_3230820_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003034925.1|3230926_3231157_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
WP_003844143.1|3231305_3233057_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	33.3	7.2e-44
WP_008323654.1|3233365_3234202_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_003844141.1|3234508_3235087_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	36.5	3.2e-17
WP_003844140.1|3235440_3236343_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.0	5.5e-16
WP_008322661.1|3236660_3236852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032934884.1|3237344_3237935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003844137.1|3238089_3238299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003034928.1|3238557_3238932_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_003034931.1|3238935_3239808_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_003034934.1|3239828_3240167_+	YebY family protein	NA	NA	NA	NA	NA
3240401:3240431	attL	ACAGGAATCGTATTCGGTCTCTTTTTATGTG	NA	NA	NA	NA
WP_137398750.1|3240503_3241589_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.4	3.6e-147
WP_032170291.1|3241557_3241830_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	64.4	1.9e-28
WP_153983742.1|3241893_3242136_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	88.6	1.5e-32
WP_153983868.1|3242175_3243288_-	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	93.2	9.1e-194
WP_153983743.1|3243299_3246062_-	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	67.1	0.0e+00
WP_153983745.1|3246369_3246567_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_039270078.1|3246887_3247103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103285403.1|3247559_3248714_-	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	27.8	1.9e-32
WP_099531231.1|3248735_3249404_-	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	67.8	3.0e-91
WP_099531219.1|3249546_3249756_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	81.2	8.8e-26
WP_099531221.1|3249795_3250335_+	regulator	NA	K7PJT7	Enterobacteria_phage	84.4	2.7e-79
WP_153983869.1|3250519_3251512_+	replication protein	NA	A5VW95	Enterobacteria_phage	75.0	2.7e-48
WP_153983747.1|3251495_3252188_+	phage replication protein	NA	G8C7U6	Escherichia_phage	60.9	1.5e-77
WP_153983748.1|3252199_3252952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983749.1|3252954_3253266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983870.1|3253625_3253850_+	hypothetical protein	NA	B8K1D2	Salmonella_phage	72.4	9.5e-18
WP_153983750.1|3254488_3254764_+	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	84.7	5.8e-33
WP_153983751.1|3254760_3255429_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	71.1	3.2e-53
WP_153983752.1|3255863_3256463_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	95.0	8.0e-104
WP_153983753.1|3256462_3256669_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	69.1	4.5e-22
WP_153983754.1|3256671_3257280_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	62.6	3.5e-46
WP_001568781.1|3257276_3257417_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	95.7	1.2e-18
WP_153983755.1|3257413_3258196_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	74.6	1.1e-108
WP_060683741.1|3258353_3258764_-	hypothetical protein	NA	K7P7K4	Enterobacteria_phage	96.3	3.3e-69
WP_071701194.1|3259113_3259602_+	hypothetical protein	NA	A0A2P0PA94	Pectobacterium_phage	46.4	2.4e-18
WP_016066213.1|3259646_3259925_+|holin	holin	holin	K7PGZ9	Enterobacteria_phage	100.0	6.0e-46
WP_153983756.1|3259896_3260445_+	glycoside hydrolase family protein	NA	K7PM52	Enterobacteria_phage	96.2	2.2e-100
WP_153983757.1|3260423_3260948_+	DUF2514 family protein	NA	A0A291LBG9	Klebsiella_phage	33.8	5.1e-06
WP_136398002.1|3261362_3262037_+	Fur-regulated protein	NA	M9NZE9	Enterobacteria_phage	71.1	9.0e-88
WP_019076560.1|3262157_3262796_+	hypothetical protein	NA	I6S676	Salmonella_phage	87.7	1.0e-109
WP_153983758.1|3262827_3263316_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	77.2	9.2e-50
WP_153983759.1|3263312_3264884_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.5	4.3e-306
WP_153983760.1|3264888_3266292_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	91.3	1.7e-242
WP_153983761.1|3266293_3267400_+	hypothetical protein	NA	G8C7P5	Escherichia_phage	90.5	1.5e-188
WP_153983762.1|3267720_3268473_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	92.0	4.3e-123
WP_016156686.1|3268490_3269630_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	84.0	4.8e-174
WP_128317024.1|3269965_3270448_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	86.9	3.9e-77
WP_115186742.1|3270449_3270803_+	hypothetical protein	NA	G8C7Q0	Escherichia_phage	90.6	1.3e-53
WP_054623473.1|3270805_3271405_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	88.4	2.3e-98
WP_016247123.1|3271394_3271844_+	DUF4128 domain-containing protein	NA	G8C7Q2	Escherichia_phage	89.9	2.3e-71
WP_115186741.1|3271890_3272823_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	91.9	6.3e-156
WP_016247125.1|3272888_3273227_+	hypothetical protein	NA	G8C7Q5	Escherichia_phage	92.9	2.1e-53
WP_025759422.1|3273244_3273532_+	hypothetical protein	NA	I6PD79	Cronobacter_phage	61.5	9.3e-18
WP_153983764.1|3273531_3276687_+|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	72.7	0.0e+00
WP_128317018.1|3276743_3277130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058659081.1|3277217_3277568_+	hypothetical protein	NA	G8C7R0	Escherichia_phage	92.2	4.0e-55
WP_153983765.1|3277564_3278338_+|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	90.2	3.5e-136
WP_153983766.1|3278350_3279082_+	peptidase P60	NA	G8C7R2	Escherichia_phage	89.7	4.2e-139
WP_038641010.1|3279069_3279669_+|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	92.0	2.5e-97
WP_153983767.1|3279724_3282934_+	DUF1983 domain-containing protein	NA	G8C7R4	Escherichia_phage	69.1	0.0e+00
WP_048231682.1|3282933_3283245_+	hypothetical protein	NA	Q5G8V9	Enterobacteria_phage	93.2	1.5e-50
WP_048231685.1|3283244_3283898_+	hypothetical protein	NA	Q5G8V8	Enterobacteria_phage	92.6	2.3e-112
WP_153983739.1|3283960_3285355_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	52.4	3.2e-111
WP_088902117.1|3285488_3285731_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	4.4e-29
WP_121581545.1|3285808_3286228_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.9	2.7e-34
WP_153983768.1|3286229_3287498_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	81.5	1.0e-204
