The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045814	Bacillus licheniformis strain P8_B2 chromosome, complete genome	4343379	157986	225428	4343379	terminase,capsid,holin,portal,integrase,plate,tRNA,tail	Bacillus_phage(34.78%)	80	163211:163226	199989:200004
WP_017474561.1|157986_158730_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003178393.1|158890_159328_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003178395.1|159348_159741_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_009330341.1|159791_160250_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_003178399.1|160361_160805_+	YbaK family protein	NA	NA	NA	NA	NA
WP_003178401.1|160897_161611_+	N-acetylmuramoyl-L-alanine amidase CwlD	NA	A0A0N9SGH1	Paenibacillus_phage	31.4	5.9e-13
WP_003178403.1|161696_162758_+	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_003178405.1|162811_163393_-	hypothetical protein	NA	NA	NA	NA	NA
163211:163226	attL	ATTTAATTTGTCATCA	NA	NA	NA	NA
WP_003178407.1|163507_164107_+	kinB signaling pathway activation protein KbaA	NA	NA	NA	NA	NA
WP_003178409.1|164115_164880_-	polysaccharide deacetylase family sporulation protein PdaB	NA	NA	NA	NA	NA
WP_061578214.1|170419_171568_-|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	31.0	2.0e-50
WP_081112692.1|171564_172155_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	46.6	2.3e-34
WP_061578216.1|172159_172759_-	hypothetical protein	NA	O64079	Bacillus_phage	36.2	1.6e-19
WP_081112693.1|172859_173222_-	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	50.8	1.1e-10
WP_061578218.1|173373_173607_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061578219.1|173637_173853_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_061578220.1|173931_174450_+	helix-turn-helix transcriptional regulator	NA	A0A290FZK9	Caldibacillus_phage	47.6	7.3e-37
WP_128474778.1|174446_174713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474943.1|174713_174902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061578222.1|175037_175232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061578223.1|175244_175460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061578224.1|175565_175754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061578225.1|175750_177739_+	hypothetical protein	NA	A0A1L2K2K3	Aeribacillus_phage	46.2	7.1e-149
WP_061578227.1|177978_178845_+	recombinase RecT	NA	D7RWF9	Brochothrix_phage	61.3	7.5e-87
WP_061578228.1|178841_179543_+	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	69.1	4.2e-96
WP_061578230.1|179744_180545_+	hypothetical protein	NA	I1W658	Staphylococcus_phage	38.6	6.2e-19
WP_017474951.1|180547_180829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075178027.1|180803_182108_+	replicative DNA helicase	NA	D2XR44	Bacillus_phage	42.7	4.8e-93
WP_075178301.1|182140_182320_+	Fur-regulated basic protein FbpA	NA	A0A1L2JY24	Aeribacillus_phage	49.0	8.7e-06
WP_075178028.1|182427_182688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061578243.1|182824_183283_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	70.5	2.6e-54
WP_081375159.1|183294_183750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061578236.1|183903_184110_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	63.2	2.9e-13
WP_061578237.1|184282_184927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064505123.1|184961_186071_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	33.1	2.4e-53
WP_061578239.1|186158_186542_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	58.7	6.8e-32
WP_128474780.1|186723_187827_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	31.9	8.8e-48
WP_075178030.1|188105_189992_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	23.5	9.8e-31
WP_065643576.1|190010_190475_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_075178031.1|191210_192701_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_075178032.1|192855_193725_+|terminase	terminase	terminase	D2IYW0	Enterococcus_phage	43.3	1.1e-37
WP_128474785.1|193721_195017_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	63.9	1.2e-160
WP_075178034.1|195020_196559_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.1	7.0e-144
WP_075178035.1|196551_197421_+	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	40.1	4.8e-49
WP_075178036.1|197541_198354_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_075178037.1|198374_199031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075178038.1|199074_200250_+|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	53.1	2.4e-83
199989:200004	attR	TGATGACAAATTAAAT	NA	NA	NA	NA
WP_075178039.1|200262_201198_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	63.8	8.6e-105
WP_075178040.1|201208_201622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075178041.1|201628_202024_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	41.1	2.2e-17
WP_075178042.1|202020_202377_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_075178043.1|202373_202871_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.2	5.2e-40
WP_081375160.1|202860_203325_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_075178044.1|203325_203553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044822157.1|203553_204954_+|portal	phage portal protein	portal	A0A0A7RTT5	Clostridium_phage	41.8	5.7e-84
WP_075178045.1|204955_205399_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	44.1	4.2e-25
WP_075178046.1|205790_206240_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	31.2	1.1e-09
WP_085959894.1|206269_206419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075178047.1|206422_211687_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	41.8	4.1e-50
