The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045820	Bacillus subtilis strain MB9_B1 chromosome, complete genome	4263919	677136	685502	4263919		Synechococcus_phage(50.0%)	8	NA	NA
WP_029726598.1|677136_678432_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.4	1.3e-18
WP_029726599.1|678505_679231_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	1.2e-45
WP_003219409.1|679223_679478_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_029726600.1|679474_680158_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_029726601.1|680141_682370_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.0	7.2e-158
WP_003233947.1|682345_683776_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_003233945.1|683877_684918_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	2.8e-64
WP_015252651.1|684914_685502_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
>prophage 2
NZ_CP045820	Bacillus subtilis strain MB9_B1 chromosome, complete genome	4263919	1175908	1220106	4263919	coat,tRNA	Planktothrix_phage(25.0%)	49	NA	NA
WP_003232972.1|1175908_1176148_-|coat	spore coat protein YjzB	coat	NA	NA	NA	NA
WP_003232971.1|1176312_1177251_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003244890.1|1177273_1178515_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_003232967.1|1178590_1179376_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_003232965.1|1179567_1180554_+	oligopeptide ABC transporter ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-22
WP_003232964.1|1180550_1181540_+	oligopeptide ABC transporter ATP-binding protein AppF	NA	F2Y302	Organic_Lake_phycodnavirus	26.1	6.7e-07
WP_003245082.1|1181627_1183259_+	oligopeptide-binding protein AppA	NA	NA	NA	NA	NA
WP_003245828.1|1183334_1184285_+	oligopeptide ABC transporter permease AppB	NA	NA	NA	NA	NA
WP_003232961.1|1184301_1185213_+	oligopeptide ABC transporter permease AppC	NA	NA	NA	NA	NA
WP_003239298.1|1185417_1186170_+	DUF3603 family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	5.4e-49
WP_003245134.1|1186204_1187197_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003232957.1|1187940_1189578_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_003245554.1|1189685_1190621_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_003232954.1|1190624_1191542_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_014906294.1|1191546_1192623_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
WP_003245567.1|1192624_1193542_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.2e-05
WP_010886478.1|1193648_1194866_+	MFS transporter	NA	NA	NA	NA	NA
WP_003244921.1|1195029_1195608_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003245483.1|1195788_1196184_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003232944.1|1196226_1196883_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
WP_121572562.1|1197052_1197193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015383354.1|1197159_1197816_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_029726275.1|1197975_1199127_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_009967010.1|1199173_1201186_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003244944.1|1201223_1201391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245184.1|1201705_1202605_-	adaptor protein SpxH	NA	NA	NA	NA	NA
WP_003232928.1|1202601_1203000_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
WP_072692654.1|1203254_1203800_-	bifunctional muramidase/murein lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	60.4	3.7e-39
WP_014479452.1|1204003_1204576_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_014479453.1|1204700_1205069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245294.1|1205097_1205733_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003232918.1|1205751_1206552_+	NAD kinase	NA	NA	NA	NA	NA
WP_010886481.1|1206614_1207466_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003244765.1|1207478_1208213_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	M4Q4T6	Vibrio_phage	25.0	3.2e-06
WP_003232910.1|1208447_1210292_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003232909.1|1210540_1211251_+	thiaminase II	NA	NA	NA	NA	NA
WP_003232908.1|1211225_1211843_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_029726273.1|1211826_1212936_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_072173897.1|1212935_1213136_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_003232902.1|1213132_1213903_+	thiazole synthase	NA	NA	NA	NA	NA
WP_003232900.1|1213899_1214910_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_014479462.1|1214928_1215744_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003232896.1|1215879_1216656_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_072692635.1|1216756_1217440_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
WP_014479464.1|1217532_1217982_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_014479465.1|1218109_1218598_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_015252341.1|1218749_1219262_-|coat	Spore coat protein X	coat	NA	NA	NA	NA
WP_015252340.1|1219356_1219680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029726269.1|1219719_1220106_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP045820	Bacillus subtilis strain MB9_B1 chromosome, complete genome	4263919	1284498	1319292	4263919	portal,plate,holin,terminase	Bacillus_phage(28.12%)	46	NA	NA
WP_003245490.1|1284498_1285770_+	ATPase YjoB	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
WP_010886491.1|1285914_1287051_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	8.3e-94
WP_003245487.1|1287040_1287175_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_003232731.1|1287205_1287463_-	YciI family protein	NA	NA	NA	NA	NA
WP_003244876.1|1287583_1288537_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	74.1	7.3e-67
WP_003245254.1|1288576_1288954_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	6.1e-17
WP_003244789.1|1289059_1289662_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	49.2	3.8e-45
WP_003245071.1|1289738_1290575_+	manganese catalase	NA	NA	NA	NA	NA
WP_003232721.1|1290618_1291215_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003232719.1|1291377_1291719_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_003232712.1|1291896_1292076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245799.1|1292062_1292899_+	phage-like element PBSX protein XkdB	NA	S6BFM4	Thermus_phage	28.2	1.8e-24
