The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045816	Bacillus subtilis strain P5_B2 chromosome, complete genome	4103324	150875	174534	4103324	capsid,tail,head,tRNA,integrase,portal,protease,terminase	Bacillus_phage(61.54%)	37	147017:147031	168122:168136
147017:147031	attL	GCAGACGGAGAAAAG	NA	NA	NA	NA
WP_046159979.1|150875_151745_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	5.2e-11
WP_029317183.1|151741_152539_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_046159980.1|152548_153292_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003241966.1|153453_153891_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004399691.1|153911_154304_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_017695832.1|154393_155521_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	34.4	8.7e-51
WP_046159981.1|155563_155986_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	63.8	5.3e-46
WP_017695834.1|155996_156425_-	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	58.9	3.4e-40
WP_017695835.1|156696_156882_+	helix-turn-helix transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	68.9	5.2e-14
WP_017695836.1|156887_157157_+	hypothetical protein	NA	S5MC08	Brevibacillus_phage	51.7	3.4e-22
WP_046159982.1|157295_157532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046159983.1|157515_157782_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	46.8	1.6e-11
WP_046159984.1|157837_158419_+	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	43.3	4.8e-29
WP_017695841.1|158396_158672_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	49.4	3.9e-21
WP_046159985.1|158865_159420_+	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	96.2	5.3e-94
WP_017695844.1|159423_160356_+	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	91.1	5.3e-155
WP_046159986.1|160355_160796_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	95.2	2.3e-76
WP_014479859.1|160856_163274_+	hypothetical protein	NA	D6R422	Bacillus_phage	88.7	0.0e+00
WP_014479860.1|163473_163911_+	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	91.7	4.8e-74
WP_046159987.1|163907_164447_+	nuclease	NA	Q9ZXC2	Bacillus_phage	95.5	6.7e-94
WP_046159988.1|164480_164996_+	hypothetical protein	NA	D6R425	Bacillus_phage	97.1	7.6e-95
WP_046159989.1|164996_165188_+	hypothetical protein	NA	D6R426	Bacillus_phage	80.4	8.1e-18
WP_082090345.1|165153_165609_+	hypothetical protein	NA	D9J0I1	Brochothrix_phage	41.2	1.1e-15
WP_046159991.1|165605_165809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046159992.1|165894_166308_+	ArpU family transcriptional regulator	NA	D6R428	Bacillus_phage	97.0	2.1e-63
WP_042975081.1|166677_166893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046159993.1|166889_167258_+	HNH endonuclease	NA	A0A1B0T6C5	Bacillus_phage	52.0	1.2e-30
WP_052719999.1|167327_167741_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_152647924.1|167737_169492_+|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	56.0	7.1e-193
168122:168136	attR	GCAGACGGAGAAAAG	NA	NA	NA	NA
WP_046159995.1|169503_170682_+|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	55.0	3.5e-111
WP_026113656.1|170671_171265_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	59.0	5.4e-52
WP_046159996.1|171261_172545_+|capsid	phage major capsid protein	capsid	A0A2H4J9Y4	uncultured_Caudovirales_phage	51.8	1.2e-85
WP_152647925.1|172531_172819_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	43.4	1.4e-13
WP_082090346.1|172772_173126_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_046159998.1|173109_173520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046159999.1|173524_173908_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_046160000.1|173904_174534_+	hypothetical protein	NA	A0A075KL86	Lactobacillus_phage	32.5	6.6e-08
>prophage 2
NZ_CP045816	Bacillus subtilis strain P5_B2 chromosome, complete genome	4103324	178513	186806	4103324	holin,plate,tail	Bacillus_phage(85.71%)	9	NA	NA
WP_116363039.1|178513_179416_+	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	82.6	1.2e-50
WP_046160001.1|179420_180251_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_046160002.1|180263_182150_+	autolysin	NA	M5AC19	Bacillus_phage	26.3	6.3e-46
WP_153952908.1|182157_183711_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	84.3	8.3e-254
WP_046160649.1|183747_184869_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	92.2	4.8e-195
WP_085185873.1|184884_185184_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	1.5e-39
WP_031600554.1|185180_185351_+	XkdX family protein	NA	NA	NA	NA	NA
WP_153952910.1|185404_185827_+|holin	holin	holin	D6R405	Bacillus_phage	82.7	1.1e-54
WP_153952912.1|185870_186806_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	62.0	5.4e-91
>prophage 3
NZ_CP045816	Bacillus subtilis strain P5_B2 chromosome, complete genome	4103324	705797	714163	4103324		Synechococcus_phage(50.0%)	8	NA	NA
WP_003233955.1|705797_707093_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
WP_041337795.1|707166_707892_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	7.0e-46
WP_003219409.1|707884_708139_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_014663062.1|708135_708819_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_046160142.1|708802_711031_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	2.2e-159
WP_046160143.1|711006_712437_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.1	2.0e-52
WP_046160144.1|712538_713579_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.4	4.8e-64
WP_015252651.1|713575_714163_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
>prophage 4
NZ_CP045816	Bacillus subtilis strain P5_B2 chromosome, complete genome	4103324	738521	748996	4103324		Streptococcus_phage(42.86%)	7	NA	NA
WP_046160151.1|738521_741680_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	5.0e-64
WP_003233894.1|742003_742915_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	29.7	1.2e-21
WP_129110459.1|742972_744355_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.9	2.1e-115
WP_035198876.1|744771_744960_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	44.6	1.9e-11
WP_082090360.1|744980_745712_+	site-specific DNA-methyltransferase	NA	M1Q227	Streptococcus_phage	71.5	4.4e-104
WP_046160152.1|745701_746790_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	68.8	6.2e-139
WP_046160153.1|746776_748996_+	AAA domain-containing protein	NA	M1NSM1	Streptococcus_phage	33.0	1.4e-84
>prophage 5
NZ_CP045816	Bacillus subtilis strain P5_B2 chromosome, complete genome	4103324	1216588	1260951	4103324	coat,tRNA	Planktothrix_phage(25.0%)	50	NA	NA
WP_072173825.1|1216588_1216825_-|coat	spore coat protein YjzB	coat	NA	NA	NA	NA