WP_061578247.1|211679_212339_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	33.3	1.6e-25
WP_153915700.1|212360_213344_+|portal	phage portal protein	portal	A0A1L6BY20	Clostridium_phage	33.2	1.3e-37
WP_043929393.1|213340_213649_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	34.3	2.0e-05
WP_075178049.1|213661_214087_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	43.4	1.0e-12
WP_075178050.1|214079_215123_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	7.5e-73
WP_075178051.1|215109_215688_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	29.6	2.3e-15
WP_075178052.1|215684_215960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075178053.1|215960_217064_+	hypothetical protein	NA	M4ZRP1	Bacillus_phage	65.9	1.5e-18
WP_075178054.1|217075_217405_+|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	39.4	3.0e-12
WP_075178055.1|217401_217584_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	57.4	6.3e-12
WP_075178056.1|217685_218519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474918.1|218601_218871_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	61.8	1.6e-24
WP_061578522.1|218886_219150_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	74.7	8.8e-31
WP_128474787.1|219201_220281_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	51.1	1.1e-42
WP_153915703.1|220288_220435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128474789.1|220702_220876_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	90.9	6.8e-24
WP_061577993.1|220923_221733_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	61.0	1.7e-96
WP_061577992.1|222342_223155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061577995.1|223213_223534_-	YolD-like family protein	NA	O64030	Bacillus_phage	35.9	1.0e-12
WP_017474059.1|223997_224165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003178412.1|224258_225428_-	serine hydrolase	NA	A0A2R4AS58	Mycobacterium_phage	24.6	2.9e-09
>prophage 2
NZ_CP045814	Bacillus licheniformis strain P8_B2 chromosome, complete genome	4343379	756348	766272	4343379		Synechococcus_phage(50.0%)	9	NA	NA
WP_003179530.1|756348_757644_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.1	5.9e-19
WP_061576038.1|757718_758435_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	42.4	2.4e-46
WP_003179532.1|758436_758691_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	8.0e-05
WP_003179533.1|758687_759371_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_153915732.1|759354_761583_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.5	2.5e-158
WP_003179536.1|761558_762989_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	4.5e-52
WP_011197613.1|763112_764153_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
WP_003179538.1|764149_764737_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.1	1.4e-28
WP_003179539.1|764733_766272_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.0	4.3e-77
>prophage 3
NZ_CP045814	Bacillus licheniformis strain P8_B2 chromosome, complete genome	4343379	1323989	1396042	4343379	coat,terminase,transposase,holin,portal,plate,tail	Bacillus_phage(25.0%)	88	NA	NA
WP_009328811.1|1323989_1324439_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197778.1|1324589_1325078_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328809.1|1325209_1325722_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328808.1|1325792_1326191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328807.1|1326239_1326626_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197779.1|1326772_1327129_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_009328806.1|1327415_1327625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197781.1|1327704_1327836_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_009328805.1|1327965_1328223_+	sporulation protein	NA	NA	NA	NA	NA
WP_153915745.1|1328261_1330544_-	AAA family ATPase	NA	A0A068EQC7	Bacillus_phage	35.4	3.0e-90
WP_016885900.1|1330665_1330923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328801.1|1330962_1331550_-	DedA family protein	NA	NA	NA	NA	NA
WP_011197784.1|1331645_1332632_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	1.6e-53
WP_009328799.1|1332628_1333519_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	55.6	1.2e-84
WP_011197785.1|1333541_1333937_-	GtrA family protein	NA	NA	NA	NA	NA
WP_009328797.1|1334101_1334521_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009328796.1|1334530_1335040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328793.1|1335104_1335827_-	esterase family protein	NA	NA	NA	NA	NA
WP_011197786.1|1335817_1336150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197787.1|1336343_1336832_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_009328787.1|1336912_1337860_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328785.1|1338168_1339293_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	25.6	5.3e-16
WP_009328782.1|1339282_1340458_+	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	29.3	6.7e-22
WP_011197789.1|1340503_1341694_-	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_011197790.1|1341867_1342437_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328774.1|1342426_1342711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474216.1|1342886_1344260_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	23.9	3.8e-08
WP_009328769.1|1344564_1345551_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_016885898.1|1346152_1346236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061565996.1|1346674_1346854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474214.1|1346887_1347466_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_017474213.1|1347552_1347840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474212.1|1348047_1348938_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011197796.1|1349258_1351088_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_003180762.1|1351115_1352834_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_085959889.1|1352906_1354069_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.2	1.5e-34