WP_153983871.1|3287490_3288162_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	2.0e-79
WP_003034937.1|3288646_3289288_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.5	8.7e-56
3288468:3288498	attR	ACAGGAATCGTATTCGGTCTCTTTTTATGTG	NA	NA	NA	NA
>prophage 11
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	3431758	3500223	5207876	protease,integrase,capsid,holin,head,tail,portal,terminase	Enterobacteria_phage(61.54%)	79	3422017:3422031	3453768:3453782
3422017:3422031	attL	AGCTTGCTGAAAAGC	NA	NA	NA	NA
WP_003020678.1|3431758_3433768_-	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	45.3	4.2e-64
WP_008322520.1|3434267_3435461_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	84.4	5.1e-203
WP_008322518.1|3435453_3435654_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	82.5	1.9e-25
WP_008322517.1|3435699_3435942_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	82.3	2.6e-29
WP_008322509.1|3435981_3437022_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	75.6	5.9e-155
WP_008322507.1|3437036_3439592_-	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	47.9	1.7e-232
WP_008322503.1|3439904_3440111_-	phage encoded cell division inhibitor protein	NA	K7PM31	Enterobacteria_phage	98.5	9.6e-33
WP_008322501.1|3440429_3440654_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	66.2	5.2e-16
WP_008322489.1|3440853_3441756_-	serine dehydrogenasease	NA	NA	NA	NA	NA
WP_149335231.1|3441949_3442048_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_008322488.1|3442060_3442759_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	79.3	1.0e-102
WP_008322487.1|3442869_3443091_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	67.6	1.1e-21
WP_008322486.1|3443116_3443656_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	86.0	5.0e-81
WP_008322485.1|3443823_3444771_+	phage protein	NA	G9L6A8	Escherichia_phage	30.1	6.4e-23
WP_008322484.1|3444773_3445523_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	86.7	4.8e-122
WP_008322482.1|3445541_3445853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322481.1|3445849_3446659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322480.1|3446655_3447015_+	hypothetical protein	NA	A0A193GYX5	Enterobacter_phage	91.4	1.9e-07
WP_008322479.1|3447016_3447436_+	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	74.1	2.5e-59
WP_008322478.1|3447432_3448083_+	hypothetical protein	NA	K7PGV7	Enterobacterial_phage	50.0	2.9e-06
WP_008322477.1|3448518_3449118_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	96.0	7.7e-107
WP_008322467.1|3449326_3449935_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	63.7	5.3e-47
WP_008322465.1|3449931_3450066_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	100.0	1.4e-13
WP_008322464.1|3450062_3450878_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	96.7	1.1e-140
WP_032934886.1|3451035_3451446_-	hypothetical protein	NA	K7P7K4	Enterobacteria_phage	99.3	2.1e-71
WP_001568784.1|3451696_3451975_+|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
WP_008322460.1|3451946_3452495_+	lysozyme	NA	K7PM52	Enterobacteria_phage	96.2	3.8e-100
WP_032652448.1|3452491_3452998_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_008322456.1|3453685_3454072_+	hypothetical protein	NA	NA	NA	NA	NA
3453768:3453782	attR	AGCTTGCTGAAAAGC	NA	NA	NA	NA
WP_000453624.1|3454542_3455088_+|terminase	terminase small subunit	terminase	E4WL18	Enterobacteria_phage	100.0	1.2e-95
WP_008322455.1|3455062_3456985_+|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	97.5	0.0e+00
WP_003034782.1|3456984_3457191_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	95.5	3.2e-28
WP_003826190.1|3457187_3458780_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	92.1	9.7e-290
WP_008322451.1|3458760_3460086_+	S49 family peptidase	NA	O64320	Escherichia_phage	78.7	4.9e-186
WP_003826193.1|3460095_3460428_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	82.7	5.0e-47
WP_008322450.1|3460495_3461521_+|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	92.4	4.3e-182
WP_008322448.1|3461566_3461971_+	DNA-packaging protein FI	NA	K7PM13	Enterobacteria_phage	52.2	1.4e-22
WP_008322446.1|3461982_3462336_+|tail	tail attachment protein	tail	K7P6U9	Enterobacteria_phage	75.2	2.0e-46
WP_008322445.1|3462345_3462900_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	91.4	8.0e-74
WP_003034811.1|3462896_3463295_+|tail	tail protein	tail	K7P7G5	Enterobacteria_phage	82.6	1.2e-60
WP_008322443.1|3463302_3464040_+|tail	tail protein	tail	O64327	Escherichia_phage	69.4	1.6e-93
WP_008322442.1|3464076_3464484_+|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	60.7	5.9e-26
WP_071524448.1|3464492_3464813_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	69.8	2.7e-34
WP_008322440.1|3464790_3467307_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	70.6	0.0e+00
WP_008322439.1|3467310_3467658_+	hypothetical protein	NA	K7PJT2	Enterobacteria_phage	69.6	2.3e-39
WP_008322437.1|3468411_3469122_+	peptidase P60	NA	K7P6F5	Enterobacteria_phage	94.1	8.2e-140
WP_008322436.1|3469151_3469577_+	hypothetical protein	NA	K7PLY8	Enterobacterial_phage	36.9	6.6e-12
WP_008322435.1|3469632_3470223_+|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	77.9	1.0e-74
WP_008322431.1|3470353_3470599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322430.1|3470762_3473933_+	host specificity protein J	NA	O64335	Escherichia_phage	85.6	0.0e+00
WP_008322429.1|3474178_3474451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322428.1|3474447_3475086_+	hypothetical protein	NA	A0A1X7QGJ8	Escherichia_phage	30.8	6.5e-11
WP_008322427.1|3475158_3476583_+	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	51.1	1.0e-112
WP_008322426.1|3476717_3476960_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	4.4e-29
WP_003826234.1|3477038_3477428_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	1.0e-51
WP_008322424.1|3478111_3478870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322423.1|3479154_3479826_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.5	1.4e-80
WP_003020675.1|3479977_3480274_-	YciI family protein	NA	NA	NA	NA	NA
WP_003020673.1|3480498_3481218_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_003020670.1|3481282_3481684_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_003020667.1|3481849_3482389_-	septation protein A	NA	NA	NA	NA	NA