WP_010886492.1|1292798_1293599_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	5.0e-61
WP_003245588.1|1293598_1293766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245290.1|1293850_1294201_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_109789043.1|1294204_1294399_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_003245797.1|1294519_1295029_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	38.6	1.9e-21
WP_003244697.1|1295144_1295942_+|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
WP_003245584.1|1295938_1297240_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.2	2.4e-153
WP_003245427.1|1297243_1298731_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
WP_003245836.1|1298750_1299578_+	phage-like element PBSX protein XkdF	NA	A0A1B1P7E4	Bacillus_phage	58.7	2.1e-54
WP_003232690.1|1299603_1300539_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_014479552.1|1300560_1300944_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
WP_009967053.1|1300940_1301297_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_003245226.1|1301293_1301779_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
WP_029726235.1|1301791_1302232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232679.1|1302235_1302454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245369.1|1302450_1303851_+	phage-like element PBSX protein XkdK	NA	A0A0A7S087	Clostridium_phage	39.3	2.3e-77
WP_003232677.1|1303852_1304296_+	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_015715734.1|1304386_1304833_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	37.7	5.9e-11
WP_072692631.1|1304874_1305015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153912175.1|1305015_1309692_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	43.8	1.1e-41
WP_029727048.1|1309684_1310344_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.2	1.1e-24
WP_003245730.1|1310359_1311337_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_015715735.1|1311336_1311603_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	36.4	1.7e-05
WP_015715736.1|1311660_1312086_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	6.6e-12
WP_015715737.1|1312078_1313125_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.0	2.4e-71
WP_015483131.1|1313108_1313687_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.1	5.1e-15
WP_015715738.1|1313683_1313956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029727047.1|1313958_1316400_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	35.2	1.1e-21
WP_029727046.1|1316417_1316744_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_014479563.1|1316740_1316905_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.9e-15
WP_029727045.1|1316948_1317788_+	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_015252265.1|1317840_1318110_+	hypothetical protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	4.8e-24
WP_014479566.1|1318122_1318386_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	6.1e-24
WP_029727044.1|1318398_1319292_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	68.8	2.0e-82
>prophage 4
NZ_CP045820	Bacillus subtilis strain MB9_B1 chromosome, complete genome	4263919	1836260	1842824	4263919		Bacillus_phage(50.0%)	6	NA	NA
WP_003231758.1|1836260_1836653_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
WP_014479842.1|1836612_1838715_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_003231754.1|1838732_1839722_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_003245105.1|1839771_1840392_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
WP_014476879.1|1840455_1841223_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	5.3e-52
WP_029726460.1|1841855_1842824_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	3.9e-52
>prophage 5
NZ_CP045820	Bacillus subtilis strain MB9_B1 chromosome, complete genome	4263919	2047017	2056626	4263919		Bacillus_phage(71.43%)	14	NA	NA
WP_015714072.1|2047017_2049618_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	34.5	5.6e-45
WP_015714073.1|2050075_2050717_-	endo-1,4-beta-xylanase XynA	NA	NA	NA	NA	NA
WP_029727213.1|2051349_2051589_-	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	65.8	1.2e-18
WP_038427749.1|2051759_2052098_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	31.7	5.5e-09
WP_004399488.1|2052131_2052488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029727212.1|2052589_2052874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029318060.1|2052907_2053237_-	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_029727211.1|2053715_2054027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029727210.1|2054182_2054395_-	hypothetical protein	NA	O64089	Bacillus_phage	77.5	6.0e-22
WP_029727209.1|2054398_2054650_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	97.6	4.6e-37
WP_080282471.1|2054715_2054895_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	89.3	6.0e-23
WP_029727208.1|2054915_2055833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029727207.1|2055993_2056224_+	membrane protein	NA	NA	NA	NA	NA
WP_029727206.1|2056233_2056626_-	UPF0715 family protein	NA	O64087	Bacillus_phage	84.5	1.0e-51
>prophage 6
NZ_CP045820	Bacillus subtilis strain MB9_B1 chromosome, complete genome	4263919	2069923	2098032	4263919	protease,head,integrase,capsid,holin,tail,portal,terminase	Bacillus_phage(30.0%)	33	2062789:2062804	2093986:2094001
2062789:2062804	attL	TTTTATCAATATCTCC	NA	NA	NA	NA
WP_153912183.1|2069923_2071063_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B2AQ00	Phage_Wrath	30.1	5.5e-29
WP_153912184.1|2072083_2072329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153912185.1|2072522_2072915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153912186.1|2072929_2073244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153912187.1|2073405_2073633_+	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	32.9	1.7e-06
WP_153912188.1|2073680_2073920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153912189.1|2074176_2074419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153912190.1|2074456_2074762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153912191.1|2074774_2076190_-	lipase	NA	NA	NA	NA	NA