WP_003180765.1|1354180_1355068_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180767.1|1355159_1356032_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003180768.1|1356079_1356457_+	glyoxalase	NA	NA	NA	NA	NA
WP_009328757.1|1356500_1357049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180772.1|1357501_1358236_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	60.8	4.2e-30
WP_011197798.1|1358291_1359716_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	24.6	5.1e-16
WP_003180775.1|1359731_1360310_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180778.1|1360322_1360658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180779.1|1360686_1361100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180781.1|1361474_1361957_-	DUF600 family protein	NA	NA	NA	NA	NA
WP_009328750.1|1361960_1364009_-	hypothetical protein	NA	O64023	Bacillus_phage	24.5	1.9e-27
WP_003180784.1|1364229_1364877_+	hypothetical protein	NA	A0A0Y0AJU6	Bacillus_phage	47.5	4.1e-45
WP_003180785.1|1364890_1365547_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	49.7	4.0e-40
WP_003180787.1|1365735_1366089_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.6	2.7e-19
WP_003180788.1|1366261_1366522_+	helix-turn-helix transcriptional regulator	NA	S5MA07	Brevibacillus_phage	41.2	7.9e-08
WP_003180790.1|1366511_1366808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180792.1|1366808_1367639_+	hypothetical protein	NA	S6BFM4	Thermus_phage	31.0	1.3e-27
WP_011197802.1|1367538_1368339_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	48.1	3.6e-59
WP_003180798.1|1368609_1368951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180800.1|1368947_1369151_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	54.7	1.9e-12
WP_003180803.1|1369271_1369775_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	38.7	1.4e-21
WP_003180804.1|1369917_1370718_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.4	5.7e-65
WP_009328741.1|1370714_1372013_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	60.2	7.2e-150
WP_003180808.1|1372016_1373531_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.5	3.4e-143
WP_009328740.1|1373538_1374387_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	62.8	2.1e-57
WP_009328739.1|1374404_1375340_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	64.1	1.1e-102
WP_011201613.1|1375427_1375808_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_009328738.1|1375804_1376161_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_003180822.1|1376157_1376646_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	44.6	1.9e-34
WP_017474400.1|1376658_1377099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180826.1|1377099_1377324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197804.1|1377323_1378670_+|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	40.2	1.5e-78
WP_003180830.1|1378671_1379115_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.7	2.1e-24
WP_003180832.1|1379297_1379747_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.7	4.1e-12
WP_003180833.1|1379788_1379926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153915747.1|1379929_1383595_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	1.7e-42
WP_003180838.1|1383587_1384244_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.6	4.0e-24
WP_003180841.1|1384300_1385281_+	hypothetical protein	NA	H7BV96	unidentified_phage	32.3	9.2e-41
WP_003180843.1|1385277_1385586_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.3	1.0e-06
WP_003180844.1|1385604_1386030_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	39.0	5.4e-14
WP_003180847.1|1386022_1387066_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	9.7e-73
WP_009328731.1|1387052_1387973_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.3	5.0e-12
WP_003180850.1|1387986_1388373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197807.1|1388388_1389594_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	48.3	9.3e-27
WP_011197808.1|1389638_1390598_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	28.4	1.2e-11
WP_011197809.1|1390619_1390889_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	66.3	5.6e-25
WP_003180859.1|1390903_1391167_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.8	5.3e-28
WP_009328730.1|1391217_1392282_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	50.8	2.0e-44
WP_016885888.1|1392383_1393061_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180865.1|1393083_1394100_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_017474398.1|1394120_1395218_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_009328728.1|1395193_1396042_+	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	33.3	5.6e-10
>prophage 4
NZ_CP045814	Bacillus licheniformis strain P8_B2 chromosome, complete genome	4343379	2218272	2236458	4343379		Bacillus_phage(87.5%)	32	NA	NA
WP_153915790.1|2218272_2218863_-	hypothetical protein	NA	A0A1P8CX67	Bacillus_phage	80.6	9.7e-86
WP_153915793.1|2219062_2219512_-	DUF1768 domain-containing protein	NA	A0A172JI41	Bacillus_phage	65.5	1.8e-47
WP_026579541.1|2219822_2220179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328256.1|2220237_2220411_-	hypothetical protein	NA	O64190	Bacillus_phage	89.5	2.7e-20
WP_009328257.1|2220675_2221020_-	hypothetical protein	NA	O64111	Bacillus_phage	60.4	1.4e-31