WP_003232971.1|1216989_1217928_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003244890.1|1217950_1219192_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_021479557.1|1219267_1220053_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_046160279.1|1220244_1221231_+	oligopeptide ABC transporter ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-22
WP_046160280.1|1221227_1222217_+	oligopeptide ABC transporter ATP-binding protein AppF	NA	F2Y302	Organic_Lake_phycodnavirus	26.1	1.1e-06
WP_038828817.1|1222304_1223933_+	peptide-binding protein	NA	NA	NA	NA	NA
WP_015252362.1|1224007_1224958_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_046160281.1|1224973_1225888_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014663526.1|1226092_1226845_+	DUF3603 family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	7.1e-49
WP_046160356.1|1226884_1227877_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_021479550.1|1228620_1230258_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_003245554.1|1230364_1231300_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_003232954.1|1231303_1232221_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_072173823.1|1232225_1233302_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
WP_003245567.1|1233303_1234221_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.2e-05
WP_080019554.1|1234327_1235545_+	MFS transporter	NA	NA	NA	NA	NA
WP_003244921.1|1235708_1236287_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014476435.1|1236467_1236863_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_038828809.1|1237117_1237774_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	38.2	1.9e-29
WP_119122854.1|1237943_1238084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015252354.1|1238050_1238707_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_021479547.1|1238701_1238824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044052564.1|1238867_1240019_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_009967010.1|1240065_1242078_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003244944.1|1242115_1242283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245184.1|1242596_1243496_-	adaptor protein SpxH	NA	NA	NA	NA	NA
WP_003232928.1|1243492_1243891_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
WP_015252352.1|1244145_1244691_-	bifunctional muramidase/murein lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	61.0	6.3e-39
WP_015252351.1|1244894_1245467_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_046160282.1|1245591_1245960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245294.1|1245988_1246624_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003232918.1|1246642_1247443_+	NAD kinase	NA	NA	NA	NA	NA
WP_015252349.1|1247505_1248357_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003244765.1|1248369_1249104_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	M4Q4T6	Vibrio_phage	25.0	3.2e-06
WP_015252348.1|1249338_1251183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232909.1|1251431_1252142_+	thiaminase II	NA	NA	NA	NA	NA
WP_015252347.1|1252116_1252734_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_015715675.1|1252717_1253827_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_072173897.1|1253826_1254027_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_010886483.1|1254023_1254794_+	thiazole synthase	NA	NA	NA	NA	NA
WP_046160283.1|1254790_1255801_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_014479462.1|1255819_1256635_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003232896.1|1256770_1257547_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_082090368.1|1257647_1258331_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
WP_003244982.1|1258423_1258870_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_003239243.1|1258997_1259486_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_014479466.1|1259637_1260120_-|coat	spore coat protein X	coat	NA	NA	NA	NA
WP_014479467.1|1260204_1260525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479468.1|1260564_1260951_-|coat	spore coat protein V	coat	NA	NA	NA	NA
>prophage 6
NZ_CP045816	Bacillus subtilis strain P5_B2 chromosome, complete genome	4103324	1341050	1375536	4103324	portal,holin,plate,terminase	uncultured_Caudovirales_phage(32.35%)	45	NA	NA
WP_003245490.1|1341050_1342322_+	ATPase YjoB	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
WP_015252291.1|1342466_1343603_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
WP_003245487.1|1343592_1343727_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_014479545.1|1344124_1345078_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.8	1.6e-66
WP_014479546.1|1345117_1345495_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	7.9e-17
WP_014479547.1|1345599_1346202_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	48.7	1.4e-44
WP_003245071.1|1346278_1347115_+	manganese catalase	NA	NA	NA	NA	NA
WP_003232721.1|1347158_1347755_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003232719.1|1347917_1348259_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_003232712.1|1348437_1348617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232710.1|1348603_1349440_+	hypothetical protein	NA	S6BFM4	Thermus_phage	27.8	6.7e-24
WP_080478406.1|1349339_1350140_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	5.0e-61
WP_032677395.1|1350139_1350307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046160305.1|1350391_1350742_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_014476537.1|1350738_1350945_+	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	2.1e-11
WP_014479550.1|1351060_1351570_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	39.2	6.5e-22
WP_003244697.1|1351685_1352483_+|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
WP_003232697.1|1352479_1353781_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	9.1e-153
WP_032725514.1|1353784_1355272_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
WP_014479551.1|1355291_1356119_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	59.2	1.6e-54
WP_003232690.1|1356144_1357080_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_014479552.1|1357101_1357485_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
WP_009967053.1|1357481_1357838_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_046160306.1|1357834_1358320_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.4	1.8e-37
WP_003232680.1|1358332_1358773_+	phage-like element PBSX protein XkdJ	NA	NA	NA	NA	NA
WP_003232679.1|1358776_1358995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046160307.1|1358991_1360392_+|portal	phage portal protein	portal	A0A0A7S087	Clostridium_phage	39.1	3.9e-77
