The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	726	7546	4716545	integrase,holin,lysis,transposase	Enterobacteria_phage(37.5%)	10	1606:1620	12788:12802
WP_032207510.1|726_1194_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	88.4	1.3e-69
WP_001151823.1|1342_1525_-	hypothetical protein	NA	NA	NA	NA	NA
1606:1620	attL	TACGTTTCGCCAGTT	NA	NA	NA	NA
WP_001092844.1|1681_2215_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.6e-100
WP_000731267.1|2265_2610_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	7.2e-57
WP_005042508.1|2614_2830_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	98.6	4.5e-33
WP_162281787.1|2906_3254_-	DUF826 domain-containing protein	NA	E7DYV2	Enterobacteria_phage	80.7	6.6e-26
WP_000111980.1|3497_4022_-	hypothetical protein	NA	A0A0N7CGH9	Escherichia_phage	42.9	1.9e-32
WP_044325913.1|4913_5123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171769597.1|5578_6806_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	3.2e-176
WP_024259622.1|6781_7546_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	50.8	7.1e-65
12788:12802	attR	TACGTTTCGCCAGTT	NA	NA	NA	NA
>prophage 2
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	234121	289067	4716545	tRNA,transposase	Shigella_phage(12.5%)	47	NA	NA
WP_088895425.1|234121_235349_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000109297.1|235679_236828_-	MFS transporter	NA	NA	NA	NA	NA
WP_094096743.1|238350_239518_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	8.4e-182
WP_000213098.1|239524_240142_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_046891701.1|240152_242597_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	1.6e-219
WP_000886683.1|242835_244128_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067768.1|244218_245562_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.6	8.1e-80
WP_001295343.1|245572_246184_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077089.1|246338_250367_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228475.1|250501_250996_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|251540_252506_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043614.1|252628_254395_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202167.1|254395_256117_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.4e-20
WP_001241678.1|256158_256863_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|257147_257366_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001179707.1|258419_259424_-|transposase	IS110-like element ISSfl8 family transposase	transposase	NA	NA	NA	NA
WP_000839282.1|260140_260338_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000976828.1|260349_260841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854917.1|260837_261212_-	toxin	NA	NA	NA	NA	NA
WP_001280958.1|261258_261633_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001220314.1|261795_262017_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
WP_005011624.1|262079_262556_-	RadC family protein	NA	NA	NA	NA	NA
WP_005011597.1|262571_263045_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.5	1.9e-12
WP_001234584.1|263386_264208_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.3	7.2e-47
WP_000088744.1|264307_264481_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_077515298.1|264600_265050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021107.1|265958_267029_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203522.1|267025_267931_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000544701.1|267927_270312_-	dynamin family protein	NA	NA	NA	NA	NA
WP_001069775.1|270529_271402_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000282124.1|271732_271915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171769599.1|272020_273249_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000422755.1|273550_273976_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	7.5e-48
WP_000290499.1|275093_275606_-	colibactin self-protection protein ClbS	NA	NA	NA	NA	NA
WP_000151891.1|275640_275922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167701220.1|275967_277130_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	2.6e-167
WP_000705119.1|278376_279489_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	26.0	1.3e-27
WP_001139133.1|279560_280928_+	MFS transporter	NA	NA	NA	NA	NA
WP_000435415.1|281563_281983_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_000624671.1|281979_282330_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_001072392.1|282360_283953_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	4.8e-172
WP_000624715.1|284486_284777_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.7	1.9e-34
WP_000422761.1|284773_285199_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	87.6	3.6e-42
WP_046891699.1|286198_286843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226519.1|286863_287133_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000502842.1|287211_287850_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.9e-55
WP_001285504.1|287834_289067_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.9	5.0e-60
>prophage 3
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	305754	336174	4716545	protease,integrase,holin,transposase	Salmonella_phage(18.18%)	23	306480:306493	338122:338135
WP_001138064.1|305754_308721_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
306480:306493	attL	CGATCCGCAGGTCG	NA	NA	NA	NA
WP_000147567.1|308723_309284_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|309409_309760_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|309962_310976_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001334766.1|311185_312016_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001209508.1|312128_312920_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001300030.1|314262_315213_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_001411475.1|315277_316222_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000088352.1|316402_317542_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.3e-67
WP_001293435.1|317695_319693_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625669.1|319755_321033_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_085949416.1|321312_322475_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.0e-50
WP_000145481.1|322541_322760_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049828170.1|322810_323200_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.9e-61
WP_165770242.1|323278_324491_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	2.2e-169
WP_042196155.1|325666_325873_-	helicase	NA	NA	NA	NA	NA
WP_000282110.1|325979_326543_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001258873.1|327917_329753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070931.1|329853_330141_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_005067490.1|330112_331642_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000279879.1|331811_333029_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	1.7e-44