WP_153915795.1|2221117_2221318_+	small, acid-soluble spore protein, alpha/beta type	NA	Q77YX0	Bacillus_phage	83.3	2.8e-21
WP_048355950.1|2221405_2221984_-	hypothetical protein	NA	R4JEY6	Bacillus_phage	35.0	1.0e-10
WP_095233904.1|2222033_2222399_-	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	44.6	3.8e-16
WP_080623981.1|2222546_2223386_-	thymidylate synthase	NA	U5J9N5	Bacillus_phage	40.3	8.4e-51
WP_153915797.1|2223398_2224496_-	hypothetical protein	NA	G3MBL0	Bacillus_virus	54.8	4.1e-114
WP_080623978.1|2224497_2225055_-	hypothetical protein	NA	G3MBK8	Bacillus_virus	53.6	5.2e-49
WP_080623977.1|2225060_2225354_-	hypothetical protein	NA	O64180	Bacillus_phage	48.9	7.5e-15
WP_153915799.1|2225337_2225541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474732.1|2225871_2226054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080623975.1|2226149_2226584_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	88.7	2.5e-70
WP_046132825.1|2226627_2227062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075223514.1|2227051_2227381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021837978.1|2227421_2227589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016885365.1|2227588_2227837_-	NrdH-redoxin	NA	A0A1P8CX24	Bacillus_phage	65.8	8.9e-25
WP_016885364.1|2227859_2228597_-	hypothetical protein	NA	A0A2I6UHL5	Bacillus_phage	60.0	7.3e-83
WP_021837976.1|2228586_2229570_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	79.9	2.8e-146
WP_153915801.1|2229610_2230594_-	DNA (cytosine-5-)-methyltransferase	NA	D2IZY5	Enterococcus_phage	57.6	5.7e-99
WP_026579530.1|2230926_2231175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080666365.1|2231391_2232774_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	77.6	3.1e-207
WP_021837970.1|2232924_2233608_-	HNH endonuclease	NA	L0LCB9	Bacillus_phage	59.3	9.3e-48
WP_035400091.1|2233715_2234444_-	hypothetical protein	NA	A0A217ER63	Bacillus_phage	87.8	1.3e-116
WP_021837968.1|2234400_2234802_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	S6ANL8	Bacillus_phage	64.0	2.3e-38
WP_017474744.1|2234801_2235149_-	hypothetical protein	NA	O64171	Bacillus_phage	41.7	6.8e-15
WP_153915803.1|2235201_2235462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095266724.1|2235891_2236026_-	hypothetical protein	NA	O64168	Bacillus_phage	79.5	1.6e-12
WP_105179790.1|2236039_2236252_-	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	80.0	1.1e-28
WP_142782808.1|2236266_2236458_-	hypothetical protein	NA	S6BUY9	Bacillus_phage	50.0	3.6e-10
>prophage 5
NZ_CP045814	Bacillus licheniformis strain P8_B2 chromosome, complete genome	4343379	2239543	2270506	4343379	integrase	Bacillus_phage(92.31%)	43	2266985:2267002	2275628:2275645
WP_095291874.1|2239543_2240344_-	site-specific DNA-methyltransferase	NA	A0A2H4IZ65	uncultured_Caudovirales_phage	56.0	1.9e-76
WP_153915807.1|2240362_2240503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095291873.1|2240600_2241185_-	hypothetical protein	NA	A7KV03	Bacillus_phage	38.6	8.2e-29
WP_026579522.1|2241508_2241724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153915809.1|2241728_2242445_-	hypothetical protein	NA	O64147	Bacillus_phage	43.3	4.0e-41
WP_153915811.1|2242455_2246385_-	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	83.8	0.0e+00
WP_145697310.1|2246400_2248122_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	64.8	2.2e-215
WP_145697312.1|2248125_2249259_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	70.2	3.0e-160
WP_145697314.1|2249275_2250790_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	81.0	3.1e-237
WP_145697317.1|2250804_2251275_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	69.2	1.3e-56
WP_073411032.1|2251321_2252293_-	AAA family ATPase	NA	A0A1P8CX29	Bacillus_phage	85.0	2.9e-156
WP_145697319.1|2252346_2253258_-	hypothetical protein	NA	A0A1P8CX09	Bacillus_phage	67.3	3.2e-112
WP_026579513.1|2253340_2253673_-	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	50.5	1.8e-17
WP_035400088.1|2254182_2254686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026579511.1|2254711_2255050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145697321.1|2255089_2255740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145697323.1|2255821_2256076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153915813.1|2256116_2256830_-	serine/threonine protein phosphatase	NA	A0A059T7C4	Listeria_phage	39.1	4.6e-42
WP_145697327.1|2256830_2257070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328303.1|2257106_2257349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328304.1|2257345_2257540_-	hypothetical protein	NA	R4JF30	Bacillus_phage	98.4	5.5e-30
WP_009328305.1|2257536_2257725_-	hypothetical protein	NA	A0A0A0RMX5	Bacillus_phage	64.4	4.1e-14
WP_009328306.1|2257724_2258129_-	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	53.7	5.7e-21
WP_006640545.1|2258246_2258609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016885326.1|2258605_2258830_-	hypothetical protein	NA	O64132	Bacillus_phage	63.4	3.1e-21
WP_075646771.1|2258923_2259736_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	76.2	7.0e-119
WP_006640548.1|2259745_2259994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075646772.1|2260828_2261041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073425984.1|2261261_2261453_-	hypothetical protein	NA	A0A142F1P8	Bacillus_phage	67.7	1.8e-17
WP_073425983.1|2261552_2261726_-	DNA strand exchange inhibitor protein	NA	A0A1B1P7C0	Bacillus_phage	73.7	5.8e-15
WP_075646773.1|2261752_2262097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075223458.1|2262143_2262341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328311.1|2262871_2263054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328312.1|2263073_2263742_-	DUF1273 family protein	NA	A0A1P8CWY2	Bacillus_phage	73.5	5.8e-95