WP_153912192.1|2076240_2076606_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_153912193.1|2076636_2076876_-	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	59.0	2.3e-17
WP_153912194.1|2077339_2078011_-	M15 family peptidase	NA	F8WPX5	Bacillus_phage	72.5	1.8e-64
WP_153912195.1|2078073_2078298_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	8.6e-19
WP_072692976.1|2078309_2078522_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.9e-15
WP_153912196.1|2078596_2078791_-	XkdX family protein	NA	NA	NA	NA	NA
WP_072692978.1|2078793_2079159_-	hypothetical protein	NA	O64053	Bacillus_phage	52.6	8.2e-19
WP_153912197.1|2079170_2080931_-	DUF2479 domain-containing protein	NA	M4ZRP1	Bacillus_phage	47.9	3.9e-58
WP_153912198.1|2080944_2082837_-	teichoic acid biosynthesis protein	NA	A0A2I7SBX4	Staphylococcus_phage	26.7	3.1e-37
WP_153912199.1|2082844_2084722_-	autolysin	NA	M5AC19	Bacillus_phage	26.4	9.7e-47
WP_153912200.1|2084750_2085584_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	34.7	2.9e-35
WP_153912201.1|2085583_2089876_-	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	46.2	6.2e-57
WP_086352667.1|2090094_2090472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153912202.1|2090589_2091204_-	hypothetical protein	NA	A0A1J0MFV0	Staphylococcus_phage	28.3	1.3e-11
WP_153912203.1|2091203_2091590_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_153912204.1|2091586_2091973_-	hypothetical protein	NA	Q9ZXF1	Bacillus_phage	33.1	1.9e-10
WP_153912205.1|2091972_2092299_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_086352662.1|2092295_2092565_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_153912206.1|2092582_2093743_-|capsid	phage major capsid protein	capsid	H7BUQ0	unidentified_phage	49.3	4.4e-74
WP_153912207.1|2093758_2094358_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U4J8K3	Exiguobacterium_phage	33.0	6.9e-15
2093986:2094001	attR	TTTTATCAATATCTCC	NA	NA	NA	NA
WP_153912208.1|2094287_2095520_-|portal	phage portal protein	portal	A0A0A8WJ25	Clostridium_phage	36.8	2.2e-68
WP_153912209.1|2095561_2097211_-|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	49.5	1.2e-157
WP_153912210.1|2097207_2097594_-	hypothetical protein	NA	A0A090C9N7	Clostridium_phage	42.3	2.2e-22
WP_153912211.1|2097705_2098032_-	HNH endonuclease	NA	A0A0K2CYS9	Paenibacillus_phage	55.6	2.2e-23
>prophage 7
NZ_CP045820	Bacillus subtilis strain MB9_B1 chromosome, complete genome	4263919	2179319	2237878	4263919	integrase	Bacillus_phage(94.81%)	93	2202533:2202554	2239692:2239713
WP_153912223.1|2179319_2179787_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI8	Catovirus	36.1	1.2e-14
WP_153912224.1|2179949_2180540_-	hypothetical protein	NA	O64195	Bacillus_phage	97.4	7.6e-107
WP_080481958.1|2180614_2180857_+	helix-turn-helix transcriptional regulator	NA	O64194	Bacillus_phage	98.8	3.6e-39
WP_010886533.1|2180858_2181044_-	hypothetical protein	NA	O64193	Bacillus_phage	100.0	2.1e-26
WP_009967444.1|2181127_2181340_-	hypothetical protein	NA	O64192	Bacillus_phage	100.0	5.2e-34
WP_153912225.1|2181385_2182060_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_153912226.1|2182094_2182256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068947650.1|2182291_2182627_-	hypothetical protein	NA	F8WPK8	Bacillus_phage	67.0	9.1e-41
WP_068947579.1|2182653_2182875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144454029.1|2182958_2183171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144454027.1|2183415_2183628_+	small, acid-soluble spore protein, alpha/beta type	NA	A0A1P8CX76	Bacillus_phage	90.0	4.0e-26
WP_153912227.1|2183955_2184648_-	hypothetical protein	NA	A0A1P8CX46	Bacillus_phage	70.9	1.6e-87
WP_153912228.1|2184660_2185014_-	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	95.7	5.8e-54
WP_153912229.1|2185340_2186180_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	96.1	1.3e-160
WP_153912230.1|2186236_2186581_-	hypothetical protein	NA	A0A1P8CX52	Bacillus_phage	99.1	2.3e-55
WP_144500603.1|2186695_2186911_-	hypothetical protein	NA	A0A1P8CX47	Bacillus_phage	94.4	3.8e-32
WP_144500602.1|2186894_2187200_-	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	92.1	1.5e-45
WP_116316022.1|2187204_2187372_-	hypothetical protein	NA	A0A1P8CX64	Bacillus_phage	90.9	1.2e-22
WP_144500601.1|2187512_2188130_+	VanZ family protein	NA	NA	NA	NA	NA
WP_004399328.1|2188917_2189160_-	thioredoxin family protein	NA	A0A1P8CX24	Bacillus_phage	100.0	1.4e-38
WP_153912231.1|2189156_2190161_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	79.8	2.1e-149
WP_124058330.1|2190277_2190697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153912232.1|2192218_2192950_-	endonuclease	NA	A0A024FSJ1	Bacillus_phage	68.6	1.4e-65
WP_153912466.1|2193099_2193843_-	hypothetical protein	NA	A0A1P8CX40	Bacillus_phage	88.3	1.7e-119
WP_153912233.1|2193853_2194246_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	91.5	8.4e-62
WP_019712231.1|2194245_2194599_-	hypothetical protein	NA	O64171	Bacillus_phage	98.3	2.7e-59
WP_059293319.1|2194650_2194896_-	hypothetical protein	NA	O64168	Bacillus_phage	67.5	2.6e-08
WP_153912234.1|2194927_2195395_-	hypothetical protein	NA	O64167	Bacillus_phage	78.2	1.2e-62
WP_153912468.1|2195409_2195622_-	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	79.7	2.3e-29
WP_153912235.1|2195643_2196006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153912236.1|2196045_2196375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032721793.1|2196725_2197073_-	hypothetical protein	NA	O64164	Bacillus_phage	92.2	1.6e-51
WP_032721791.1|2197069_2197498_-	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	63.9	9.9e-32
WP_153912237.1|2197540_2197723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101502272.1|2197817_2197997_-	hypothetical protein	NA	O64161	Bacillus_phage	94.9	4.9e-25
WP_071579003.1|2198123_2198273_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_153912470.1|2198650_2198833_-	hypothetical protein	NA	A0A1P8CX23	Bacillus_phage	90.0	6.1e-23
WP_153912238.1|2198845_2199073_-	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	85.3	7.1e-29
WP_153256824.1|2199111_2199477_-	hypothetical protein	NA	O64156	Bacillus_phage	83.5	3.9e-53
WP_153912239.1|2199734_2200013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041352125.1|2200048_2200774_-	site-specific DNA-methyltransferase	NA	W8EBG5	Geobacillus_phage	59.3	5.9e-77