WP_003232677.1|1360393_1360837_+	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_015715734.1|1360927_1361374_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	37.7	5.9e-11
WP_014479557.1|1361415_1361556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153952942.1|1361556_1366314_+	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	44.8	6.1e-37
WP_038828716.1|1366306_1366966_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.2	8.1e-25
WP_046160309.1|1366981_1367959_+|portal	phage portal protein	portal	H7BV96	unidentified_phage	32.6	7.8e-40
WP_046160310.1|1367958_1368225_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	35.2	3.8e-05
WP_014479560.1|1368282_1368708_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	3.0e-12
WP_003232669.1|1368700_1369747_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	1.3e-72
WP_014476551.1|1369730_1370309_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	3.9e-15
WP_003232665.1|1370305_1370578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046160311.1|1370580_1372644_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	34.5	2.6e-29
WP_046160312.1|1372655_1372985_+|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	42.3	1.0e-15
WP_014479563.1|1372981_1373146_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.9e-15
WP_014479564.1|1373192_1374032_+	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_014479565.1|1374084_1374354_+	phage-like element PBSX protein XhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	1.4e-23
WP_014479566.1|1374366_1374630_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	6.1e-24
WP_021479459.1|1374642_1375536_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.7	1.8e-83
>prophage 7
NZ_CP045816	Bacillus subtilis strain P5_B2 chromosome, complete genome	4103324	1807259	1868161	4103324	coat,tRNA,integrase,protease,terminase	Bacillus_phage(66.67%)	59	1807063:1807079	1818480:1818496
1807063:1807079	attL	CTATGTACTAAATATTC	NA	NA	NA	NA
WP_003231833.1|1807259_1807805_+|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_046160418.1|1807937_1810514_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	27.7	2.4e-40
WP_041516431.1|1810529_1812413_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.3	7.6e-68
WP_031600520.1|1813522_1813771_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	44.9	4.6e-05
WP_033881685.1|1813821_1814184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479826.1|1814456_1815206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046160420.1|1815852_1816383_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	62.8	9.0e-59
WP_123772464.1|1817054_1817420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046160421.1|1817570_1818344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033881251.1|1818734_1819481_+	hypothetical protein	NA	NA	NA	NA	NA
1818480:1818496	attR	CTATGTACTAAATATTC	NA	NA	NA	NA
WP_046160532.1|1819530_1819905_+	HNH endonuclease	NA	Q38456	Bacillus_phage	82.3	7.5e-60
WP_046160422.1|1820284_1820818_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	80.8	2.6e-69
WP_015252068.1|1821989_1822445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479830.1|1822599_1823157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479831.1|1823277_1823892_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029726464.1|1824030_1824387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080479557.1|1824465_1825290_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_124059879.1|1825399_1826728_-|protease	serine protease AprX	protease	A0A1B0T6A2	Bacillus_phage	33.6	1.6e-27
WP_003245758.1|1827463_1828171_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
WP_003231775.1|1828240_1828693_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003245163.1|1828706_1829060_-	multidrug efflux SMR transporter subunit EbrB	NA	NA	NA	NA	NA
WP_015483253.1|1829073_1829391_-	multidrug efflux SMR transporter subunit EbrA	NA	NA	NA	NA	NA
WP_046160427.1|1829525_1829801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003231769.1|1829889_1830303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021479248.1|1830402_1831347_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003221097.1|1831386_1831608_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_014479841.1|1831802_1832075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245262.1|1832156_1832387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231758.1|1832629_1833022_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
WP_014479842.1|1832981_1835084_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_003231754.1|1835101_1836091_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_003245105.1|1836140_1836761_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
WP_014479843.1|1836824_1837592_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	1.2e-51
WP_003231746.1|1838232_1839201_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
WP_046160428.1|1839333_1840596_+	GTPase HflX	NA	NA	NA	NA	NA
WP_046160429.1|1840613_1841879_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003238341.1|1841988_1842396_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_003231737.1|1842454_1843789_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_046160430.1|1844248_1844542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042975843.1|1844788_1845133_+	hypothetical protein	NA	O64021	Bacillus_phage	81.6	2.7e-32
WP_080262658.1|1845699_1846134_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_046160431.1|1847516_1848053_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046160432.1|1848131_1849034_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_029726895.1|1849111_1849492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479898.1|1850033_1850264_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	75.0	2.1e-20
WP_046160433.1|1850260_1850899_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_014479901.1|1851762_1851927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479902.1|1852066_1852537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046160434.1|1853331_1854723_+	MFS transporter	NA	NA	NA	NA	NA
WP_046160435.1|1854753_1856355_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_029726900.1|1856491_1857646_-	ROK family protein	NA	NA	NA	NA	NA
WP_046160436.1|1857886_1859224_+	xylose isomerase	NA	NA	NA	NA	NA
WP_153952944.1|1859374_1860874_+	xylulokinase	NA	NA	NA	NA	NA
WP_014479910.1|1861358_1861994_-	endonuclease YncB	NA	A0A1P8CWK6	Bacillus_phage	68.5	7.7e-73
WP_033881939.1|1862406_1863822_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_031600564.1|1863923_1865108_-	alanine racemase	NA	NA	NA	NA	NA