WP_003020663.1|3482443_3483187_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_003020660.1|3483585_3484239_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_003020658.1|3484807_3485524_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003020655.1|3485596_3486055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003020652.1|3486294_3486570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003020649.1|3486756_3488241_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.8	8.3e-17
WP_003020647.1|3488247_3489054_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_003020645.1|3489053_3490247_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_003020643.1|3490257_3491616_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.0e-37
WP_003020639.1|3491619_3493215_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.6	3.2e-51
WP_003020636.1|3493214_3494777_-	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_071524452.1|3494871_3494934_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_003020630.1|3495051_3495930_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_003020628.1|3495926_3496547_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_003020625.1|3496647_3497523_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_003020622.1|3497606_3498197_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_003020620.1|3498193_3498955_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.7	3.0e-07
WP_032934880.1|3499176_3500223_+|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 12
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	3683696	3745875	5207876	plate,transposase	Escherichia_phage(25.0%)	55	NA	NA
WP_032425611.1|3683696_3684728_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_003020082.1|3685242_3686124_-	aromatic amino acid efflux DMT transporter YddG	NA	NA	NA	NA	NA
WP_085952501.1|3686411_3689459_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_003836226.1|3689472_3690357_+	formate dehydrogenase N subunit beta	NA	NA	NA	NA	NA
WP_003020054.1|3690349_3691006_+	formate dehydrogenase-N subunit gamma	NA	NA	NA	NA	NA
WP_003020048.1|3691135_3691738_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	4.5e-22
WP_003020045.1|3691817_3693533_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	25.7	5.8e-38
WP_003020042.1|3693842_3695540_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003020039.1|3695719_3695860_-	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
WP_003020036.1|3696087_3696519_+	peroxiredoxin OsmC	NA	NA	NA	NA	NA
WP_008322294.1|3696566_3697337_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003020031.1|3697348_3698740_-	GntP family permease	NA	NA	NA	NA	NA
WP_003020028.1|3698780_3699704_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003020025.1|3699693_3700899_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_003020022.1|3700909_3701566_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_003020020.1|3701568_3702276_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_003020016.1|3702418_3703309_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008322292.1|3703328_3704264_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.8	9.2e-14
WP_003020012.1|3704256_3705243_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.5	7.2e-17
WP_003020010.1|3705239_3706136_-	D,D-dipeptide ABC transporter permease	NA	NA	NA	NA	NA
WP_003020008.1|3706132_3707155_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003020006.1|3707199_3708762_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003020004.1|3708777_3709365_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
WP_003020002.1|3709379_3710246_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003019999.1|3710646_3710976_+	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_003019994.1|3711131_3713075_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.8	1.0e-11
WP_003836258.1|3713254_3713569_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003019985.1|3713561_3714833_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_003019982.1|3714887_3715406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003019978.1|3715402_3716770_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_003019974.1|3716782_3717070_-	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_008322283.1|3717204_3718530_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003019965.1|3718532_3720272_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	34.6	4.5e-30
WP_032932590.1|3720282_3725613_-	heme peroxidase	NA	NA	NA	NA	NA
WP_008322281.1|3726238_3727441_-	MFS transporter	NA	NA	NA	NA	NA
WP_003019956.1|3727587_3729054_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_083884615.1|3729211_3729586_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000019450.1|3729699_3730680_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_003019927.1|3731642_3731990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143186488.1|3732235_3732526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071687560.1|3732536_3733058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117255452.1|3733743_3734604_+	DNA-binding protein	NA	I6R977	Salmonella_phage	49.2	6.4e-62
WP_117255451.1|3734618_3735941_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	34.2	7.0e-68
WP_062958097.1|3736425_3736695_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071687562.1|3736697_3736961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071687563.1|3736947_3737307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071687565.1|3737503_3737689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983773.1|3737748_3738024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019450.1|3738959_3739940_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_071687568.1|3740533_3740791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008324315.1|3741869_3742823_+	hypothetical protein	NA	A0A1D8EQC7	Escherichia_phage	27.0	1.0e-07
WP_008324316.1|3742819_3743530_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_008324317.1|3743539_3743917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008324318.1|3744131_3744482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008324319.1|3744465_3745875_+|plate	baseplate component	plate	A0A2D0YGH8	Vibrio_phage	23.4	1.6e-17
>prophage 13
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	3812096	3819217	5207876	transposase	Stx2-converting_phage(33.33%)	6	NA	NA
WP_001000409.1|3812096_3813632_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_000609174.1|3813681_3814029_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|3814025_3814409_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_100216202.1|3814801_3815970_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