WP_106294053.1|2200939_2201287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069322666.1|2201326_2201824_-	hypothetical protein	NA	A0A1P8CX28	Bacillus_phage	90.9	4.6e-81
WP_121572605.1|2201823_2201979_-	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	96.1	1.7e-21
WP_064814903.1|2201971_2202187_-	hypothetical protein	NA	O64150	Bacillus_phage	97.2	3.9e-37
WP_153912240.1|2202198_2202849_-	hypothetical protein	NA	A0A1P8CX16	Bacillus_phage	49.0	2.7e-20
2202533:2202554	attL	ATTTTATTTTTATTCTTTATTT	NA	NA	NA	NA
WP_153912241.1|2202923_2206841_-	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	96.3	0.0e+00
WP_153912242.1|2206853_2208584_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	99.0	0.0e+00
WP_153912243.1|2208583_2209720_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	98.9	3.3e-223
WP_004399302.1|2209735_2211250_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	100.0	3.6e-286
WP_153912244.1|2211264_2211735_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	97.4	1.3e-85
WP_004399537.1|2211777_2212749_-	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	100.0	1.7e-180
WP_041338504.1|2212832_2213747_-	hypothetical protein	NA	A0A1P8CX09	Bacillus_phage	90.8	5.6e-157
WP_041338755.1|2213765_2214134_-	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	99.2	5.5e-63
WP_153912245.1|2215188_2215569_-	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	97.6	4.2e-66
WP_113712893.1|2215631_2215928_-	hypothetical protein	NA	O64136	Bacillus_phage	98.0	6.8e-48
WP_153912246.1|2216015_2217776_-	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	98.5	0.0e+00
WP_144453827.1|2217772_2218597_-	gamma-polyglutamate hydrolase PghZ	NA	O64134	Bacillus_phage	97.1	5.8e-145
WP_017697067.1|2218694_2219090_-	hypothetical protein	NA	O64133	Bacillus_phage	94.7	7.9e-68
WP_153912247.1|2219126_2220329_-	hypothetical protein	NA	A0A2C9CZ84	Yersinia_phage	37.5	1.7e-41
WP_153912248.1|2220394_2220616_-	hypothetical protein	NA	O64132	Bacillus_phage	90.4	1.1e-31
WP_153912249.1|2220686_2221361_+	hypothetical protein	NA	A0A1P8CX02	Bacillus_phage	97.9	1.7e-78
WP_153912250.1|2221430_2222243_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	95.2	7.2e-148
WP_153912251.1|2222806_2223631_-	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	72.0	7.4e-100
WP_113766170.1|2223759_2223912_+	hypothetical protein	NA	A0A1P8CWZ1	Bacillus_phage	82.0	1.6e-16
WP_041352063.1|2223993_2224344_-	hypothetical protein	NA	O64127	Bacillus_phage	86.2	1.4e-52
WP_153912252.1|2224345_2224702_-	hypothetical protein	NA	O64126	Bacillus_phage	90.7	4.2e-44
WP_153912253.1|2224694_2225003_-	hypothetical protein	NA	O64125	Bacillus_phage	88.2	7.8e-47
WP_032721718.1|2225024_2225540_-	hypothetical protein	NA	A0A1Z1DA37	Bacillus_phage	54.7	1.7e-46
WP_032721716.1|2225572_2225977_-	hypothetical protein	NA	K4JWE2	Caulobacter_phage	39.8	8.8e-22
WP_101502251.1|2226100_2226475_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	96.8	5.4e-58
WP_153912472.1|2226490_2226712_-	hypothetical protein	NA	O64123	Bacillus_phage	84.7	1.3e-27
WP_101502250.1|2226912_2227191_+	hypothetical protein	NA	O64122	Bacillus_phage	87.0	1.1e-39
WP_095353266.1|2227388_2227679_-	hypothetical protein	NA	A0A127AWI5	Bacillus_phage	51.1	2.0e-15
WP_041335828.1|2227716_2227953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153912254.1|2227977_2228616_-	DUF3920 family protein	NA	NA	NA	NA	NA
WP_072692921.1|2228668_2228872_-	hypothetical protein	NA	O64115	Bacillus_phage	95.5	1.1e-33
WP_061891124.1|2228880_2229045_-	hypothetical protein	NA	O64114	Bacillus_phage	88.9	1.9e-20
WP_072692922.1|2229157_2229379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072692923.1|2229409_2229856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068947540.1|2229942_2230698_-	antirepressor	NA	A0A1P8CWY0	Bacillus_phage	82.9	7.0e-113
WP_153912474.1|2230739_2231165_-	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	90.3	4.0e-65
WP_068947538.1|2231295_2231766_-	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	45.7	9.3e-23
WP_041352905.1|2231762_2232098_-	hypothetical protein	NA	A0A1P8CWX6	Bacillus_phage	92.8	1.8e-44
WP_041338559.1|2232133_2232373_-	hypothetical protein	NA	A0A1P8CWW8	Bacillus_phage	98.7	9.7e-37
WP_099043105.1|2232491_2232731_-	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	100.0	3.3e-37
WP_041338565.1|2232803_2233103_-	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	99.0	3.4e-47
WP_041338568.1|2233270_2233492_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	100.0	1.1e-34
WP_041338571.1|2233722_2234694_-|integrase	integrase	integrase	A0A1P8CWX4	Bacillus_phage	100.0	2.2e-180
WP_041338574.1|2234712_2236059_-	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	100.0	2.6e-251
WP_061187763.1|2236143_2237205_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8CWW9	Bacillus_phage	99.7	1.9e-201
WP_061187761.1|2237409_2237655_-	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	100.0	3.9e-41
WP_041338583.1|2237671_2237878_-	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	100.0	1.4e-31
2239692:2239713	attR	ATTTTATTTTTATTCTTTATTT	NA	NA	NA	NA
>prophage 8
NZ_CP045820	Bacillus subtilis strain MB9_B1 chromosome, complete genome	4263919	2241882	2316215	4263919	integrase,holin,tail	Bacillus_phage(86.15%)	79	2246363:2246379	2319476:2319492
WP_153912259.1|2241882_2242014_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	93.0	6.1e-17
WP_153912260.1|2242025_2242241_-	hypothetical protein	NA	O64089	Bacillus_phage	93.0	1.0e-29
WP_153912261.1|2242244_2242496_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	98.8	4.6e-37
WP_003231000.1|2242566_2242746_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	96.6	3.6e-28
WP_153912262.1|2242777_2243035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153912263.1|2243056_2243884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153912475.1|2243974_2244202_-	helix-turn-helix domain-containing protein	NA	O64085	Bacillus_phage	92.0	2.4e-32
WP_153912264.1|2244405_2245107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153912265.1|2245171_2246038_-	DUF3102 domain-containing protein	NA	D2XQ12	Bacillus_virus	61.1	2.5e-37
WP_153912266.1|2246054_2247674_-	hypothetical protein	NA	A0A1P8CWT8	Bacillus_phage	37.3	2.1e-34