WP_014479913.1|1865518_1865944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479915.1|1866862_1867297_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	92.3	5.8e-72
WP_033881937.1|1867897_1868161_-|coat	spore coat protein CotU	coat	NA	NA	NA	NA
>prophage 8
NZ_CP045816	Bacillus subtilis strain P5_B2 chromosome, complete genome	4103324	2020651	2028678	4103324	holin	Bacillus_phage(85.71%)	9	NA	NA
WP_046160543.1|2020651_2020945_-	YolD-like family protein	NA	O64030	Bacillus_phage	97.9	9.7e-47
WP_033881859.1|2021439_2021799_-	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	98.3	2.2e-61
WP_072592542.1|2022058_2022142_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_046160484.1|2023000_2023579_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	91.1	1.5e-99
WP_046160485.1|2023634_2024093_-	SMI1 / KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	82.2	9.2e-68
WP_003231326.1|2024185_2024644_-	type II toxin-antitoxin system antitoxin YobK	NA	NA	NA	NA	NA
WP_014479999.1|2024653_2026456_-	type II toxin-antitoxin system toxin ribonuclease YobL	NA	A0A1P8CWI7	Bacillus_phage	87.0	1.3e-218
WP_046160544.1|2026556_2027114_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	93.5	8.5e-100
WP_125121259.1|2027241_2028678_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	30.3	1.5e-07
>prophage 9
NZ_CP045816	Bacillus subtilis strain P5_B2 chromosome, complete genome	4103324	2239840	2245935	4103324		Staphylococcus_phage(66.67%)	8	NA	NA
WP_014480158.1|2239840_2240434_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.6e-14
WP_014477220.1|2240423_2241179_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
WP_014480159.1|2241458_2241983_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003223910.1|2241996_2242371_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003223915.1|2242483_2242948_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_038828558.1|2242980_2244177_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
WP_004398505.1|2244191_2244839_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	5.0e-43
WP_046160523.1|2244849_2245935_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.4	3.9e-56
>prophage 10
NZ_CP045816	Bacillus subtilis strain P5_B2 chromosome, complete genome	4103324	2480310	2514988	4103324	holin,tail,plate,portal,terminase	uncultured_Caudovirales_phage(29.03%)	50	NA	NA
WP_046160615.1|2480310_2481135_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.1	4.2e-63
WP_003246208.1|2481179_2481602_-|holin	holin family protein	holin	D6R405	Bacillus_phage	73.7	3.3e-48
WP_046160616.1|2481647_2482541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041850053.1|2482629_2482794_-	XkdX family protein	NA	NA	NA	NA	NA
WP_009967793.1|2482790_2483126_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_046160617.1|2483135_2484230_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	56.1	1.7e-19
WP_032722163.1|2484233_2484506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032722164.1|2484502_2485081_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.8	1.9e-14
WP_032722165.1|2485064_2486111_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.0	4.8e-72
WP_032722166.1|2486103_2486529_-	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	33.3	5.6e-11
WP_032722167.1|2486541_2486808_-	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_032722168.1|2486804_2487785_-	hypothetical protein	NA	H7BV96	unidentified_phage	32.3	1.6e-40
WP_032722169.1|2487797_2488457_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.7	2.1e-25
WP_043940167.1|2488449_2493207_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.2	1.8e-44
WP_021480099.1|2493209_2493347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032722171.1|2493388_2493838_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	41.1	2.7e-11
WP_004398662.1|2493983_2494163_+	type I toxin-antitoxin system toxin TxpA	NA	NA	NA	NA	NA
WP_075058862.1|2494542_2494632_+	type I toxin-antitoxin system toxin BsrH	NA	NA	NA	NA	NA
WP_003229930.1|2494885_2495329_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.4	3.2e-25
WP_003229929.1|2495331_2496732_-|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	39.1	4.1e-74
WP_010886574.1|2496732_2496924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160618.1|2496920_2497358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015714316.1|2497370_2497874_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.9	2.9e-38
WP_015714317.1|2497870_2498233_-	DUF3599 family protein	NA	A0A249XXE9	Clostridium_phage	39.3	6.3e-11
WP_015714318.1|2498229_2498625_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_015714319.1|2498629_2498941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229922.1|2498951_2499887_-|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	65.0	8.6e-105
WP_003229921.1|2499905_2500874_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.3	7.4e-59
WP_003229920.1|2500906_2501560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004398748.1|2501600_2502518_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.1	2.4e-51
WP_004398894.1|2502514_2504047_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.9	4.7e-148
WP_082090405.1|2504050_2505346_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	66.7	3.3e-155
WP_003229916.1|2505338_2506058_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	55.9	1.7e-55
WP_004398685.1|2506125_2506590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004398775.1|2506733_2507189_-	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	74.8	2.4e-60
WP_003229913.1|2507386_2508316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229912.1|2508389_2508596_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	71.6	5.5e-20
WP_009967809.1|2508677_2509106_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	65.7	5.6e-43
WP_003229910.1|2509201_2509351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075058863.1|2509341_2510283_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	8.0e-58
WP_116362964.1|2510164_2510842_-	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	31.8	1.1e-05
WP_046160619.1|2510917_2511772_-	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	78.3	7.9e-121
WP_004398673.1|2511774_2512734_-	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	72.9	2.2e-135
WP_003229905.1|2512839_2513034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119123069.1|2512993_2513167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245994.1|2513163_2513421_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	6.4e-10
WP_004398626.1|2513417_2513987_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	61.0	1.5e-64
WP_003229902.1|2514060_2514201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004398958.1|2514230_2514461_-	helix-turn-helix transcriptional regulator	NA	A8ATK0	Listeria_phage	53.4	1.1e-08