WP_008324000.1|3817422_3818589_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	46.3	1.4e-83
WP_003028915.1|3818599_3819217_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	5.6e-76
>prophage 14
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	3995097	4005135	5207876	tRNA	Cedratvirus(14.29%)	10	NA	NA
WP_003030561.1|3995097_3995877_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.3	1.2e-11
WP_008323845.1|3995873_3997316_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	5.9e-52
WP_003030564.1|3997377_3998091_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003030566.1|3998407_3998872_-	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	2.7e-14
WP_003030567.1|3998949_3999699_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_003030569.1|3999698_4000250_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003030570.1|4000310_4001291_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	1.5e-14
WP_003030571.1|4001444_4001744_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_008323842.1|4001748_4004136_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003030576.1|4004151_4005135_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
>prophage 15
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	4099060	4104640	5207876		uncultured_Caudovirales_phage(57.14%)	8	NA	NA
WP_003030760.1|4099060_4099486_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
WP_003030761.1|4099498_4100788_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	1.2e-165
WP_003030762.1|4100832_4101153_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
WP_008320415.1|4101238_4101937_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	3.8e-89
WP_008320414.1|4102013_4102247_-	DNA polymerase V subunit	NA	A0A222YZE2	Escherichia_phage	78.8	4.3e-21
WP_003030766.1|4102326_4102527_+	DinI-like family protein	NA	Q6UAW0	Klebsiella_phage	77.3	7.9e-24
WP_003030767.1|4102743_4103253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003030769.1|4103389_4104640_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	9.4e-22
>prophage 16
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	4295900	4339074	5207876	protease,integrase,plate,holin,tail,terminase	Escherichia_phage(40.0%)	52	4294682:4294741	4336217:4336344
4294682:4294741	attL	ATATTCTTTCTTTATTCTTCTGCTCAAAAAACAAAGGGGTCAGCATTTAGCTAACCCCTT	NA	NA	NA	NA
WP_153983786.1|4295900_4296269_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_153983787.1|4297545_4297803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983788.1|4297838_4298543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110498441.1|4298544_4299963_-|plate	baseplate J-like family protein	plate	A0A0U2RJZ0	Escherichia_phage	45.3	1.2e-54
WP_003833581.1|4299959_4300292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088760183.1|4300288_4301005_-	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	30.8	7.0e-22
WP_110498442.1|4301001_4302042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110498443.1|4302041_4302317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983789.1|4302313_4303024_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	38.1	5.3e-30
WP_110498445.1|4303023_4304850_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	41.9	4.9e-19
WP_110498446.1|4304973_4305549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983790.1|4305551_4305989_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	38.9	7.0e-25
WP_131445529.1|4305990_4307385_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	38.3	6.5e-72
WP_110498448.1|4307390_4308329_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	39.2	2.2e-52
WP_131445535.1|4308312_4308744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110498450.1|4308740_4309166_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	43.3	3.6e-26
WP_110498451.1|4309174_4309663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131445541.1|4309728_4310760_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	46.5	5.1e-74
WP_110498452.1|4310777_4311650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131445543.1|4311670_4313245_-	NUDIX domain-containing protein	NA	Q6UJ14	Burkholderia_virus	49.5	1.7e-20
WP_153983791.1|4313245_4314121_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	43.9	1.1e-53
WP_153983792.1|4314092_4315532_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	38.0	1.3e-91
WP_153983793.1|4315531_4316803_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.8	4.6e-85
WP_148977527.1|4316792_4317764_-|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	33.5	1.3e-23
WP_153983794.1|4317825_4318236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131445557.1|4318225_4318771_-	DUF2514 domain-containing protein	NA	A0A291AXG6	Shigella_phage	28.7	1.3e-07
WP_110498460.1|4318773_4319190_-	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	58.6	1.4e-43
WP_001648823.1|4319192_4319546_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.7	1.7e-53
WP_115643621.1|4319991_4320570_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	51.4	1.2e-43
WP_148977525.1|4320566_4320860_-	DUF1364 family protein	NA	A0A0U2KD41	Escherichia_phage	63.2	2.3e-32
WP_045441382.1|4320856_4321453_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	74.7	1.7e-82
WP_131445566.1|4321902_4322241_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.1	8.6e-47
WP_131445569.1|4322240_4324313_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	54.2	9.6e-205
WP_131445573.1|4324309_4324582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131445576.1|4324578_4325712_-	site-specific DNA-methyltransferase	NA	A0A060D598	Salmonella_phage	50.4	3.9e-99
WP_131445594.1|4325708_4325960_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	52.8	5.1e-12
WP_048241297.1|4325985_4326234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131445579.1|4326237_4326918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983795.1|4326956_4328345_-	replicative DNA helicase	NA	Q8HA30	Enterobacteria_phage	47.5	9.5e-108
WP_046595084.1|4328341_4329325_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	79.6	1.2e-43
WP_001648809.1|4329327_4329552_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	46.1	4.7e-09
WP_016152513.1|4329574_4330021_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.1	3.2e-25
WP_050186203.1|4330085_4330289_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	49.2	8.0e-08