WP_000934041.1|333546_335823_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|335853_336174_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
338122:338135	attR	CGACCTGCGGATCG	NA	NA	NA	NA
>prophage 4
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	372570	399917	4716545	tail,capsid,transposase,lysis,terminase	Salmonella_phage(79.17%)	26	NA	NA
WP_000980402.1|372570_373056_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.9	1.3e-67
WP_000763310.1|376123_376243_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.4e-12
WP_001281016.1|376257_376560_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_001207660.1|376614_377130_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046144.1|377139_378312_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.7e-203
WP_000905012.1|378454_379021_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.2	3.2e-86
WP_000983057.1|379048_379585_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	97.2	3.1e-99
WP_000829134.1|380343_380745_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.5	5.1e-54
WP_001039925.1|380737_381169_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	2.2e-71
WP_001442125.1|381264_381693_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	3.8e-47
WP_000727844.1|381689_382067_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	1.4e-16
WP_001069905.1|382068_382581_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000171568.1|382561_382777_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868179.1|382780_382984_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	4.0e-31
WP_000059202.1|383525_384176_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	1.6e-110
WP_000742516.1|384179_385238_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.9e-180
WP_000216257.1|385254_386088_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
WP_001098464.1|386230_387997_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	98.5	0.0e+00
WP_004982020.1|389135_390017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960487.1|390000_391650_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001217575.1|391942_392176_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|392186_392375_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_000099181.1|393463_395002_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000612610.1|395050_395398_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_001333468.1|395394_395775_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_024181292.1|399818_399917_-|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	100.0	8.0e-06
>prophage 5
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	499816	565594	4716545	integrase,holin,transposase,tail	Stx2-converting_phage(24.44%)	71	498949:499008	529692:532135
498949:499008	attL	TGCGTAAGCGTACAGCCTGAACCGTCTGGTCAGAATCTGACGAATTAGACAAAGTGGTGT	NA	NA	NA	NA
WP_000099181.1|499816_501355_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000784361.1|501480_501861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109196.1|502176_503229_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_001295305.1|503386_504139_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_000931389.1|504340_505381_-	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_000053437.1|505374_506523_-	galactokinase	NA	NA	NA	NA	NA
WP_000191538.1|506526_507573_-	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_001265437.1|507582_508599_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_000096885.1|508859_510332_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	1.2e-12
WP_001147440.1|510399_511188_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|511316_511466_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000102000.1|511631_512405_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|512404_513094_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891687.1|513096_514155_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
WP_005040312.1|514155_514974_-	bifunctional pyridoxal phosphate/fructose-1,6-bisphosphate phosphatase	NA	NA	NA	NA	NA
WP_024259580.1|515209_515896_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	46.6	6.7e-46
WP_094096507.1|515825_516994_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
WP_000702027.1|517238_517661_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	1.8e-70
WP_000787424.1|517949_518357_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
WP_000379550.1|518559_518712_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	57.4	3.5e-08
WP_000435415.1|520457_520877_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_046891694.1|520873_521224_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.1e-39
WP_001333468.1|521342_521723_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612610.1|521719_522067_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_000099181.1|522115_523654_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_094096743.1|524228_525396_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	8.4e-182
WP_000839570.1|526141_526357_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	95.8	1.0e-32
WP_000259035.1|527095_527434_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.2	3.8e-10
WP_000537609.1|527439_527895_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	44.6	3.3e-17
WP_000247612.1|527888_528473_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	5.2e-15
WP_001009072.1|528469_528835_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	6.7e-21
WP_001139093.1|528819_529365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001122284.1|529345_529711_+	DUF3383 family protein	NA	A0A077KGV4	Edwardsiella_phage	50.0	1.8e-21
WP_001333468.1|529786_530167_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612610.1|530163_530511_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_000099181.1|530559_532098_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000016416.1|533279_533471_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	52.9	1.7e-07