WP_004398704.1|2514637_2514988_+	transcriptional regulator SknR	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	30.6	2.0e-06
>prophage 11
NZ_CP045816	Bacillus subtilis strain P5_B2 chromosome, complete genome	4103324	2568412	2667211	4103324	holin,tail,capsid,head,coat,tRNA,integrase,portal,protease,terminase	Bacillus_phage(41.86%)	115	2607871:2607898	2648933:2648960
WP_003229845.1|2568412_2568658_+|coat	spore coat protein F-like protein YraG	coat	NA	NA	NA	NA
WP_009967868.1|2568675_2569044_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_003229843.1|2569062_2570199_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.1	2.2e-14
WP_014480384.1|2570217_2570415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003246006.1|2570430_2570730_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014480386.1|2570992_2571415_-	aldehyde stress transcriptional regulator AdhR	NA	NA	NA	NA	NA
WP_014480387.1|2571597_2571792_+	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_014480388.1|2571922_2572972_+	formaldehyde dehydrogenase AdhA	NA	A0A2K9L339	Tupanvirus	41.8	8.6e-69
WP_003229836.1|2573104_2573614_+|protease	cysteine protease YraA	protease	NA	NA	NA	NA
WP_033881349.1|2573657_2575691_-	levanase	NA	S6ATV4	Bacillus_phage	37.8	8.2e-84
WP_003229834.1|2575847_2576675_-	PTS fructose transporter subunit IID	NA	NA	NA	NA	NA
WP_046160633.1|2576696_2577503_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_004399158.1|2577519_2578008_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_014480391.1|2578007_2578448_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_153952949.1|2578637_2581445_-	transcriptional regulator LevR	NA	NA	NA	NA	NA
WP_128422323.1|2582001_2582142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046160634.1|2582180_2583569_+	amino acid permease	NA	NA	NA	NA	NA
WP_003229828.1|2583664_2584297_-	membrane protein	NA	NA	NA	NA	NA
WP_004398526.1|2584449_2585277_+	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_004398891.1|2585470_2585971_+	RNA polymerase sigma factor SigV	NA	NA	NA	NA	NA
WP_046160635.1|2585970_2586828_+	anti-sigma-V factor rsiV	NA	NA	NA	NA	NA
WP_046160636.1|2586938_2588843_+	peptidoglycan O-acetyltransferase OatA	NA	B5WZU0	Pseudomonas_phage	34.8	6.0e-44
WP_087614863.1|2588977_2589268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046160637.1|2589511_2592676_-	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	37.6	2.1e-78
WP_046160638.1|2592691_2593276_-	transcriptional regulator FatR	NA	NA	NA	NA	NA
WP_046160639.1|2593498_2594041_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003229817.1|2594229_2594388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399102.1|2594544_2594694_-	YrzI family small protein	NA	NA	NA	NA	NA
WP_046160640.1|2595082_2595883_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_003229814.1|2596145_2596514_-	DUF2294 domain-containing protein	NA	NA	NA	NA	NA
WP_010886582.1|2596829_2599772_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_003229812.1|2599790_2600273_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_003237358.1|2600309_2600540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017696065.1|2600622_2601762_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	31.0	1.0e-22
WP_046160641.1|2601763_2602687_-	O-acetylserine dependent cystathionine beta-synthase	NA	A0A1W6JHY1	Lactococcus_phage	42.8	6.4e-60
WP_046160642.1|2602751_2603447_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_046160643.1|2603467_2604109_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014477495.1|2604301_2604505_+	YrzA family protein	NA	NA	NA	NA	NA
WP_038829651.1|2604541_2605243_-	YrrS family protein	NA	NA	NA	NA	NA
WP_024572771.1|2605307_2607062_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004399078.1|2607115_2607589_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
2607871:2607898	attL	TGAATTTTTGTGACCATCAGATCAATTG	NA	NA	NA	NA
WP_153952951.1|2608328_2608499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160644.1|2608584_2609463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160645.1|2609609_2611193_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	58.9	7.8e-74
WP_014480875.1|2611207_2611597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046160646.1|2611783_2612539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046160647.1|2612580_2613549_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.6	2.0e-64
WP_046160648.1|2613604_2613868_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	3.6e-24
WP_031600555.1|2613882_2614095_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.9e-15
WP_031600554.1|2614146_2614317_-	XkdX family protein	NA	NA	NA	NA	NA
WP_085185873.1|2614313_2614613_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	1.5e-39
WP_153952953.1|2614628_2615750_-	DUF2479 domain-containing protein	NA	M4ZRP1	Bacillus_phage	93.0	1.5e-196
WP_153952955.1|2615786_2617364_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	84.4	2.4e-256
WP_046160651.1|2617415_2619119_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	55.8	1.9e-179
WP_046160652.1|2619133_2619973_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.6	3.4e-92
WP_046160653.1|2619966_2624454_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	41.8	1.2e-66
WP_032725463.1|2624653_2625031_-	phage protein	NA	NA	NA	NA	NA
WP_046160654.1|2625096_2625708_-|tail	tail protein	tail	J7KKC8	Streptococcus_phage	35.1	3.6e-11
WP_046160655.1|2625722_2626115_-	phage protein	NA	NA	NA	NA	NA
WP_046160656.1|2626111_2626510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160657.1|2626509_2626824_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	37.3	1.7e-12
WP_046160658.1|2626813_2627116_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	4.7e-12
WP_046160659.1|2627133_2627595_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	58.9	1.0e-10
WP_046160660.1|2627620_2628907_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	44.7	5.9e-80
WP_046160661.1|2628946_2629684_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	57.7	9.0e-57
WP_153952957.1|2629631_2630939_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.7	7.1e-105
WP_041337954.1|2630939_2631131_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_144527404.1|2631143_2632853_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.4	2.3e-204
WP_019846969.1|2632849_2633365_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	43.4	2.2e-33
WP_153952959.1|2633592_2633958_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	2.5e-28