WP_050186201.1|4330367_4330769_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	54.9	2.5e-37
WP_001648806.1|4331338_4331662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153983796.1|4331707_4333981_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.5	2.9e-106
WP_001648803.1|4333980_4334535_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	6.1e-50
WP_016152506.1|4334537_4334720_+	hypothetical protein	NA	H9C155	Pectobacterium_phage	51.7	2.2e-09
WP_001648801.1|4334932_4335157_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_110498477.1|4335157_4336177_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.1	7.5e-94
WP_003035920.1|4336514_4338143_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
4336217:4336344	attR	ATATTCTTTCTTTATTCTTCTGCTCAAAAAACAAAGGGGTCAGCATTTAGCTAACCCCTTGTTAAATTTGGCGGAAGCGTAGAGATTCGAACTCTAGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_003035917.1|4338414_4339074_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	8.9e-48
>prophage 17
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	4373812	4475064	5207876	integrase,terminase,capsid,head,tail,tRNA,portal,transposase	Cronobacter_phage(30.19%)	88	4369182:4369201	4472343:4472362
4369182:4369201	attL	TGCTGCTGCTGGATGAACCC	NA	NA	NA	NA
WP_003035832.1|4373812_4375213_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	5.0e-80
WP_117255451.1|4375875_4377198_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	34.2	7.0e-68
WP_117255452.1|4377212_4378073_-	DNA-binding protein	NA	I6R977	Salmonella_phage	49.2	6.4e-62
WP_015059991.1|4379117_4379915_-	carbapenem-hydrolyzing class D beta-lactamase OXA-48	NA	NA	NA	NA	NA
WP_025987686.1|4380827_4382033_+|transposase	IS4 family transposase	transposase	Q9E8P4	Bluetongue_virus	72.0	9.9e-170
WP_004187429.1|4382364_4382622_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_020277900.1|4382590_4382956_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_004187425.1|4383048_4383483_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.3	1.2e-29
WP_015059993.1|4383431_4384736_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	50.1	7.8e-112
WP_004187413.1|4384858_4385068_-	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	42.0	7.0e-07
WP_004187411.1|4385070_4385289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117255451.1|4385541_4386864_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	34.2	7.0e-68
WP_117255452.1|4386878_4387739_-	DNA-binding protein	NA	I6R977	Salmonella_phage	49.2	6.4e-62
WP_003035828.1|4388107_4389196_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.4	4.8e-99
WP_003035825.1|4389379_4390570_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_003035823.1|4390623_4391271_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003035820.1|4391299_4391848_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	3.5e-05
WP_008320228.1|4392025_4393777_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003035811.1|4394036_4398497_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_003035809.1|4398496_4399201_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_003035806.1|4399181_4400504_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_003035803.1|4400496_4401300_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_003035801.1|4401435_4402212_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_003035798.1|4402188_4403082_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_003035796.1|4403246_4403993_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003035793.1|4403989_4404172_-	protein YcaR	NA	NA	NA	NA	NA
WP_003035790.1|4404223_4405456_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003035787.1|4405497_4406475_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_003035784.1|4406471_4408220_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	2.4e-60
WP_003035783.1|4408256_4410521_-	ComEC family protein	NA	NA	NA	NA	NA
WP_003035780.1|4410727_4411012_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	39.1	9.2e-10
WP_003035776.1|4411171_4412845_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_003035772.1|4412958_4413642_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_153983834.1|4413813_4415097_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003035766.1|4415166_4416255_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.0	6.6e-80
WP_003035760.1|4416467_4417160_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_003035758.1|4417296_4419057_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_003035756.1|4419461_4420319_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_003035753.1|4420378_4422661_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	3.8e-162
WP_153983835.1|4423148_4424387_+	acyltransferase family protein	NA	A0A088CPR9	Enterobacteria_phage	28.8	7.3e-27
WP_153983836.1|4425524_4427222_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	58.9	1.4e-169
WP_048231835.1|4427221_4427731_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	48.5	1.9e-34
WP_048231758.1|4427777_4428476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048231836.1|4428507_4428882_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_153983837.1|4428896_4430546_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	61.7	1.7e-100
WP_048231759.1|4430566_4431100_-	protein phage	NA	F1BUK5	Cronobacter_phage	65.4	3.8e-65
WP_153983880.1|4431092_4432277_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	70.3	1.0e-158
WP_048231761.1|4432254_4432599_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.3	3.2e-33
WP_048231763.1|4432595_4434515_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	38.9	2.7e-113
WP_048231765.1|4434702_4434972_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	57.6	4.5e-22
WP_153983838.1|4435073_4435451_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	53.8	8.8e-24
WP_153983839.1|4435447_4435957_-	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	80.8	3.9e-75
WP_048231769.1|4435940_4436162_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.8	3.6e-09
WP_048231771.1|4436164_4436623_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	60.5	4.9e-45
WP_153983840.1|4436622_4438146_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	58.3	7.2e-109
WP_153983841.1|4438148_4438856_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	63.6	3.2e-75
WP_153983842.1|4438828_4439335_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.0	2.1e-36
WP_153983843.1|4439331_4439784_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	49.7	2.1e-32