2246363:2246379	attL	ACTCAATTTCATCTTTT	NA	NA	NA	NA
WP_153912267.1|2247883_2248084_-	hypothetical protein	NA	F8WPK8	Bacillus_phage	65.4	5.1e-15
WP_033885296.1|2248130_2248385_-	hypothetical protein	NA	A0A088C4P6	Shewanella_sp._phage	44.2	2.4e-09
WP_153912268.1|2248548_2250150_-	DUF4942 domain-containing protein	NA	A0A2I7RNS1	Vibrio_phage	28.7	1.1e-14
WP_153912269.1|2250198_2252085_-	hypothetical protein	NA	A0A0H3UZM4	Geobacillus_virus	32.3	1.1e-05
WP_153912270.1|2252397_2253615_-	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	98.3	2.5e-229
WP_134853524.1|2253905_2254157_-	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	95.8	4.2e-30
WP_017696861.1|2254175_2254352_-	hypothetical protein	NA	O64080	Bacillus_phage	92.3	4.4e-10
WP_153912271.1|2255249_2255750_-	hypothetical protein	NA	A0A1P8CWU7	Bacillus_phage	96.8	1.9e-66
WP_153912273.1|2256125_2256305_+	hypothetical protein	NA	A0A1P8CWT4	Bacillus_phage	98.3	8.9e-27
WP_153912275.1|2256349_2258875_+	hypothetical protein	NA	O64076	Bacillus_phage	93.2	0.0e+00
WP_144500930.1|2259128_2259404_+	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	95.6	9.2e-39
WP_144500931.1|2259460_2260714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003230977.1|2261273_2261474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144500932.1|2261485_2262679_+	metallophosphoesterase	NA	W5RV85	Staphylococcus_phage	42.1	4.4e-69
WP_153912277.1|2262897_2263422_+	hypothetical protein	NA	U5J9P3	Bacillus_phage	37.3	5.3e-19
WP_061891088.1|2263528_2264449_+	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	99.7	9.2e-176
WP_003230970.1|2264435_2266205_+	hypothetical protein	NA	O64069	Bacillus_phage	99.8	0.0e+00
WP_153912279.1|2266222_2267743_+	hypothetical protein	NA	O64068	Bacillus_phage	98.0	1.9e-279
WP_153912281.1|2267773_2269210_+	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	99.2	5.2e-266
WP_019712260.1|2269234_2269771_+	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	98.9	3.0e-94
WP_003230962.1|2269809_2270826_+	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	99.4	6.4e-186
WP_019712890.1|2270861_2271332_+	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	99.4	1.1e-81
WP_153912283.1|2271346_2271742_+	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	98.5	6.1e-68
WP_009967519.1|2271738_2271993_+	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	100.0	2.2e-39
WP_153912285.1|2271976_2272627_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	99.5	1.2e-121
WP_153912287.1|2272623_2273130_+	hypothetical protein	NA	O64060	Bacillus_phage	83.3	3.2e-77
WP_153912288.1|2273126_2273855_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	42.6	2.7e-45
WP_010328117.1|2273890_2274685_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	38.6	4.3e-20
WP_074794686.1|2274702_2275314_+	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	99.5	7.5e-65
WP_153912290.1|2275313_2275541_+	hypothetical protein	NA	A0A1P8CWR2	Bacillus_phage	97.3	2.7e-36
WP_120028272.1|2275604_2275961_+	hypothetical protein	NA	O64055	Bacillus_phage	89.8	1.9e-52
WP_153912292.1|2275960_2276905_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	35.5	1.7e-20
WP_042976260.1|2276901_2277321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072692670.1|2277322_2277463_+	XkdX family protein	NA	NA	NA	NA	NA
WP_153912294.1|2277500_2277989_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	72.3	2.1e-57
WP_153912296.1|2277988_2278408_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	86.3	1.7e-60
WP_153912477.1|2278421_2279423_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8CWP6	Bacillus_phage	98.8	1.0e-191
WP_068947501.1|2279623_2279959_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	33.7	1.7e-10
WP_068947500.1|2280035_2280662_+	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	35.6	1.5e-28
WP_153912298.1|2280715_2287609_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	81.7	0.0e+00
WP_072692673.1|2287649_2288411_+|tail	phage tail protein	tail	A0A1P8CWP8	Bacillus_phage	98.7	2.0e-131
WP_153912300.1|2288423_2291066_+	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	93.6	0.0e+00
WP_068947646.1|2291080_2291899_+	hypothetical protein	NA	O64043	Bacillus_phage	66.1	7.3e-100
WP_068947496.1|2291911_2294146_+	hypothetical protein	NA	A0A0A0RUQ7	Bacillus_phage	38.6	1.9e-65
WP_153912302.1|2294324_2295392_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1P8CWN6	Bacillus_phage	60.0	2.1e-78
WP_017696898.1|2295507_2295900_+	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	100.0	2.2e-62
WP_071581350.1|2295920_2296172_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	96.4	7.8e-37
WP_153912304.1|2296329_2297490_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	25.5	9.9e-34
WP_113712850.1|2297779_2298313_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_113712849.1|2298335_2299187_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_121572572.1|2299360_2300506_-	ThiF family adenylyltransferase	NA	A0A1V0SCZ9	Indivirus	20.6	7.3e-05
WP_113712847.1|2300510_2301341_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_142743355.1|2301352_2302591_-	MFS transporter	NA	NA	NA	NA	NA
WP_153912306.1|2302703_2303954_-	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	97.1	3.1e-235
WP_128473977.1|2303946_2304279_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	97.3	2.5e-54
WP_004399073.1|2304452_2304788_+	hypothetical protein	NA	O64029	Bacillus_phage	100.0	2.1e-53
WP_019712874.1|2304830_2305187_-	hypothetical protein	NA	O64028	Bacillus_phage	98.3	7.2e-60
WP_128992107.1|2305192_2305660_-	DUF4879 domain-containing protein	NA	O64027	Bacillus_phage	96.1	2.4e-79
WP_009967548.1|2305892_2306009_+	type I toxin-antitoxin system toxin BsrG	NA	Q96209	Bacillus_phage	100.0	9.8e-11
WP_080316884.1|2306632_2307109_-	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	65.8	5.1e-61
WP_041056186.1|2307209_2307698_-	DUF600 family protein	NA	NA	NA	NA	NA
WP_153912308.1|2307704_2309615_-	TIGR01741 family protein	NA	A0A1P8CWI7	Bacillus_phage	91.5	4.2e-215
WP_153912309.1|2309714_2310272_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	94.1	5.9e-101
WP_153912311.1|2310772_2311663_+	endonuclease	NA	O64020	Bacillus_phage	91.9	1.3e-102
WP_152425456.1|2311913_2312069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041056256.1|2312248_2312764_-	hypothetical protein	NA	O64017	Bacillus_phage	99.4	7.6e-95