WP_153952961.1|2634067_2634541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153952963.1|2634871_2635042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153952965.1|2635251_2635800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153952967.1|2636045_2636612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003220264.1|2636867_2637410_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	63.9	5.8e-61
WP_046160667.1|2637409_2637859_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	58.1	5.2e-39
WP_046160668.1|2638109_2638310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160669.1|2638306_2638510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160670.1|2638506_2638899_-	hypothetical protein	NA	H6WU17	Pseudomonas_phage	63.4	3.3e-05
WP_046160671.1|2638898_2639597_-	hypothetical protein	NA	R9TQ23	Paenibacillus_phage	36.8	2.7e-26
WP_046160672.1|2640577_2640826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160673.1|2640822_2641203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160674.1|2641245_2641443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003237439.1|2641689_2641830_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_046160675.1|2641937_2642486_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	39.3	4.6e-05
WP_153952969.1|2642637_2642799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160676.1|2642785_2643640_-	AAA family ATPase	NA	Q4ZAS1	Staphylococcus_virus	29.4	2.9e-22
WP_046160677.1|2643590_2644433_-	DNA damage-inducible protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	47.5	9.0e-61
WP_041850161.1|2644432_2644657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003237453.1|2644658_2644988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052481590.1|2645029_2645227_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041850162.1|2645429_2645819_+	helix-turn-helix transcriptional regulator	NA	A0A0U4B088	Bacillus_phage	31.4	2.2e-06
WP_144414559.1|2646041_2646254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041850163.1|2646192_2647374_-	helix-turn-helix transcriptional regulator	NA	A0A288WGA2	Bacillus_phage	25.8	6.8e-14
WP_046160678.1|2647680_2648838_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	35.8	2.7e-63
WP_041850165.1|2648904_2649537_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.7	3.2e-34
2648933:2648960	attR	TGAATTTTTGTGACCATCAGATCAATTG	NA	NA	NA	NA
WP_003229802.1|2649543_2650812_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.8	9.5e-38
WP_046160679.1|2650830_2651760_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_014480416.1|2651765_2652419_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	31.7	3.2e-05
WP_153952971.1|2652570_2653653_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_003246199.1|2653783_2654065_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_003229795.1|2654082_2654499_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003225903.1|2654506_2654773_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_046160680.1|2654857_2657494_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.5	1.1e-67
WP_009967889.1|2657825_2658887_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003246180.1|2659042_2659771_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.9	2.5e-35
WP_003245954.1|2659792_2660614_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_038829647.1|2660674_2661325_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003229784.1|2661341_2661998_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003229780.1|2662032_2662164_-	DUF3918 domain-containing protein	NA	NA	NA	NA	NA
WP_003225893.1|2662185_2662377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082090407.1|2662388_2662913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014477509.1|2662968_2665365_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.2	1.4e-79
WP_014480423.1|2665389_2666040_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_046160682.1|2666095_2667211_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP045816	Bacillus subtilis strain P5_B2 chromosome, complete genome	4103324	2689407	2780006	4103324	holin,tail,capsid,head,coat,tRNA,portal,protease,terminase	Bacillus_phage(35.0%)	99	NA	NA
WP_003229725.1|2689407_2690553_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	3.4e-87
WP_003229723.1|2690579_2691608_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003222669.1|2691637_2691838_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003229718.1|2691830_2692835_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	1.1e-07
WP_003229717.1|2692845_2693451_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003229715.1|2693589_2694102_-	sporulation cell-cell signaling protein BofC	NA	NA	NA	NA	NA
WP_153952973.1|2694149_2695457_-	MFS transporter	NA	NA	NA	NA	NA
WP_015251559.1|2695527_2696556_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_015251558.1|2696793_2697441_+	serine/threonine protein kinase	NA	A0A2R3ZQF2	Marseillevirus	26.3	5.4e-05
WP_003229707.1|2697486_2697609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017696344.1|2697693_2698140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398683.1|2698146_2698287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044052486.1|2698450_2699905_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_015251555.1|2699945_2700668_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015714450.1|2700770_2701367_-	spore germination protein SgpA	NA	NA	NA	NA	NA
WP_015251553.1|2701514_2702678_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_003229691.1|2702794_2703901_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_015714452.1|2703887_2704757_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_003229687.1|2704710_2706306_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_046160685.1|2706408_2707596_+	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	27.4	1.7e-33
WP_004398582.1|2707555_2708098_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_015251550.1|2708122_2708980_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003222630.1|2708996_2709440_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_003229675.1|2709500_2710787_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_004399131.1|2710820_2711399_-	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_003229671.1|2711476_2711599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222623.1|2711719_2712004_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003229669.1|2712016_2712355_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003229668.1|2712357_2712666_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_014480452.1|2712812_2713679_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_021480238.1|2713671_2714466_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_014664846.1|2714614_2715421_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398901.1|2715422_2716103_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398811.1|2716155_2716674_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003222609.1|2716670_2717543_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003229650.1|2717573_2718587_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_042975111.1|2719801_2720044_-	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	59.5	2.3e-17