529692:532135	attR	TGCGTAAGCGTACAGCCTGAACCGTCTGGTCAGAATCTGACGAATTAGACAAAGTGGTGTCCACCAAATAAGTAGTGGGAACCAAAGTGTCAGATATGCAGAAAAATGTGAATCCCGGCAGGCGAAAAGGCTGCCCTAATTATCCTCCCGAATTTAAACAGCAGCTCGTTGCTGCCTCCTGTGAACCCGGGATATCCATCTCAAAACTTGCTCTTGAAAATGGCATTAACGCCAATCTGTTGTTCAAATGGCGACAACAATGGCGCGAGGGAAAGCTGCTATTACCTTCTTCAGAGAGCCCCCAGCTACTTCCTGTGACTCTCGATGCAGCTGCCGAACAGCCAGAATCGCTCGCAGAGGATCCGGAAACCCTCAGTATCAGCTGTGAGGTAACGTTCCGGCACGGGACGCTCCGCTTCAATGGCAATGTCAGCGAAAAGCTCCTGACTCTGCTGATACAGGAACTGAAGCGATGATCCCGTTACCTTCCGGGACCAAAATTTGGCTGGTTGCCGGTATCACCGATATGAGAAATGGCTTCAACGGCCTGGCGGCAAAGGTGCAGACGACGCTGAAAGACGCTCCGATGTCAGGTCACGTTTTTATCTTCCGTGGGCGTAATGGCAGTCAGGTAAAGCTCCTCTGGTCTACCGGCGATGGACTGTGTCTGCTGACCAAACGGCTGGAGCGCGGCCGCTTCGCCTGGCCGTCAGCCCGGGATGGCAAAGTGTTCCTCACACCGGCACAGCTGGCGATGCTCCTTGAAGGTATCGACTGGCGGCAGCCTAAAAGACTGCTTACGTCCCTGACTATGTTGTAAGCCTCTTTATCCTGGTCGACGCTGAATGAGCCTGGTAATATACCCGGTATGAGCAGCTCACTTCCTGACGATATCAATGCACTGAAACGTCTCCTTGCCGAACAGGAGGCGCTGAACCGTGCCCTGCTGGAAAAGCTGAACGAGCGTGAACGCGAAATAGACCATCTGCAGGCACAGCTGGATAAGCTGCGCCGGATGAACTTCGGCAGCCGCTCCGAAAAAGTCTCCCGTCGTATCGCACAGATGGAAGCTGACCTGAAGGCACTTCAGAAAGAAAGTGATACCCTTACCGGTCGGGTTGACGACCCGGCCGTGCAGCGCCCGCTGCGTCAAACCCGCACCCGCAAACCGTTCCCCGAATCACTCCCCCGCGATGAAAAACGGCTGCTGCCGGCAGCGTCATGCTGCCCGGAATGTGGAGGCTCACTGAGCTATCCGGGTGAGGATGCCGCCGAACAGCTGGAGTTGATGCGCAGCGTCTTCCGGGTTATCCGGACTGTACGTGAAAAGCATGCCTGTACTCAGTGCGATGCCATCGTGCAGGCCCCCGCGCCTTCACGGCCCATCGAGCGGGGTATCGCAGGACCGGGGCTGCTGGCCCGCGTGCTGATCTCAAAGTATGCAGAGCACACCCCGCTGTACCGCCAGTCTGAAATGTACGGCCGCCAGGGCGTGGAGCTGAGTCGTTCACTGCTGTCGGGCTGGGTGGATGCATGCTGCCGGCTACTGTCACCGCTGGAAGAAGCGCTTCAGGACTATGTGCTGACTGACGGTAAGCTCCATGCTGATGACACGCCTGTCCCGGTGCTGTTGCCAGGCAATAAGAAAACGAAGACCGGGCGGTTATGGACCTACGTTCGTGACGACCGTAACGCCGGGTCAACGCTGGCGCCGGCGGTGTGGTTCGCTTACAGCCCGGACAGAAAAGGCATCCATCCGCAGACCCATCTTGCGGGGTTCAGTGGTGTACTGCAGGCGGATGCATACGCCGGGTTCAACGAGCTGTACCGGGATGGCCGGATAACGGAAGCCGCCTGTTGGGCTCACGCCCGCCGTAAAATCCACGATGTGCACGTTCGCACCCCGTCAGCCCTGACGGAGGAAGCGCTGAAACGGATCGGCGAACTGTACGCCATCGAGGCAGAGATAAGGGGAATGACGGCGGAGCAGCGCCTTGCCGAACGTCAGTTGAAAACGAAACCGCTGCTGAAATCCCTGGAAAGCTGGCTGCGTGAAAAGATGAAAACCCTGTCGCGACACTCAGAACTGGCGAAAGCGTTCGCATACGCCCTGAACCAGTGGCCGGCGCTGACGTACTATGCAGATGATGGCTGGGCTGAGGCGGACAATAACATCGCTGAAAATGCGTTGCGGATGGTCAGTCTGGGCCGCAAAAACTACCTGTTCTTCGGTTCGGATCATGGAGGAGAGCGGGGAGCGCTGCTGTACAGCCTGATCGGGACGTGCAAACTGAACGGAGTGGAGCCAGAAAGCTACCTCCGCTATGTACTTGACGTCATAGCCGACTGGCCGATAAACCGGGTCGGCGAACTGCTCCCCTGGCGCGTAGCACTGCCGACTGAATAACACATCCCCGTCAATACGGTTCTTGCTGCACGCTTAC	NA	NA	NA	NA
WP_000101350.1|534500_534905_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	47.9	3.1e-19
WP_000228829.1|534946_535129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000079879.1|535112_537134_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	68.1	4.0e-46
WP_000010338.1|537130_537841_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	32.8	1.2e-21
WP_000890114.1|537840_538143_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.0	1.6e-23
WP_000122177.1|538139_539009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000068495.1|538989_539667_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	34.1	2.8e-28
WP_001191863.1|539679_540036_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	48.1	2.1e-19
WP_005028613.1|540032_540485_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	63.1	1.2e-35
WP_005043481.1|540487_541270_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	43.6	1.1e-52
WP_088895425.1|541567_542796_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000012213.1|542859_543213_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	45.0	1.3e-16
WP_077897081.1|544063_544585_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	56.0	3.6e-44
WP_153933088.1|544883_545582_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	93.5	1.7e-126
WP_153933089.1|545934_547347_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	51.3	2.4e-74
WP_000099181.1|547750_549289_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000612610.1|549337_549685_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_001333468.1|549681_550062_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000951300.1|550187_551129_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	1.7e-23
WP_000345414.1|551125_551845_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	5.4e-22
WP_000115275.1|551882_552926_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_000097580.1|554096_554888_-	cell division protein CpoB	NA	NA	NA	NA	NA
WP_001295306.1|554897_555419_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_005031646.1|555453_556746_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_000030650.1|556878_558033_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000090104.1|558097_558526_-	colicin uptake protein TolR	NA	NA	NA	NA	NA
WP_000131314.1|558529_559222_-	Tol-Pal system protein TolQ	NA	NA	NA	NA	NA
WP_001098375.1|559218_559623_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000034601.1|559772_560066_-	cyd operon protein YbgE	NA	NA	NA	NA	NA
WP_000270282.1|560065_560179_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_000568275.1|560193_561333_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000884361.1|561348_562917_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_001324497.1|563512_563740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153933088.1|564895_565594_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	93.5	1.7e-126
>prophage 6
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	814935	876187	4716545	protease,tRNA,transposase	uncultured_Mediterranean_phage(18.75%)	56	NA	NA
WP_001266492.1|814935_816006_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000667313.1|816061_817189_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	3.6e-89
WP_000007629.1|817211_817544_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934825.1|817571_819419_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|819429_820401_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|820529_820877_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_005030662.1|821053_821938_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_005004736.1|822236_822776_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|822926_823376_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150462.1|823379_824483_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	3.1e-53
WP_001021161.1|824571_825042_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_000801125.1|825061_825481_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_000742101.1|825558_826536_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_000154044.1|826513_827032_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_046891687.1|827085_828048_-	1-deoxyxylulose-5-phosphate synthase YajO	NA	NA	NA	NA	NA
WP_000006809.1|828102_829965_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_000347225.1|829989_830889_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_046891686.1|830888_831131_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000668685.1|831336_832785_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_001276309.1|832838_833429_-	protein deglycase YajL	NA	NA	NA	NA	NA
WP_000705861.1|833391_834303_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_001138904.1|834470_834962_+	nucleotide binding protein YajQ	NA	NA	NA	NA	NA
WP_001000997.1|835095_836454_-	MFS transporter	NA	NA	NA	NA	NA
WP_000971338.1|836602_837493_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_000019869.1|837504_837834_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_000179812.1|837833_838448_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_000467180.1|838437_840429_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_000098438.1|841858_843334_-	muropeptide MFS transporter AmpG	NA	NA	NA	NA	NA
WP_005030624.1|843377_843956_-	lipoprotein	NA	NA	NA	NA	NA
WP_000973449.1|844260_844578_+	transcriptional regulator BolA	NA	NA	NA	NA	NA
WP_001198392.1|844921_846220_+	trigger factor	NA	NA	NA	NA	NA