WP_086352798.1|2312939_2313137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109962774.1|2313944_2315579_+	recombinase family protein	NA	O64015	Bacillus_phage	77.5	2.0e-242
WP_004399080.1|2315624_2316215_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	28.6	4.9e-13
2319476:2319492	attR	ACTCAATTTCATCTTTT	NA	NA	NA	NA
>prophage 9
NZ_CP045820	Bacillus subtilis strain MB9_B1 chromosome, complete genome	4263919	2454390	2460486	4263919		Staphylococcus_phage(66.67%)	8	NA	NA
WP_003223904.1|2454390_2454984_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.0e-14
WP_015714192.1|2454973_2455729_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.8	9.4e-09
WP_015251790.1|2456009_2456534_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003223910.1|2456547_2456922_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003223915.1|2457034_2457499_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_014480160.1|2457531_2458728_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
WP_029726753.1|2458742_2459390_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
WP_004398763.1|2459400_2460486_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	5.1e-56
>prophage 10
NZ_CP045820	Bacillus subtilis strain MB9_B1 chromosome, complete genome	4263919	2695611	2725056	4263919	plate,holin,tail,portal,terminase	Bacillus_phage(36.36%)	37	NA	NA
WP_015714309.1|2695611_2697207_+	type II toxin-antitoxin system toxin ribonuclease YqcG	NA	A0A1P8CWI7	Bacillus_phage	60.9	3.8e-76
WP_015714310.1|2697221_2697800_+	type II toxin-antitoxin system antitoxin YqcF	NA	NA	NA	NA	NA
WP_009967791.1|2697917_2698064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229947.1|2698060_2698423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399085.1|2698438_2698918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229946.1|2699082_2699901_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	74.4	1.0e-64
WP_003246208.1|2699945_2700368_-|holin	holin family protein	holin	D6R405	Bacillus_phage	73.7	3.3e-48
WP_003246010.1|2700412_2701306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229944.1|2701393_2701558_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	2.7e-14
WP_009967793.1|2701554_2701890_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_003229943.1|2701899_2703000_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	56.1	1.7e-19
WP_003229942.1|2703002_2703275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229941.1|2703271_2703850_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.8	1.5e-14
WP_003229940.1|2703833_2704880_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.5	8.3e-72
WP_004398572.1|2704872_2705298_-	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	36.4	1.5e-11
WP_003229938.1|2705310_2705574_-	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_004398524.1|2705570_2706551_-	hypothetical protein	NA	H7BV96	unidentified_phage	32.0	2.1e-40
WP_004398548.1|2706563_2707223_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.7	4.8e-25
WP_029727093.1|2707215_2711973_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.2	1.3e-44
WP_021480099.1|2711975_2712113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229933.1|2712154_2712604_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	41.1	2.7e-11
WP_074794433.1|2713411_2713501_+	type I toxin-antitoxin system toxin BsrH	NA	NA	NA	NA	NA
WP_015714312.1|2713872_2714316_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.4	3.2e-25
WP_015714313.1|2714318_2715719_-|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	39.1	1.8e-74
WP_032679171.1|2715719_2715911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015714315.1|2715907_2716345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015714316.1|2716357_2716861_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.9	2.9e-38
WP_015714317.1|2716857_2717220_-	DUF3599 family protein	NA	A0A249XXE9	Clostridium_phage	39.3	6.3e-11
WP_153912322.1|2717216_2717612_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_153912324.1|2717615_2717927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229922.1|2717937_2718873_-|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	65.0	8.6e-105
WP_153912326.1|2718891_2719866_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	56.2	8.3e-58
WP_044455008.1|2719912_2720560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153912328.1|2720599_2721517_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	40.0	8.9e-54
WP_153912330.1|2721513_2723046_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.8	2.1e-148
WP_113712833.1|2723015_2724344_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	63.4	6.9e-156
WP_029727095.1|2724336_2725056_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	55.0	5.9e-61
>prophage 11
NZ_CP045820	Bacillus subtilis strain MB9_B1 chromosome, complete genome	4263919	2728935	2736619	4263919		uncultured_Caudovirales_phage(60.0%)	16	NA	NA
WP_153912333.1|2728935_2729391_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.3	4.9e-37
WP_029727251.1|2729650_2729917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029727252.1|2730055_2730262_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	70.1	9.3e-20
WP_153912335.1|2730343_2730772_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	62.0	9.9e-40
WP_080334920.1|2730867_2731017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113712831.1|2731007_2731949_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.2	1.8e-57
WP_142671577.1|2731830_2732508_-	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	32.2	8.7e-06
WP_029727256.1|2732584_2733439_-	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	82.4	6.7e-112
WP_029727257.1|2733441_2734401_-	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	73.9	5.7e-136
WP_153912337.1|2734506_2734701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142671574.1|2734660_2734834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029727259.1|2734830_2735088_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	4.9e-10
WP_029727260.1|2735084_2735654_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	61.0	9.1e-65