WP_009328313.1|2263767_2263989_-	hypothetical protein	NA	A0A217ER97	Bacillus_phage	50.8	2.0e-12
WP_075646775.1|2264026_2264314_-	hypothetical protein	NA	A0A0E3DEX0	Bacillus_phage	49.5	1.8e-16
WP_145736961.1|2264366_2265521_-	AAA family ATPase	NA	A0A223LDI7	Bacillus_phage	39.7	3.0e-67
WP_075646776.1|2265601_2265826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328316.1|2266132_2266327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034291511.1|2266339_2266594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328318.1|2266962_2267964_-|integrase	site-specific integrase	integrase	O64101	Bacillus_phage	40.1	4.8e-61
2266985:2267002	attL	TCAATTCCAAGCTCTTTC	NA	NA	NA	NA
WP_145697346.1|2267967_2269344_-	hypothetical protein	NA	O64100	Bacillus_phage	42.4	1.0e-93
WP_145697348.1|2269411_2270506_-|integrase	integrase	integrase	O64099	Bacillus_phage	42.7	2.7e-73
2275628:2275645	attR	TCAATTCCAAGCTCTTTC	NA	NA	NA	NA
>prophage 6
NZ_CP045814	Bacillus licheniformis strain P8_B2 chromosome, complete genome	4343379	2285176	2345300	4343379	transposase,holin,integrase,tail	Bacillus_phage(84.62%)	63	2294299:2294314	2326553:2326568
WP_075646788.1|2285176_2286256_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3V0V2	Geobacillus_virus	33.8	3.9e-16
WP_075646789.1|2286743_2286926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328351.1|2287122_2287353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021837916.1|2287424_2287724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328352.1|2287756_2288011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474468.1|2288045_2288240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474469.1|2288402_2288615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073425966.1|2288646_2289198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021837913.1|2289218_2289569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153915817.1|2290115_2290649_-	hypothetical protein	NA	A0A0H3UZP0	Geobacillus_virus	33.3	2.0e-13
WP_145736938.1|2290953_2292171_-	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	81.2	1.6e-191
WP_145736935.1|2292873_2293194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474476.1|2293190_2293469_-	hypothetical protein	NA	NA	NA	NA	NA
2294299:2294314	attL	TATAGACAAAAACAAA	NA	NA	NA	NA
WP_080618478.1|2294463_2294916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075223470.1|2294946_2297721_+	hypothetical protein	NA	H7BV05	unidentified_phage	29.5	8.0e-106
WP_075223471.1|2297717_2298518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075223472.1|2298623_2298899_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	75.6	1.2e-30
WP_075223473.1|2299835_2300351_+	hypothetical protein	NA	L0L915	Bacillus_phage	48.6	1.5e-34
WP_043928512.1|2301001_2301205_+	hypothetical protein	NA	A0A1P8CWT3	Bacillus_phage	74.2	7.8e-19
WP_075223474.1|2301217_2302411_+	metallophosphoesterase	NA	A0A0N9SK37	Staphylococcus_phage	38.0	4.1e-67
WP_021837898.1|2302765_2303395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021837897.1|2303675_2304608_+	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	76.4	1.8e-139
WP_021837896.1|2304591_2306361_+	hypothetical protein	NA	O64069	Bacillus_phage	91.9	0.0e+00
WP_021837895.1|2306378_2307899_+	hypothetical protein	NA	O64068	Bacillus_phage	83.0	1.9e-247
WP_021837894.1|2307932_2309351_+	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	65.1	8.1e-171
WP_021837893.1|2309374_2309977_+	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	82.4	1.7e-77
WP_021837892.1|2310017_2311034_+	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	84.6	1.2e-160
WP_009328375.1|2311068_2311539_+	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	80.8	1.3e-69
WP_009328376.1|2311550_2311949_+	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	62.1	2.2e-41
WP_009328377.1|2311945_2312176_+	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	52.8	6.3e-09
WP_009328378.1|2312162_2312822_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	65.7	3.7e-78
WP_021837890.1|2312818_2313349_+	hypothetical protein	NA	O64060	Bacillus_phage	63.1	1.5e-58
WP_009328380.1|2313345_2314056_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	38.6	9.0e-38
WP_009328381.1|2314087_2314921_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	42.5	4.2e-26
WP_021837889.1|2314960_2315317_+	hypothetical protein	NA	D6R3Z0	Bacillus_phage	42.7	3.5e-14
WP_145614593.1|2315426_2315792_+	lysozyme	NA	NA	NA	NA	NA
WP_075646805.1|2317097_2317409_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	45.2	5.2e-14
WP_075646806.1|2317405_2317597_+	XkdX family protein	NA	NA	NA	NA	NA
WP_075646807.1|2317634_2318120_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	32.1	3.6e-14
WP_075646808.1|2318120_2318540_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	57.0	5.1e-41
WP_075646809.1|2318553_2319555_+|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	86.5	2.6e-171
WP_145699372.1|2319674_2319869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153915819.1|2319865_2320768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153915821.1|2320949_2321564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153915823.1|2321704_2322166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016886016.1|2322935_2323676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016886014.1|2323999_2324695_+	hypothetical protein	NA	Q37974	Bacillus_phage	47.0	3.5e-50
WP_016886013.1|2324704_2324938_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SC34	Paenibacillus_phage	51.6	1.7e-09