WP_000122253.1|846465_847089_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130306.1|847214_848489_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.6	2.3e-132
WP_004981092.1|848676_851031_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	3.6e-224
WP_001043542.1|851239_851512_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_000969381.1|851703_853575_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_000680312.1|853725_854097_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000099182.1|854404_855943_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	1.8e-293
WP_000612626.1|855991_856339_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|856335_856716_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000817229.1|857089_857785_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
WP_001238231.1|857849_859550_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000113027.1|859649_860468_+	HMP-PP phosphatase	NA	NA	NA	NA	NA
WP_000884589.1|860620_861079_+	DNA-binding transcriptional regulator DecR	NA	NA	NA	NA	NA
WP_000878030.1|862874_863894_+|transposase	IS110-like element ISEc11 family transposase	transposase	NA	NA	NA	NA
WP_001163619.1|864177_864324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001256174.1|864316_866098_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
WP_000780338.1|866278_866617_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_000684902.1|866646_867933_+	ammonium transporter AmtB	NA	NA	NA	NA	NA
WP_004981073.1|867980_868841_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_000779826.1|869058_869631_+	lipoprotein	NA	NA	NA	NA	NA
WP_171769601.1|869723_871070_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000409911.1|871099_871411_-	MGMT family protein	NA	NA	NA	NA	NA
WP_000878140.1|871789_872143_+	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
WP_094110543.1|873361_874518_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_088895425.1|874958_876187_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 7
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	905006	1010355	4716545	integrase,protease,tRNA,transposase	Stx2-converting_phage(25.71%)	92	899115:899154	975636:975675
899115:899154	attL	GATGCCTGATGCGACGCTGGCGCGTCTTATCATGCCTACA	NA	NA	NA	NA
WP_000186627.1|905006_905486_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365186.1|905689_906484_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_005039895.1|906621_906963_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	73.6	2.7e-40
WP_000083974.1|907170_909675_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	1.1e-114
WP_000883032.1|909936_910869_+	glutaminase A	NA	NA	NA	NA	NA
WP_000982153.1|910871_912164_+	amino acid permease	NA	NA	NA	NA	NA
WP_001026747.1|912288_912696_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000970323.1|912696_913155_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|913151_914069_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_001157540.1|914214_914892_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
WP_005030189.1|914878_915658_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001295322.1|915720_916575_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148945.1|916635_917445_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|917434_918058_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|918028_918715_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_075319160.1|925306_925648_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_088895425.1|925736_926965_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001157963.1|928456_929551_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460156.1|929619_930522_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|930751_931234_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|931311_932127_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_024259574.1|932216_933998_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	7.8e-38
WP_001047109.1|935021_935774_-	antitermination protein	NA	Q8SBE4	Shigella_phage	99.2	9.0e-137
WP_001061406.1|936783_937581_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
WP_000767125.1|937600_937990_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	1.3e-67
WP_000210161.1|937986_938313_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.0e-53
WP_000066917.1|938309_938963_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_073817732.1|938962_939457_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	1.2e-84
WP_000099181.1|940057_941596_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_153933092.1|941644_941992_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_046891683.1|941988_942369_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	98.4	3.5e-65
WP_000230709.1|942481_942937_-	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	65.7	1.1e-44
WP_000617443.1|943195_943477_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000284450.1|944080_944623_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001350215.1|944615_944975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167544906.1|946629_947843_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.3	4.3e-165
WP_001019377.1|948911_949745_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	46.7	2.0e-20
WP_000042978.1|949737_949917_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_005040399.1|949913_950981_+	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	37.1	5.2e-13
WP_001065741.1|950973_951168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|951164_951428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094096507.1|951697_952866_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
WP_046891682.1|953032_953452_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	74.2	4.2e-35
WP_000624671.1|953448_953799_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_001072392.1|953829_955422_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	4.8e-172
WP_001063816.1|955714_956842_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_000083332.1|957306_957504_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	3.9e-07
WP_000251023.1|957701_958583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000772640.1|958725_959940_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.2	3.7e-132
WP_000893276.1|960295_961549_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	4.9e-95
WP_001285290.1|961560_962664_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	6.3e-62
WP_000749890.1|962951_964007_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	8.5e-117
WP_000174671.1|964045_964447_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189552.1|964504_965749_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|965840_966299_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|966559_968017_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602112.1|968073_968688_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_005041144.1|969530_970727_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000528872.1|970705_971272_-	RNA ligase RtcB family protein	NA	U5PUG1	Bacillus_phage	30.3	2.0e-08