WP_032679254.1|2735727_2735868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029727261.1|2735870_2736110_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021480133.1|2736265_2736619_+	helix-turn-helix domain-containing protein	NA	A0A0A7RTK4	Clostridium_phage	48.6	8.0e-11
>prophage 12
NZ_CP045820	Bacillus subtilis strain MB9_B1 chromosome, complete genome	4263919	2878034	2931506	4263919	coat,tRNA,protease	uncultured_Mediterranean_phage(12.5%)	56	NA	NA
WP_003229725.1|2878034_2879180_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	3.4e-87
WP_003229723.1|2879206_2880235_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003222669.1|2880264_2880465_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003229718.1|2880457_2881462_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	1.1e-07
WP_003229717.1|2881472_2882078_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003229715.1|2882216_2882729_-	sporulation cell-cell signaling protein BofC	NA	NA	NA	NA	NA
WP_003246197.1|2882776_2884084_-	MFS transporter	NA	NA	NA	NA	NA
WP_029727129.1|2884154_2885180_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_003246159.1|2885417_2886065_+	serine/threonine protein kinase	NA	A0A2R3ZQF2	Marseillevirus	26.3	5.4e-05
WP_003229707.1|2886110_2886233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029727128.1|2886317_2886764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029727127.1|2886770_2886911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029727126.1|2887074_2888529_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_004398802.1|2888569_2889292_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_029727125.1|2889394_2889991_-	spore germination protein SgpA	NA	NA	NA	NA	NA
WP_029727124.1|2890138_2891302_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_029727123.1|2891418_2892525_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_029318181.1|2892511_2893381_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_029727122.1|2893334_2894930_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_029727121.1|2895032_2896220_+	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	27.4	1.7e-33
WP_004398582.1|2896179_2896722_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_029727120.1|2896745_2897603_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003222630.1|2897619_2898063_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_029727119.1|2898123_2899410_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_004399131.1|2899443_2900022_-	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_003229671.1|2900099_2900222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222623.1|2900342_2900627_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003229669.1|2900639_2900978_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003229668.1|2900980_2901289_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_004398649.1|2901435_2902302_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_029727118.1|2902294_2903089_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_004398624.1|2903237_2904044_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398901.1|2904045_2904726_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398811.1|2904778_2905297_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003222609.1|2905293_2906166_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003229650.1|2906196_2907210_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_015251546.1|2907301_2907997_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_004398496.1|2908033_2908603_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_038427816.1|2908755_2909751_-	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_072692713.1|2909884_2910631_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_029727116.1|2910772_2912065_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_029727115.1|2912124_2914767_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	4.9e-161
WP_003222590.1|2915214_2915406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029727114.1|2915424_2916450_-|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_029727113.1|2916482_2918210_-|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_015384279.1|2918340_2919633_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_029727112.1|2919662_2920637_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_029727111.1|2920633_2921422_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_072692716.1|2921411_2922356_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003222575.1|2922388_2923219_-	protein HemX	NA	NA	NA	NA	NA
WP_004399038.1|2923226_2924594_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003229624.1|2924823_2925321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014114673.1|2925342_2925930_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003229618.1|2925926_2928251_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	3.4e-182
WP_014477564.1|2928431_2930090_-|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229613.1|2930243_2931506_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
>prophage 13
NZ_CP045820	Bacillus subtilis strain MB9_B1 chromosome, complete genome	4263919	3506261	3513996	4263919	holin	Organic_Lake_phycodnavirus(50.0%)	9	NA	NA
WP_038427914.1|3506261_3506942_-|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
WP_038427915.1|3506958_3507879_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228370.1|3507890_3508544_-|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_038427916.1|3508560_3509706_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.3	6.0e-15
WP_014478002.1|3509989_3510523_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038427917.1|3510554_3511229_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_072692820.1|3511246_3512158_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038427919.1|3512177_3512831_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_003243370.1|3512853_3513996_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	6.2e-12
>prophage 14
NZ_CP045820	Bacillus subtilis strain MB9_B1 chromosome, complete genome	4263919	3887639	3966459	4263919	coat,protease,tRNA,bacteriocin	Bacillus_phage(25.0%)	79	NA	NA