WP_153983844.1|4439880_4440582_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	47.3	8.3e-52
WP_153983845.1|4440590_4441637_-|capsid	phage major capsid protein, P2 family	capsid	Q94MZ4	Haemophilus_virus	43.7	5.4e-71
WP_153983846.1|4441646_4442510_-|capsid	phage capsid protein	capsid	A5X9H4	Aeromonas_virus	37.0	3.3e-34
WP_153983847.1|4442691_4444473_+|terminase	terminase	terminase	A5X9H3	Aeromonas_virus	57.7	7.2e-201
WP_153983848.1|4444469_4445498_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	50.7	1.5e-102
WP_153983881.1|4445555_4445825_+	hypothetical protein	NA	F1BUM8	Cronobacter_phage	46.9	5.1e-18
WP_153983849.1|4445868_4446234_-	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	55.8	3.4e-33
WP_153983850.1|4446236_4446431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983851.1|4446433_4449097_-	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	46.8	1.6e-233
WP_153983852.1|4449357_4449918_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	34.4	6.5e-23
WP_153983853.1|4449927_4450263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983882.1|4450282_4450606_-	hypothetical protein	NA	Q1JS26	Enterobacteria_phage	65.3	5.9e-29
WP_153983854.1|4450742_4451042_+	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	82.8	6.7e-43
WP_153983855.1|4451135_4452131_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	79.8	5.7e-155
WP_048231800.1|4452162_4452960_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	7.8e-22
WP_003035749.1|4453003_4454425_-	amino acid permease	NA	NA	NA	NA	NA
WP_003035748.1|4454638_4455787_-	MFS transporter	NA	NA	NA	NA	NA
WP_003035746.1|4456172_4456799_+	hydrolase	NA	NA	NA	NA	NA
WP_003035744.1|4456908_4457772_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_003035741.1|4457773_4458391_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	2.8e-75
WP_003035739.1|4458401_4460846_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.7	3.5e-222
WP_003035737.1|4461082_4462375_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.1	3.3e-94
WP_003035735.1|4462467_4463811_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	1.3e-80
WP_008320214.1|4463821_4464433_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_153983856.1|4464544_4468567_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.9e-88
WP_002439523.1|4468701_4469196_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_008320202.1|4469743_4470712_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	1.9e-62
WP_003035725.1|4470826_4472593_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.6	1.8e-23
4472343:4472362	attR	TGCTGCTGCTGGATGAACCC	NA	NA	NA	NA
WP_003035722.1|4472593_4474315_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.6	1.4e-15
WP_003035721.1|4474359_4475064_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 18
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	5094061	5143361	5207876	transposase,protease,capsid,integrase	Stx2-converting_phage(33.33%)	41	5096767:5096784	5139254:5139271
WP_003838722.1|5094061_5094643_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_008321015.1|5094648_5095053_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_008321017.1|5095049_5095907_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_008321019.1|5095995_5097540_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
5096767:5096784	attL	GGCGAATGGCAAACCGAA	NA	NA	NA	NA
WP_008321021.1|5097551_5098688_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003838732.1|5098701_5098791_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_008321024.1|5098843_5099557_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008321026.1|5099749_5101219_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_003838738.1|5101342_5101792_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008321029.1|5101959_5102964_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.4e-23
WP_003838742.1|5103117_5104569_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_003838744.1|5104581_5105763_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_008321031.1|5105928_5107407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321033.1|5107934_5109137_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_008321035.1|5109257_5109458_-	glycogen synthase	NA	NA	NA	NA	NA
WP_008321037.1|5109687_5109897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321040.1|5110029_5111064_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_008321041.1|5111079_5111421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321043.1|5111989_5114149_-	hypothetical protein	NA	A0A2H4YH07	Raoultella_phage	36.2	6.6e-07
WP_008321044.1|5114197_5114593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321046.1|5114749_5115235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321048.1|5115248_5116166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321052.1|5116440_5116884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321055.1|5118923_5119484_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SCL7	Streptococcus_phage	34.6	1.8e-17
WP_008321059.1|5120164_5120557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008321061.1|5121321_5122641_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	27.7	4.5e-06
WP_008321066.1|5123521_5124286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008321072.1|5124747_5125368_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_003029581.1|5125423_5126080_-	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	82.1	6.2e-09
WP_003029582.1|5126108_5126417_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_077258089.1|5126926_5127097_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003029584.1|5127325_5128249_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_003029587.1|5128414_5129932_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000345204.1|5130069_5131440_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_003029589.1|5131439_5132840_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.1	2.0e-20
WP_003029591.1|5132869_5133874_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_008321087.1|5137416_5138877_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001548946.1|5138877_5140899_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
5139254:5139271	attR	TTCGGTTTGCCATTCGCC	NA	NA	NA	NA
WP_001201739.1|5141048_5141432_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000609174.1|5141428_5141776_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001000409.1|5141825_5143361_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