WP_001059855.1|971517_971970_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226164.1|971966_973022_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207568.1|973092_973878_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_005039557.1|973822_975562_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006234.1|975785_976283_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
975636:975675	attR	TGTAGGCATGATAAGACGCGCCAGCGTCGCATCAGGCATC	NA	NA	NA	NA
WP_005025508.1|976458_977208_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	36.9	5.8e-19
WP_001225679.1|978284_979025_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|978995_979763_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|979968_980547_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973134.1|980786_983231_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|983273_983747_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118027.1|983900_984671_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_001297205.1|985890_986622_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|986686_987154_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|987150_987873_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|987906_988662_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644682.1|988733_990092_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001230983.1|990767_991568_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648584.1|991808_992723_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001140195.1|999282_999855_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|1000042_1001074_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|1001066_1001720_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|1001759_1002575_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|1002692_1003097_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094009.1|1003093_1003801_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|1003911_1005630_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005039402.1|1005682_1006507_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239180.1|1006706_1007417_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635540.1|1007490_1007853_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185292.1|1007849_1008395_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|1008560_1008761_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|1008747_1009008_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176566.1|1009056_1010355_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	1275642	1319139	4716545	transposase	Stx2-converting_phage(40.0%)	33	NA	NA
WP_005041144.1|1275642_1276839_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_073817651.1|1278847_1278928_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_094096507.1|1279697_1280866_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
WP_001137007.1|1282317_1283550_+	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_001037377.1|1283590_1284871_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_000222495.1|1286149_1286917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000657676.1|1286913_1287171_+	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_162281793.1|1287124_1288096_+	YjiK family protein	NA	NA	NA	NA	NA
WP_001141187.1|1288163_1289342_+	MFS transporter	NA	NA	NA	NA	NA
WP_162281794.1|1289354_1290011_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	43.0	5.4e-37
WP_001295597.1|1290158_1290842_+	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
WP_000211971.1|1290838_1291300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000568428.1|1291312_1292485_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000340766.1|1292549_1293461_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000986206.1|1293453_1293846_-	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_120795393.1|1293842_1293926_-	iraD leader peptide	NA	NA	NA	NA	NA
WP_000062561.1|1295294_1296125_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000833687.1|1297040_1297817_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000208186.1|1298031_1299492_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
WP_000438559.1|1299572_1300757_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_000872005.1|1302465_1302969_-	type 1 fimbria minor subunit FimG	NA	NA	NA	NA	NA
WP_001244838.1|1302981_1303512_-	type 1 fimbria minor subunit FimF	NA	NA	NA	NA	NA
WP_001162467.1|1303521_1303887_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_000824117.1|1309316_1309856_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000695563.1|1309920_1310469_-	metal ABC transporter substrate-binding lipoprotein/fibrin-binding adhesin FimA	NA	NA	NA	NA	NA
WP_000435415.1|1310744_1311164_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_000624671.1|1311160_1311511_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_001072392.1|1311541_1313134_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	4.8e-172
WP_001243643.1|1313164_1313458_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.9e-51
WP_000099204.1|1313506_1315045_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	6.3e-294
WP_153933094.1|1315292_1316461_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	4.9e-182
WP_000856939.1|1317246_1317930_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_134800437.1|1317982_1319139_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	9.8e-66
>prophage 9
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	1414855	1551033	4716545	protease,transposase	Stx2-converting_phage(27.27%)	100	NA	NA
WP_000811566.1|1414855_1415131_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000558725.1|1415247_1416873_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_032335874.1|1416956_1417991_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	39.5	1.2e-67
WP_088895425.1|1418058_1419286_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000101670.1|1419353_1419992_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547762.1|1420001_1420400_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012566.1|1420417_1421077_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511951.1|1421127_1421826_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_001034109.1|1425451_1429309_+|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.2	2.0e-224
WP_005045429.1|1430969_1433237_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_001217059.1|1433561_1434323_+	DNA-binding transcriptional activator AdiY	NA	NA	NA	NA	NA
WP_024259688.1|1436678_1438322_+	phosphoethanolamine transferase EptA	NA	NA	NA	NA	NA
WP_046891667.1|1438318_1438987_+	two-component system response regulator BasR	NA	NA	NA	NA	NA
WP_001052136.1|1438987_1440088_+	two-component system sensor histidine kinase PmrB	NA	NA	NA	NA	NA