WP_029726075.1|3887639_3889310_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003243604.1|3889306_3889735_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003222002.1|3890047_3890179_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_010886632.1|3890135_3890288_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_024573031.1|3890312_3891659_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_003222006.1|3891671_3891833_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_003227564.1|3891829_3892549_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	7.3e-19
WP_029726077.1|3892541_3893852_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_108029087.1|3893841_3895002_+	insulinase family protein	NA	NA	NA	NA	NA
WP_029726079.1|3895006_3896287_+	insulinase family protein	NA	NA	NA	NA	NA
WP_029726080.1|3896283_3896985_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_015250987.1|3896990_3898367_-	YncE family protein	NA	NA	NA	NA	NA
WP_003227552.1|3898405_3899761_-	YncE family protein	NA	NA	NA	NA	NA
WP_029726081.1|3899757_3899958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015714890.1|3899990_3901136_+	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.0	1.1e-77
WP_009968329.1|3901119_3901239_+	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_015714892.1|3901495_3901975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015714893.1|3902123_3902912_+	membrane protein	NA	NA	NA	NA	NA
WP_015714894.1|3902898_3903573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015714895.1|3903573_3904380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015714896.1|3904382_3905030_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.0	7.7e-28
WP_029726083.1|3905022_3905583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003227545.1|3905631_3906504_-	agmatinase	NA	NA	NA	NA	NA
WP_003227543.1|3906564_3907395_-	spermidine synthase	NA	NA	NA	NA	NA
WP_046664002.1|3907596_3909672_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_015250981.1|3909964_3910483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003243167.1|3910496_3911156_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003222038.1|3911264_3911453_+	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
WP_003227535.1|3911495_3911915_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046664003.1|3912034_3913951_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	42.7	4.8e-142
WP_046664004.1|3914787_3916197_-	MFS transporter	NA	NA	NA	NA	NA
WP_046664005.1|3916196_3916667_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227524.1|3916778_3917279_-	YwgA family protein	NA	NA	NA	NA	NA
WP_024571616.1|3917314_3918616_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003222050.1|3918777_3919002_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_029726231.1|3919216_3919993_+	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_029726230.1|3920136_3921027_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003227511.1|3921194_3922040_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_029726229.1|3922088_3922988_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_003235941.1|3923134_3924106_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003242896.1|3924375_3925140_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_029726228.1|3925271_3926051_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_029726227.1|3926065_3927265_-	transaminase BacF	NA	NA	NA	NA	NA
WP_029726226.1|3927265_3928450_-	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_015250972.1|3928446_3929865_-	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_029726225.1|3929883_3930645_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	3.7e-21
WP_003244300.1|3930647_3931355_-	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_009968341.1|3931344_3931959_-	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_003242790.1|3932110_3933349_-	MFS transporter	NA	NA	NA	NA	NA
WP_029726224.1|3933558_3934971_-	amino acid permease	NA	NA	NA	NA	NA
WP_029726223.1|3934970_3936671_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_029726222.1|3936744_3938292_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003227482.1|3938518_3939793_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_029726220.1|3939968_3940433_-	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_003242881.1|3940756_3941212_-|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
WP_015250965.1|3941204_3942056_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	3.7e-38
WP_029726219.1|3942069_3943017_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	9.8e-72
WP_014478328.1|3943016_3943757_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	41.9	4.5e-48
WP_029726217.1|3943781_3944801_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_029726216.1|3944803_3945526_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_029726215.1|3945518_3946640_-|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
WP_029726214.1|3946639_3947509_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014481249.1|3947509_3948679_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	28.1	1.2e-15
WP_029726213.1|3948699_3950124_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_015250957.1|3950128_3950899_-|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
WP_014481253.1|3951218_3951764_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_003227446.1|3951807_3952179_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_015384975.1|3952240_3953563_-	purine permease	NA	NA	NA	NA	NA
WP_003243806.1|3953582_3953900_-	YwdI family protein	NA	NA	NA	NA	NA
WP_014478341.1|3955469_3956147_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	45.7	1.8e-48
WP_015250953.1|3956159_3956966_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014665830.1|3957156_3957972_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003243437.1|3958062_3958311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029726209.1|3958404_3959844_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.4	3.1e-21
WP_029726208.1|3959840_3961226_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_014481261.1|3961527_3962298_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_003227423.1|3962336_3963167_-	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_003222155.1|3963206_3963509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029726207.1|3964038_3966459_+|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