WP_095233942.1|2325325_2326903_+	hypothetical protein	NA	NA	NA	NA	NA
2326553:2326568	attR	TATAGACAAAAACAAA	NA	NA	NA	NA
WP_017474508.1|2326975_2327227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026080824.1|2327316_2328711_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	53.6	3.9e-101
WP_120155646.1|2329347_2329581_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	84.3	4.6e-15
WP_026080825.1|2329675_2334808_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	60.5	0.0e+00
WP_017474509.1|2334863_2335625_+	hypothetical protein	NA	A0A1P8CWP8	Bacillus_phage	58.1	5.1e-79
WP_051030486.1|2335628_2338268_+	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	50.8	1.2e-241
WP_017474511.1|2338283_2339081_+	hypothetical protein	NA	O64043	Bacillus_phage	59.0	2.8e-72
WP_095264092.1|2339096_2341001_+	hypothetical protein	NA	U5PWM6	Bacillus_phage	35.3	2.3e-51
WP_048349898.1|2341157_2342246_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	68.1	2.3e-109
WP_016886002.1|2342377_2342764_+	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	70.6	4.0e-40
WP_021837857.1|2342782_2343037_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	77.1	1.0e-28
WP_048349897.1|2343055_2343355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180750.1|2343563_2343641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080623910.1|2344199_2345300_-	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	26.5	4.5e-28
>prophage 7
NZ_CP045814	Bacillus licheniformis strain P8_B2 chromosome, complete genome	4343379	2511985	2524166	4343379		Staphylococcus_phage(55.56%)	15	NA	NA
WP_003183104.1|2511985_2512579_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.6	3.4e-14
WP_009327962.1|2512568_2513324_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.6	1.4e-07
WP_003183108.1|2513506_2513602_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003183111.1|2513722_2514244_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003183113.1|2514254_2514629_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003183115.1|2514730_2515195_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	70.7	1.7e-45
WP_003183117.1|2515229_2516426_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.9	2.1e-116
WP_017473932.1|2516447_2517095_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.5	5.7e-39
WP_017473931.1|2517106_2518195_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.8	6.6e-64
WP_003183123.1|2518555_2518900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011198084.1|2519162_2521349_-	AAA family ATPase	NA	A0A220BYT7	Staphylococcus_phage	41.3	1.4e-150
WP_003183127.1|2521475_2521913_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003183128.1|2522071_2522377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009327959.1|2522366_2523497_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	43.3	1.4e-77
WP_003183133.1|2523728_2524166_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	44.6	5.4e-17
>prophage 8
NZ_CP045814	Bacillus licheniformis strain P8_B2 chromosome, complete genome	4343379	2926720	2996993	4343379	protease,coat,terminase,transposase,integrase,tRNA	Bacillus_phage(33.33%)	69	2991048:2991073	2997054:2997079
WP_016885541.1|2926720_2927773_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_153915842.1|2927888_2928998_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_009327769.1|2929019_2929859_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_003184010.1|2929839_2931414_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003184013.1|2931514_2932693_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	25.3	1.2e-31
WP_003184015.1|2932661_2933204_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_003184017.1|2933247_2934117_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003184018.1|2934125_2934569_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003184021.1|2934682_2935969_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003184022.1|2936001_2936580_-	sporulation protein	NA	NA	NA	NA	NA
WP_003184023.1|2936805_2937087_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003184025.1|2937099_2937441_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003184027.1|2937453_2937762_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003184028.1|2937918_2938785_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_044789852.1|2938777_2939569_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003184032.1|2939714_2940143_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_003184034.1|2940142_2940463_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003184035.1|2940507_2941314_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_011198163.1|2941316_2941997_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003184039.1|2942051_2942570_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003184040.1|2942566_2943475_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003184042.1|2943505_2944516_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_003184045.1|2944603_2945278_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_003184048.1|2945332_2945905_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003184050.1|2946058_2947090_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011198164.1|2947293_2948043_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_017474374.1|2948185_2949490_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003184055.1|2949565_2952208_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	2.8e-161