WP_000797656.1|1440063_1440153_-	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
WP_000919721.1|1440264_1441767_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	4.1e-56
WP_000169196.1|1442031_1442910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000288547.1|1442906_1445135_-	clamp-binding protein CrfC	NA	NA	NA	NA	NA
WP_001300891.1|1446312_1446648_+	phnA family protein	NA	NA	NA	NA	NA
WP_001131343.1|1446807_1447251_+	VOC family metalloprotein YjdN	NA	NA	NA	NA	NA
WP_001193422.1|1447383_1448172_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	1.5e-25
WP_000991980.1|1448196_1449213_+	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001193503.1|1449338_1450118_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_001072392.1|1450692_1452285_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	4.8e-172
WP_000624671.1|1452315_1452666_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_000435415.1|1452662_1453082_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_001183287.1|1453267_1453585_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_000819746.1|1453653_1453983_+	protein YjdP	NA	NA	NA	NA	NA
WP_000059947.1|1454129_1454888_-	phosphonate metabolism protein PhnP	NA	NA	NA	NA	NA
WP_001110504.1|1454889_1455324_-	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
WP_000971894.1|1455310_1455868_-	ribose 1,5-bisphosphokinase	NA	NA	NA	NA	NA
WP_000586303.1|1455867_1457004_-	alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000611423.1|1457000_1457681_-	phosphonate C-P lyase system protein PhnL	NA	G9BWD6	Planktothrix_phage	33.6	1.7e-17
WP_001075525.1|1457791_1458550_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
WP_000002283.1|1458546_1459392_-	alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ	NA	NA	NA	NA	NA
WP_005045173.1|1459384_1460449_-	alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnI	NA	NA	NA	NA	NA
WP_000171616.1|1460448_1461033_-	phosphonate C-P lyase system protein PhnH	NA	NA	NA	NA	NA
WP_000542751.1|1461029_1461482_-	phosphonate C-P lyase system protein PhnG	NA	NA	NA	NA	NA
WP_000099181.1|1461729_1463268_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000612626.1|1463316_1463664_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_153933095.1|1463660_1464041_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	97.6	6.0e-65
WP_000950648.1|1465093_1465486_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_077897571.1|1465492_1467094_+|transposase	IS66-like element ISEc49 family transposase	transposase	A0A218MNE7	uncultured_virus	36.4	7.7e-77
WP_000221546.1|1467786_1468356_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270997.1|1468522_1468906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013309.1|1468902_1469361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171769603.1|1471167_1472396_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	4.2e-176
WP_005024678.1|1472406_1472841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074489.1|1473290_1474484_-	MFS transporter	NA	NA	NA	NA	NA
WP_001403387.1|1474619_1476344_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287499.1|1476344_1477292_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015718.1|1477291_1479034_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750143.1|1479030_1480368_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001387241.1|1480373_1482569_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001063816.1|1482973_1484101_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_005026022.1|1487606_1488320_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_000270377.1|1488430_1488847_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_000155655.1|1488850_1489207_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000357691.1|1489241_1492064_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|1492317_1492854_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_001295689.1|1492952_1493234_-	YjcB family protein	NA	NA	NA	NA	NA
WP_000019553.1|1493663_1494404_+	CSS-motif domain-containing protein	NA	NA	NA	NA	NA
WP_000019358.1|1496510_1496834_-	superoxide response transcriptional regulator SoxS	NA	NA	NA	NA	NA
WP_000412428.1|1496919_1497384_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_000106873.1|1497928_1499278_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.7e-157
WP_000402207.1|1499429_1501079_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_134800436.1|1501525_1502222_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	93.1	1.1e-125
WP_000832577.1|1502291_1503941_-	cation/acetate symporter ActP	NA	NA	NA	NA	NA
WP_001014565.1|1503937_1504252_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_005045745.1|1506802_1508239_+	ammonia-forming nitrite reductase cytochrome c552 subunit	NA	NA	NA	NA	NA
WP_001296647.1|1508283_1508850_+	cytochrome c nitrite reductase pentaheme subunit	NA	NA	NA	NA	NA
WP_000220281.1|1508846_1509518_+	cytochrome c nitrite reductase Fe-S protein	NA	NA	NA	NA	NA
WP_000195158.1|1509514_1510471_+	cytochrome c nitrite reductase subunit NrfD	NA	NA	NA	NA	NA
WP_071821661.1|1510490_1512209_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_001032546.1|1512201_1512585_+	heme lyase NrfEFG subunit NrfF	NA	NA	NA	NA	NA
WP_000662604.1|1512581_1513178_+	heme lyase NrfEFG subunit NrfG	NA	NA	NA	NA	NA
WP_000789585.1|1513519_1514833_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_077897533.1|1515805_1517953_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	2.7e-32
WP_046891665.1|1518150_1519617_-	multidrug efflux transporter outer membrane subunit MdtP	NA	NA	NA	NA	NA
WP_001275142.1|1519613_1521665_-	multidrug efflux transporter permease subunit MdtO	NA	NA	NA	NA	NA
WP_004988094.1|1522713_1522989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001066003.1|1523197_1525183_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.1	8.7e-147
WP_001063816.1|1525474_1526602_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_167544906.1|1528144_1529357_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.3	4.3e-165
WP_000624671.1|1529761_1530112_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_000435424.1|1530108_1530528_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	76.3	8.5e-36
WP_000477614.1|1532094_1532421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171769604.1|1533525_1534754_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001223346.1|1535208_1537299_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_129592959.1|1538096_1539252_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	7.5e-66
WP_000099177.1|1540538_1542077_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	8.2e-294
WP_000612610.1|1542125_1542473_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_001333468.1|1542469_1542850_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001293267.1|1543063_1543795_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076296.1|1543975_1546417_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	1.7e-67