WP_042975110.1|2720488_2721304_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	72.6	1.5e-65
WP_046160686.1|2721348_2721771_-|holin	holin family protein	holin	D6R405	Bacillus_phage	86.5	3.0e-57
WP_031600554.1|2721824_2721995_-	XkdX family protein	NA	NA	NA	NA	NA
WP_085185873.1|2721991_2722291_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	1.5e-39
WP_153952953.1|2722306_2723428_-	DUF2479 domain-containing protein	NA	M4ZRP1	Bacillus_phage	93.0	1.5e-196
WP_046160689.1|2725052_2726927_-	autolysin	NA	M5AC19	Bacillus_phage	27.6	2.9e-51
WP_014479880.1|2726940_2727774_-|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	34.1	3.5e-33
WP_046160690.1|2727786_2731533_-	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	55.5	1.0e-100
WP_014479878.1|2731595_2731778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479877.1|2731789_2732152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160691.1|2732208_2732790_-	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	J7KKC8	Streptococcus_phage	40.1	1.4e-28
WP_046160692.1|2732782_2733202_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_031600548.1|2733198_2733591_-	hypothetical protein	NA	A0A0M5M1E5	Enterococcus_phage	37.9	3.0e-11
WP_046160693.1|2733590_2733917_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_046160694.1|2733906_2734200_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	33.0	2.6e-07
WP_046160695.1|2734254_2734647_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	63.6	3.5e-07
WP_046160696.1|2734674_2735880_-|capsid	phage major capsid protein	capsid	A0A2H4J824	uncultured_Caudovirales_phage	49.3	1.9e-75
WP_014479869.1|2735927_2736524_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	53.8	3.3e-49
WP_010329623.1|2736516_2737743_-|portal	phage portal protein	portal	A0A1J0MFU3	Staphylococcus_phage	39.4	1.4e-70
WP_014479867.1|2737747_2737954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160697.1|2737970_2739704_-|terminase	terminase large subunit	terminase	A0A1W6JPU1	Staphylococcus_phage	48.8	3.5e-144
WP_122060541.1|2739693_2740179_-|terminase	phage terminase small subunit P27 family	terminase	A0A1Q1PVW3	Staphylococcus_phage	36.0	4.2e-18
WP_046160698.1|2740412_2740598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160699.1|2740601_2740985_-	hypothetical protein	NA	A0A075M5R4	Enterococcus_phage	43.3	2.5e-18
WP_046160700.1|2740975_2741233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160701.1|2741347_2741890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042975080.1|2742352_2742733_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	76.4	2.0e-44
WP_042975079.1|2742729_2744085_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	65.4	1.3e-178
WP_052720008.1|2744032_2744392_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	57.8	2.8e-19
WP_046160702.1|2744664_2747076_-	phage-like protein	NA	A0A0A7RTG3	Clostridium_phage	57.2	8.6e-282
WP_042975077.1|2747095_2747278_-	hypothetical protein	NA	Q38589	Bacillus_phage	98.1	8.5e-25
WP_042975075.1|2747396_2749343_-	DNA polymerase	NA	S5M5X4	Brevibacillus_phage	67.2	1.4e-253
WP_046160703.1|2749339_2749882_-	hypothetical protein	NA	Q38587	Bacillus_phage	96.5	1.0e-41
WP_042975072.1|2749938_2750505_-	DUF2815 family protein	NA	S5MC21	Brevibacillus_phage	77.5	9.3e-78
WP_042975070.1|2750563_2750896_-	hypothetical protein	NA	A0A2P0ZLA7	Lactobacillus_phage	47.9	7.2e-22
WP_042975067.1|2750910_2752089_-	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	61.1	5.0e-134
WP_042975066.1|2752085_2752454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042975065.1|2752466_2752868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042975064.1|2753181_2753454_-	helix-turn-helix transcriptional regulator	NA	D6R414	Bacillus_phage	91.1	6.9e-39
WP_041345303.1|2753720_2754155_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	93.1	4.1e-65
WP_041345305.1|2754168_2754615_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	89.2	3.2e-73
WP_080332210.1|2754654_2756082_+	recombinase family protein	NA	Q9T200	Bacillus_phage	85.1	1.1e-231
WP_106611024.1|2756085_2756460_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_004398496.1|2756538_2757108_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_029318188.1|2757260_2758259_-	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_082090408.1|2758392_2759139_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_003229640.1|2759278_2760571_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_046160705.1|2760630_2763273_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	3.7e-161
WP_003222590.1|2763720_2763912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480462.1|2763930_2764956_-|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_014480463.1|2764988_2766710_-|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_014480464.1|2766840_2768133_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_014480465.1|2768162_2769137_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_014480466.1|2769133_2769922_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_014480467.1|2769911_2770856_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003222575.1|2770888_2771719_-	protein HemX	NA	NA	NA	NA	NA
WP_004399038.1|2771726_2773094_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014477563.1|2773323_2773821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229621.1|2773842_2774430_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_014480468.1|2774426_2776751_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	2.6e-182
WP_004398923.1|2776931_2778590_-|protease	Lon protease 2	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229613.1|2778743_2780006_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
>prophage 13
NZ_CP045816	Bacillus subtilis strain P5_B2 chromosome, complete genome	4103324	3354660	3362395	4103324	holin	Organic_Lake_phycodnavirus(50.0%)	9	NA	NA
WP_014480907.1|3354660_3355341_-|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
WP_014480908.1|3355357_3356278_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228370.1|3356289_3356943_-|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_014480909.1|3356959_3358105_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.7	6.0e-15