WP_003184058.1|2952663_2952855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009329292.1|2952874_2953897_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_011198165.1|2953924_2955298_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_059260978.1|2955446_2956742_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_009329298.1|2956767_2957742_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_044789850.1|2957745_2958537_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003184068.1|2958526_2959468_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003184070.1|2959507_2960338_-	cytochrome c	NA	NA	NA	NA	NA
WP_017474375.1|2960343_2961705_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003184074.1|2961893_2962379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184076.1|2962426_2963014_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016885551.1|2963010_2965335_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.2	1.0e-186
WP_003184080.1|2965553_2967209_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	35.7	1.4e-17
WP_003184083.1|2967391_2968657_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.5	7.2e-147
WP_003184085.1|2968925_2970200_-	trigger factor	NA	NA	NA	NA	NA
WP_017474376.1|2970426_2971434_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003184088.1|2971563_2972163_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_017474377.1|2972175_2973594_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_003184091.1|2973627_2974740_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_003184093.1|2974767_2976324_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.6	2.5e-08
WP_003184095.1|2976310_2977339_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003184097.1|2977362_2977881_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003184100.1|2977877_2979602_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.2	1.5e-62
WP_003184102.1|2980024_2980939_-	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_003184104.1|2981395_2981623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184106.1|2981665_2983048_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_009329319.1|2983460_2983715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184110.1|2983758_2984250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474379.1|2984263_2984464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025808006.1|2984685_2984901_-	hypothetical protein	NA	A0A1B1P7C8	Bacillus_phage	53.0	4.1e-10
WP_059260972.1|2986196_2987066_-|terminase	terminase	terminase	D2IYW0	Enterococcus_phage	40.4	3.9e-35
WP_017474640.1|2987111_2988116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009329322.1|2988606_2989380_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_026080840.1|2989685_2990456_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1B1P7C6	Bacillus_phage	63.1	1.3e-87
WP_003184124.1|2990464_2990821_-	hypothetical protein	NA	A0A1B1P7B5	Bacillus_phage	52.0	1.8e-23
2991048:2991073	attL	GTGTCCGCAGGCTCTCCGTCTTGGAC	NA	NA	NA	NA
WP_085959889.1|2991184_2992347_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.2	1.5e-34
WP_009329324.1|2992522_2993002_-	TIGR01741 family protein	NA	NA	NA	NA	NA
WP_026699140.1|2993007_2995002_-|integrase	integrase	integrase	A0A1P8CWI7	Bacillus_phage	23.6	2.7e-15
WP_009329326.1|2995196_2996387_+	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	29.0	5.6e-40
WP_003184137.1|2996383_2996515_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003184139.1|2996609_2996993_-	ArpU family transcriptional regulator	NA	A0A2H4J748	uncultured_Caudovirales_phage	43.9	5.4e-21
2997054:2997079	attR	GTGTCCGCAGGCTCTCCGTCTTGGAC	NA	NA	NA	NA
>prophage 9
NZ_CP045814	Bacillus licheniformis strain P8_B2 chromosome, complete genome	4343379	3547765	3621111	4343379	protease,coat,terminase,transposase,capsid,holin,portal,head,integrase,tRNA,tail	Bacillus_phage(34.15%)	84	3560307:3560324	3605704:3605721
WP_017474576.1|3547765_3548515_+|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	NA	NA	NA	NA
WP_003185271.1|3548511_3549732_+	cytochrome P450, cyclodipeptide synthase-associated	NA	NA	NA	NA	NA
WP_003185273.1|3549728_3550184_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003185275.1|3550200_3550674_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017474574.1|3550796_3551975_-	amidase	NA	NA	NA	NA	NA
WP_017474573.1|3552164_3553214_+	oxidoreductase	NA	NA	NA	NA	NA
WP_003185281.1|3553245_3553881_-	FMN-dependent NADH-azoreductase 2	NA	NA	NA	NA	NA
WP_003185283.1|3554181_3555150_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_003185286.1|3555345_3555555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185288.1|3555538_3556120_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003185290.1|3556276_3556426_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_003185292.1|3556519_3557674_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003185294.1|3557746_3558145_+	peptidase	NA	NA	NA	NA	NA
WP_003185296.1|3558241_3558727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011198290.1|3558842_3559385_+	hypothetical protein	NA	NA	NA	NA	NA
3560307:3560324	attL	TGGAGACGGTGGGAGTCG	NA	NA	NA	NA
WP_153915875.1|3560856_3562386_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144583132.1|3562401_3562740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003185310.1|3563453_3564164_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_035334177.1|3564371_3565223_+	DUF2202 domain-containing protein	NA	NA	NA	NA	NA
WP_003185315.1|3565378_3565972_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	67.6	6.4e-53
WP_003185317.1|3566092_3567046_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	41.7	1.6e-58
WP_011197884.1|3567093_3567357_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	74.7	1.5e-30
WP_009329192.1|3567372_3567642_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	58.4	1.4e-20