WP_001177640.1|1546455_1546881_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|1547085_1548384_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|1548487_1548685_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|1548766_1549771_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|1549773_1551033_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 10
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	1912645	1980289	4716545	tRNA,transposase	Stx2-converting_phage(25.0%)	56	NA	NA
WP_171769605.1|1912645_1913874_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	1.2e-175
WP_094112384.1|1913947_1914277_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_001140251.1|1914475_1914757_+	peptidylprolyl isomerase PpiC	NA	NA	NA	NA	NA
WP_001295253.1|1914843_1916319_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000365778.1|1916468_1917359_+	HTH-type transcriptional activator IlvY	NA	NA	NA	NA	NA
WP_000785598.1|1917355_1918900_-	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_001127401.1|1918902_1920753_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_000208520.1|1920817_1921747_-	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_000983255.1|1921766_1922030_-	acetolactate synthase 2 small subunit	NA	NA	NA	NA	NA
WP_001012626.1|1922026_1923673_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	5.7e-67
WP_113771618.1|1923675_1923726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311244.1|1923812_1923911_-	ilv operon leader peptide	NA	NA	NA	NA	NA
WP_005044890.1|1924261_1925422_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_000841001.1|1925709_1926048_-	macrodomain Ori organization protein MaoP	NA	NA	NA	NA	NA
WP_000379241.1|1926166_1927006_+	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
WP_001131174.1|1932898_1933591_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001280817.1|1933613_1935041_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_000224470.1|1935006_1935999_-	ribose operon transcriptional repressor RbsR	NA	NA	NA	NA	NA
WP_001300603.1|1936002_1936932_-	ribokinase	NA	NA	NA	NA	NA
WP_000211846.1|1937968_1938934_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387790.1|1938938_1939307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000715936.1|1939314_1939734_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_171769606.1|1941980_1943327_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005045000.1|1943429_1944926_+	ATPase RavA	NA	NA	NA	NA	NA
WP_000956628.1|1944919_1946371_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_000845107.1|1946375_1947368_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
WP_000432970.1|1947519_1947978_+	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_000763732.1|1948067_1948511_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_000499753.1|1948889_1950779_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_000932840.1|1950842_1951466_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_000116695.1|1952082_1952463_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_000135625.1|1952471_1953287_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_000429386.1|1953333_1953573_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_001052219.1|1953634_1954105_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_001288587.1|1954119_1954653_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_001176745.1|1954665_1956207_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_000896498.1|1956257_1957121_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_000190506.1|1957147_1958530_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_001251973.1|1958550_1958970_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_000933714.1|1959319_1960690_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.3	6.9e-34
WP_000334043.1|1960851_1962681_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	7.3e-132
WP_005044990.1|1962730_1964077_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000827805.1|1964421_1964994_+	fimbrial protein	NA	NA	NA	NA	NA
WP_073817747.1|1965041_1965185_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_000099181.1|1965604_1967143_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000612610.1|1967191_1967539_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_001333468.1|1967535_1967916_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000377786.1|1969150_1969876_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000063125.1|1969890_1970664_-	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	31.6	1.3e-18
WP_001251975.1|1970754_1971645_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|1971644_1972604_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|1972690_1973731_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_001046014.1|1973978_1975052_-	fimbrial protein	NA	NA	NA	NA	NA
WP_088895425.1|1976091_1977319_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000262788.1|1978935_1979532_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_134800821.1|1979592_1980289_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	93.1	3.0e-126
>prophage 11
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	2205403	2210934	4716545	transposase	Stx2-converting_phage(50.0%)	6	NA	NA
WP_171769607.1|2205403_2206632_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001333468.1|2206745_2207126_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612626.1|2207122_2207470_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099181.1|2207518_2209057_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000922639.1|2209236_2210526_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008974.1|2210580_2210934_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	2.2e-24
>prophage 12
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	2477439	2540038	4716545	protease,transposase	Staphylococcus_phage(11.11%)	59	NA	NA
WP_005042757.1|2477439_2478636_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_024259669.1|2480864_2481137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295556.1|2481804_2482137_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000071134.1|2482364_2483702_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_000764742.1|2483694_2484543_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	30.1	1.5e-23
WP_001107476.1|2484632_2486567_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	4.1e-117
WP_000145975.1|2486666_2487296_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_001054420.1|2487421_2487715_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_001193478.1|2487871_2488348_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_001212655.1|2488595_2490029_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_000673544.1|2490068_2491241_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_000813019.1|2491256_2492222_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000940595.1|2492348_2492606_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_000271401.1|2492626_2492938_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_001047336.1|2493196_2494168_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445420.1|2494394_2494673_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	69.8	7.6e-17