WP_024571735.1|3358388_3358922_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046160851.1|3358953_3359628_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_080480888.1|3359645_3360557_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046160853.1|3360576_3361230_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_003243370.1|3361252_3362395_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	6.2e-12
>prophage 14
NZ_CP045816	Bacillus subtilis strain P5_B2 chromosome, complete genome	4103324	3730854	3806188	4103324	coat,tRNA,protease,bacteriocin	Bacillus_phage(26.67%)	74	NA	NA
WP_046160958.1|3730854_3732525_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003243604.1|3732521_3732950_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003222002.1|3733262_3733394_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_010886632.1|3733350_3733503_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_024573031.1|3733527_3734874_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_003222006.1|3734886_3735048_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_017696261.1|3735044_3735764_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.7	8.1e-18
WP_038829818.1|3735756_3737067_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_080316907.1|3737056_3738217_+	insulinase family protein	NA	NA	NA	NA	NA
WP_041351297.1|3738221_3739502_+	insulinase family protein	NA	NA	NA	NA	NA
WP_046160959.1|3739498_3740200_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_041351296.1|3740205_3741582_-	YncE family protein	NA	NA	NA	NA	NA
WP_015250986.1|3741620_3742976_-	YncE family protein	NA	NA	NA	NA	NA
WP_021480843.1|3743205_3744351_+	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.5	1.7e-78
WP_009968329.1|3744334_3744454_+	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_003227545.1|3745055_3745928_-	agmatinase	NA	NA	NA	NA	NA
WP_003227543.1|3745988_3746819_-	spermidine synthase	NA	NA	NA	NA	NA
WP_015384942.1|3747020_3749096_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_014478299.1|3749123_3749558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003244446.1|3749696_3750215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003227536.1|3750228_3750888_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003222038.1|3750996_3751185_+	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
WP_003242889.1|3751227_3751647_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046160960.1|3751766_3753683_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	42.7	9.6e-143
WP_153952978.1|3754519_3755929_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_017696247.1|3755928_3756399_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227524.1|3756510_3757011_-	YwgA family protein	NA	NA	NA	NA	NA
WP_046160961.1|3757046_3758348_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.2	2.5e-25
WP_003222050.1|3758509_3758734_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_019712820.1|3758948_3759725_+	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_046160962.1|3759868_3760759_-	DMT family transporter	NA	NA	NA	NA	NA
WP_014481232.1|3760927_3761773_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_014481233.1|3761821_3762721_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_003235941.1|3762866_3763838_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003227507.1|3764107_3764872_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_046160963.1|3765004_3765784_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_046160964.1|3765798_3766998_-	transaminase BacF	NA	NA	NA	NA	NA
WP_014481236.1|3766998_3768183_-	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_076457451.1|3768179_3769598_-	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_003243359.1|3769616_3770378_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.8e-21
WP_003244300.1|3770380_3771088_-	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_009968341.1|3771077_3771692_-	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_003242790.1|3771843_3773082_-	MFS transporter	NA	NA	NA	NA	NA
WP_046160965.1|3773290_3774703_-	amino acid permease	NA	NA	NA	NA	NA
WP_046160966.1|3774702_3776403_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014478322.1|3776476_3778024_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_046160967.1|3778250_3779525_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_046160968.1|3779702_3780167_-	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_003242881.1|3780490_3780946_-|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
WP_015250965.1|3780938_3781790_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	3.7e-38
WP_003244201.1|3781803_3782751_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
WP_014478328.1|3782750_3783491_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	41.9	4.5e-48
WP_046160969.1|3783515_3784535_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014481245.1|3784537_3785260_-|coat	spore coat polysaccharide biosynthesis protein SpsF	coat	NA	NA	NA	NA
WP_031601100.1|3785252_3786374_-|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
WP_046160970.1|3786373_3787243_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048654797.1|3787243_3788413_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	26.9	3.2e-16
WP_046160971.1|3788433_3789858_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_014481251.1|3789862_3790633_-|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	4.4e-06
WP_003227448.1|3790952_3791498_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_003227446.1|3791541_3791913_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_015384975.1|3791974_3793297_-	purine permease	NA	NA	NA	NA	NA
WP_046161096.1|3793316_3793634_-	YwdI family protein	NA	NA	NA	NA	NA
WP_046160972.1|3793801_3795172_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015384978.1|3795196_3795874_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	45.7	1.8e-48
WP_015250953.1|3795887_3796694_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014665830.1|3796885_3797701_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003243437.1|3797791_3798040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015250950.1|3798133_3799573_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	26.9	3.5e-20
WP_046160974.1|3799569_3800955_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_015250948.1|3801256_3802027_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_003227423.1|3802065_3802896_-	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_003222155.1|3802935_3803238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160975.1|3803767_3806188_+|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