WP_011198303.1|3567704_3567887_-	XkdX family protein	NA	Q4ZA85	Staphylococcus_virus	49.0	3.0e-06
WP_071583926.1|3567883_3568198_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	43.0	4.4e-13
WP_145599662.1|3568209_3569580_-	DUF2479 domain-containing protein	NA	M4ZRP1	Bacillus_phage	45.2	3.6e-67
WP_153915877.1|3569600_3571556_-	hypothetical protein	NA	D7NW65	Streptomyces_phage	28.9	2.3e-43
WP_153915879.1|3571592_3573305_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	66.6	1.2e-221
WP_145737055.1|3573317_3574154_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	69.3	3.6e-110
WP_153915881.1|3574153_3578623_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.6	7.1e-72
WP_153915883.1|3578830_3579193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185341.1|3579246_3579864_-|tail	tail protein	tail	NA	NA	NA	NA
WP_003185344.1|3579878_3580262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006637249.1|3580258_3580657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185349.1|3580656_3580965_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_003185351.1|3580954_3581257_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	1.2e-12
WP_003185353.1|3581277_3581703_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	57.8	9.3e-14
WP_025807602.1|3581726_3583010_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	44.5	1.3e-79
WP_035317290.1|3583048_3583780_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	53.7	5.2e-57
WP_025807606.1|3583724_3585035_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.7	3.8e-106
WP_025807608.1|3585035_3585227_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_153915885.1|3585238_3586948_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	61.8	2.7e-205
WP_026080867.1|3586944_3587460_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	46.4	4.4e-34
WP_006637239.1|3587689_3588064_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	1.4e-29
WP_006637238.1|3588090_3588405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153915887.1|3588391_3588952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006637236.1|3589149_3589377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006637235.1|3589593_3589818_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_071584222.1|3590547_3590928_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	69.9	3.6e-41
WP_153915889.1|3590924_3592280_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	66.1	1.1e-177
WP_069500915.1|3592269_3592554_-	VRR-NUC domain-containing protein	NA	S5MUC8	Brevibacillus_phage	57.8	2.9e-19
WP_145837479.1|3592851_3595263_-	hypothetical protein	NA	A0A0A7RTG3	Clostridium_phage	58.2	3.6e-288
WP_153915891.1|3595378_3597322_-	hypothetical protein	NA	S5M5X4	Brevibacillus_phage	68.4	6.1e-262
WP_006637225.1|3597327_3597573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048406860.1|3597634_3598201_-	DUF2815 family protein	NA	S5MC21	Brevibacillus_phage	73.8	3.7e-74
WP_153915893.1|3598233_3599406_-	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	64.6	1.9e-141
WP_153915895.1|3599405_3599852_-	hypothetical protein	NA	S5M5X1	Brevibacillus_phage	41.1	1.2e-08
WP_011198322.1|3599946_3600189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009330095.1|3600276_3600543_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	54.7	2.7e-19
WP_003185396.1|3600602_3600983_+	DUF2513 domain-containing protein	NA	A0A2I7SCV0	Paenibacillus_phage	41.6	7.0e-21
WP_003185401.1|3601488_3602043_-	hypothetical protein	NA	A0A288WGQ2	Bacillus_phage	42.7	1.3e-31
WP_016886536.1|3602100_3602289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185403.1|3602420_3602609_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153915897.1|3602605_3603400_-	ORF6N domain-containing protein	NA	D7RWL7	Brochothrix_phage	61.0	1.3e-77
WP_003185407.1|3603422_3603641_-	helix-turn-helix transcriptional regulator	NA	Q8SBM9	Clostridium_phage	61.1	7.8e-17
WP_003185408.1|3603817_3604456_+	LexA family transcriptional regulator	NA	A0A2I7SCV6	Paenibacillus_phage	47.7	1.8e-45
WP_153915899.1|3604526_3605621_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B2AQ00	Phage_Wrath	53.1	5.7e-100
WP_009329604.1|3606172_3606646_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	61.1	1.0e-45
3605704:3605721	attR	TGGAGACGGTGGGAGTCG	NA	NA	NA	NA
WP_003185414.1|3606757_3609061_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.7	6.9e-95
WP_003185416.1|3609074_3609821_-	carboxylesterase	NA	NA	NA	NA	NA
WP_003185418.1|3609961_3610192_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_003185421.1|3610362_3610647_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	52.7	5.8e-12
WP_085959538.1|3610675_3610909_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_026080846.1|3611061_3611463_+	transcriptional regulator	NA	S6C481	Thermus_phage	46.2	6.5e-17
WP_011201739.1|3611626_3612031_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	49.5	2.1e-15
WP_003185432.1|3612078_3612756_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009329611.1|3612772_3613690_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009329612.1|3613703_3614357_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003185439.1|3614378_3615518_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	30.6	8.6e-14
WP_003185442.1|3615775_3616315_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003185444.1|3616361_3616994_-	NAAT family transporter	NA	NA	NA	NA	NA
WP_009329613.1|3617331_3617934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474709.1|3617977_3619756_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_085959889.1|3619949_3621111_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.2	1.5e-34