>prophage 19
NZ_CP038656	Citrobacter freundii strain 565 chromosome, complete genome	5207876	5166762	5207816	5207876	integrase,plate,capsid,holin,tail	Salmonella_phage(48.21%)	62	5166531:5166576	5207831:5207876
5166531:5166576	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_061549414.1|5166762_5167308_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	87.2	3.1e-86
WP_153983797.1|5167383_5167752_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_153983798.1|5167761_5168883_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	61.5	1.2e-60
WP_061549416.1|5168882_5169563_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	81.4	2.5e-109
WP_153983799.1|5169559_5170759_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	82.7	1.8e-179
WP_016239889.1|5170759_5171113_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	76.1	1.1e-44
WP_048219596.1|5171112_5171853_-|plate	phage baseplate assembly protein V	plate	A0A0M5M1K7	Salmonella_phage	62.0	2.6e-72
WP_061549418.1|5171918_5172641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061549419.1|5172648_5173713_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	67.1	7.2e-140
WP_001160174.1|5173715_5174021_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	53.5	9.2e-24
WP_153983800.1|5174022_5174625_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	70.1	5.6e-65
WP_153983801.1|5174624_5176628_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	55.1	1.3e-193
WP_112899804.1|5176805_5177231_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	56.7	3.5e-37
WP_000257257.1|5177234_5177675_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	77.4	7.5e-59
WP_153983802.1|5177685_5178846_-	DUF3383 family protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	5.4e-157
WP_153983875.1|5178849_5179413_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.1	3.8e-79
WP_001515083.1|5179387_5179777_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	2.7e-68
WP_147679414.1|5179763_5180351_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	76.9	7.6e-75
WP_153983803.1|5180347_5180755_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.0	2.1e-71
WP_001040703.1|5180720_5181110_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	57.4	6.5e-30
WP_153983804.1|5181151_5182093_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	97.4	9.4e-176
WP_032177172.1|5182104_5182608_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	84.4	3.2e-74
WP_153983805.1|5182612_5183845_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	93.7	5.3e-219
WP_153983876.1|5183859_5184597_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	95.5	1.3e-108
WP_153983806.1|5184481_5185951_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	95.1	1.5e-268
WP_048219616.1|5185950_5187573_-	bacteriophage TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	4.5e-311
WP_153983807.1|5187575_5188049_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	68.0	3.6e-51
WP_001081498.1|5188080_5188701_-	hypothetical protein	NA	I6S676	Salmonella_phage	73.2	4.4e-89
WP_029403918.1|5188755_5188941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048219618.1|5189084_5189477_-	hypothetical protein	NA	A0A192Y6H8	Salmonella_phage	75.0	1.7e-46
WP_153983808.1|5189473_5190088_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	90.1	1.4e-98
WP_048219622.1|5190090_5190438_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	82.4	3.0e-47
WP_082138498.1|5190695_5191379_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	44.1	4.9e-41
WP_045354712.1|5191375_5191738_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	65.5	2.7e-38
WP_052674422.1|5191728_5192211_-	AsnC family protein	NA	A0A068CBG2	Acinetobacter_phage	51.5	5.2e-37
WP_044702921.1|5192207_5192507_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	88.0	5.1e-43
WP_061549425.1|5192496_5192949_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	53.1	3.4e-38
WP_061549426.1|5193189_5193528_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	85.7	4.9e-50
WP_061549427.1|5193520_5193922_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	75.0	1.5e-45
WP_082805395.1|5193914_5194601_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	85.4	9.6e-45
WP_061549428.1|5194602_5195298_-	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	32.3	5.0e-25
WP_153983809.1|5195294_5195462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048219627.1|5195458_5195749_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	65.2	1.8e-29
WP_153983810.1|5195748_5197146_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	63.8	3.3e-169
WP_108961704.1|5197142_5197955_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	45.0	7.9e-54
WP_000426372.1|5198423_5198744_-	hypothetical protein	NA	H6WRX6	Salmonella_phage	88.7	2.9e-44
WP_108961705.1|5198781_5199009_-	transcriptional regulator	NA	K7P6H5	Enterobacteria_phage	69.0	1.9e-18
WP_108961706.1|5199129_5199843_+	helix-turn-helix domain-containing protein	NA	M9NZE3	Enterobacteria_phage	83.1	1.7e-113
WP_061549435.1|5199854_5200283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061549442.1|5200396_5200606_+	hypothetical protein	NA	C6ZR45	Salmonella_phage	60.9	4.2e-12
WP_108961707.1|5200627_5200825_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	53.1	1.3e-10
WP_000501155.1|5201241_5201439_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_153983811.1|5201449_5201722_+	hypothetical protein	NA	S4TU79	Salmonella_phage	61.1	2.7e-27
WP_109863254.1|5201761_5202352_+	hypothetical protein	NA	A0A291AXG3	Shigella_phage	31.7	1.0e-10
WP_044702471.1|5202582_5203023_+	hypothetical protein	NA	Q6WYF0	Enterobacteria_phage	46.7	1.3e-26
WP_044702473.1|5203015_5203702_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	36.6	3.6e-15
WP_016243544.1|5203698_5204370_+	AAA family ATPase	NA	G9L667	Escherichia_phage	46.6	8.8e-51
WP_045399452.1|5204386_5205073_+	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	40.8	2.0e-26
WP_021571176.1|5205084_5205243_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	56.9	3.3e-09
WP_031275321.1|5205293_5206145_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	84.3	3.2e-138
WP_031275320.1|5206147_5206387_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	87.3	1.2e-31
WP_021242885.1|5206652_5207816_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	67.2	2.1e-153
5207831:5207876	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
>prophage 1
NZ_CP038657	Citrobacter freundii strain 565 plasmid p565_1, complete sequence	263189	204371	256952	263189	integrase,transposase	Escherichia_phage(39.13%)	52	241994:242053	258966:260986
WP_119505882.1|204371_205286_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.7	9.5e-173
WP_000900745.1|205451_205769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371904.1|205819_206227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000285959.1|206684_207356_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_001100610.1|207400_207706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785965.1|207728_208046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611902.1|208267_209614_+|transposase	ISNCY-like element ISLad2 family transposase	transposase	NA	NA	NA	NA
WP_000589340.1|209672_210476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000482601.1|210489_211851_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_016239970.1|212003_212444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239971.1|212461_213268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044704760.1|213562_214966_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000130816.1|214998_215703_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000941305.1|215789_216110_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000922628.1|216155_217445_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000065802.1|217457_217883_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_001066652.1|217942_218770_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000927306.1|218788_220267_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_000864986.1|220758_221034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371914.1|221174_221372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000637193.1|222358_222616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005009.1|222689_223004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975181.1|223051_223948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031942328.1|223950_224466_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833382.1|224680_226108_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000078514.1|226358_227678_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_001572381.1|227957_229163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044704764.1|229159_229978_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000019951.1|230443_230716_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001572377.1|230838_231954_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000723070.1|232211_232646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004248839.1|232863_234210_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
WP_074129341.1|234248_235217_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	1.5e-184
WP_044704969.1|235405_237028_+	MCR-9 family phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_044704902.1|239118_239370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153983901.1|239476_239647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024266332.1|239931_240561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032489926.1|241024_241900_-	class A extended-spectrum beta-lactamase CTX-M-9	NA	A0A1B0VBP7	Salmonella_phage	99.3	2.3e-152
241994:242053	attL	CGGGTATAGGAAGTATAAACCACCTTTTTGCTCCTCATCCGAAGTATCTTACCTGAAATT	NA	NA	NA	NA
WP_000050481.1|242226_243768_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|244172_245012_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|245005_245353_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|245516_246308_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_032490158.1|246412_246886_-	trimethoprim-resistant dihydrofolate reductase DfrA16	NA	G3MBI7	Bacillus_virus	30.8	1.4e-18
WP_015057121.1|247041_248001_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|247891_248596_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011152976.1|248772_249432_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	99.1	4.2e-130
WP_001067855.1|249653_250358_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|250966_251671_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002903955.1|253304_254207_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|254468_255230_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|255250_256111_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|256247_256952_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
258966:260986	attR	AATTTCAGGTAAGATACTTCGGATGAGGAGCAAAAAGGTGGTTTATACTTCCTATACCCGTTAGCACCCTCCCTGATTAAAGGAAGCCGTATGGATATTATTGATAAAGTTTTTCAGCAAGAGGATTTCTCACGCCAGGATTTGAGTGACAGCCGTTTTCGCCGCTGCCGCTTTTATCAGTGTGACTTCAGCCACTGTCAGCTGCAGGATGCCAGTTTCGAGGATTGCAGTTTCATTGAAAGCGGCGCCGTTGAAGGGTGTCACTTCAGCTATGCCGATCTGCGCGATGCCAGTTTCAAGGCCTGCCGTCTGTCTTTGGCCAACTTCAGCGGTGCCAACTGCTTTGGCATAGAGTTCAGGGAGTGCGATCTCAAGGGCGCCAACTTTTCCCGGGCCCGCTTCTACAATCAAGTCAGCCATAAGATGTACTTCTGCTCGGCTTATATCTCAGGTTGCAACCTGGCCTATACCAACTTGAGTGGCCAATGCCTGGAAAAATGCGAGCTGTTTGAAAACAACTGGAGCAATGCCAATCTCAGCGGCGCTTCCTTGATGGGCTCAGATCTCAGCCGCGGCACCTTCTCCCGCGACTGTTGGCAACAGGTCAATCTGCGGGGCTGTGACCTGACCTTTGCCGATCTGGATGGGCTCGACCCCAGACGGGTCAACCTCGAAGGAGTCAAGATCTGTGCCTGGCAACAGGAGCAACTGCTGGAACCCTTGGGAGTAATAGTGCTGCCGGATTAGCTCGAATGCAAACACAAGAGGCAAATATCACTTGAGTTCCGCGCTACAACAAGGCAGATTCTGCTATAGCAGAGTATTACCGCCGGAATGCCGTTTCTCTGCTGCCGCAGCCGACGTTATACCTTCCCTTCAAAGGAGGCATTATGAAGACTCAACTGCCCTAAAGAAAAACTTACAGGTGGATTATGGTCAGACGTTATCTCCCCCTTAACCCGCTGCGCGCCTTTGAGGCCGCCGCCCGTCATCTCAGTTTTACCCGCGCGGCGATTGAGCTGAATGTCACCCATGCCGCCGTCAGCCAGCAGGTCAGGGCGCTGGAAGAACAACTCGGCTGTGTGCTGTTTACCCGCGTCTCGCGCGGGCTGGTGCTGACCCATGAAGGTGAGGGATTACTGCCGGTGCTCAATGAGGCGTTTGACCGGATTGCGGATACTCTGGAGTGTTTTTCTCACGGGCAGTTCCGTGAGCGGGTGAAAGTCGGTGCGGTGGGAACATTTGCCGCAGGCTGGCTGCTGCCGCGTCTGGCCGGATTCTATGACAGCCATCCGCATATTGATCTGCATATCTCCACCCATAACAATCATGTGGACCCGGCGGCGGAAGGGCATGATTATACGATCCGTTTCGGTAACGGCGCGTGGCATGAGTCAGATGCGGAACTGATTTTCAGTGCACCACACGCTCCGCTGTGCTCACCGGCCATTGCAGAACAGTTACAGCAGCCGGATGATGTTCACCGCTTTACCCTGCTGCGCTCATTCCGCCGGGATGAATGGAGCCGCTGGCTGGATTGTGCGGGCGGCACACCGCCTTCCCCGTCACAGCCGGTAATGGTGTTCGATACCTCACTGGCCATGGCCGAGGCGGCACAACTGGGTGCCGGGGTAGCGATCGCACCGGTATGTATGTTCAGCCGCCTGTTACAGTCAGGCGCACTGGTACAGCCGTTTGCCGCAGAAATCACCCTCGGCGGCTACTGGCTGACGCGGTTACAGTCCCGTACGGAAACCCCGGCCATGCAGCAATTCGCCCGCTGGCTGCTGAATACGGCGGCGGCGTAAAACTCACTCACCTTCCAGGCTTTTTACCCGCAAATCATCACCTTCACTGATGCGCAGCCGTTCACTGCCGCAGTGCGGACAGCATCCGGCGTGCTGCATGATTTCGGCCTCACGGCTGCAATCCCAGCACCATGCCTGTGCCGGGATAACATCAATATGCAGTGTGCAGCCCTGCGCCACGGTATCACGGCAGGCGATATCAAAACAGAAATG	NA	NA	NA	NA