WP_000357260.1|2494720_2495980_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000429656.1|2496034_2496289_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_000004488.1|2496448_2496742_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_000476487.1|2496741_2497377_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_001296448.1|2497395_2497947_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_000925795.1|2497951_2498734_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_000438245.1|2498741_2499551_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_046891644.1|2499760_2500738_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_005028950.1|2500751_2501738_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	5.6e-38
WP_000030005.1|2501758_2502325_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|2502321_2502897_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2502865_2503423_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2503429_2504155_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|2504202_2505636_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176597.1|2505658_2505946_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	4.2e-10
WP_000183676.1|2506063_2506555_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2506600_2507455_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2507451_2507724_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620401.1|2507937_2508570_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|2508566_2509295_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_005028964.1|2509291_2509945_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809767.1|2510174_2512511_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_005044260.1|2512606_2513536_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_005028970.1|2514209_2518670_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_000081674.1|2518682_2520101_+	glutamate synthase subunit GltD	NA	NA	NA	NA	NA
WP_001333468.1|2520578_2520959_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612626.1|2520955_2521303_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000639208.1|2523229_2523535_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000979883.1|2523610_2524075_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209048.1|2524071_2524947_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|2524943_2525633_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108471.1|2525680_2527171_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000224714.1|2527279_2528173_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000523845.1|2528294_2529086_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000366129.1|2531652_2532150_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
WP_000257293.1|2532155_2532794_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|2533188_2533581_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_004986574.1|2533596_2534025_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_001192311.1|2534243_2535371_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001295270.1|2535564_2535963_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_005044006.1|2536116_2537484_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497730.1|2537573_2538641_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_000483770.1|2538691_2540038_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	2848634	2861769	4716545		Escherichia_phage(44.44%)	11	NA	NA
WP_001295182.1|2848634_2849396_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|2849389_2850016_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272581.1|2850155_2851247_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|2851309_2852302_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104447.1|2852395_2853760_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136921.1|2853848_2854625_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278997.1|2854629_2855268_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.5	2.8e-83
WP_000590422.1|2855264_2856527_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	1.4e-134
WP_000848005.1|2856523_2857432_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	3.3e-117
WP_001297141.1|2857627_2858395_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001272926.1|2859207_2861769_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 14
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	3029409	3075776	4716545	tRNA,transposase	Stx2-converting_phage(44.44%)	36	NA	NA
WP_000264777.1|3029409_3030177_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065255.1|3030218_3030566_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589818.1|3030642_3031125_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004985941.1|3033789_3034155_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168066.1|3034362_3035433_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225221.1|3035443_3036565_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|3036607_3037768_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|3037867_3037915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|3038018_3038360_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|3040138_3040876_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079103.1|3041010_3041991_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	A0A2H4UV25	Bodo_saltans_virus	25.1	2.8e-05
WP_000040159.1|3041987_3042719_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|3042848_3045422_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_001333468.1|3052152_3052533_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612610.1|3052529_3052877_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_000099181.1|3052925_3054464_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_153933117.1|3054786_3055943_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_073817198.1|3056295_3056619_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949272.1|3056664_3058020_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083004.1|3058133_3060794_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000138184.1|3060825_3061524_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|3061592_3062012_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|3062218_3063256_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262727.1|3063303_3063993_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.4	4.6e-55
WP_000627807.1|3064297_3064681_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|3064736_3065324_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_134805288.1|3065447_3066675_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_005027037.1|3066761_3067643_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219197.1|3067851_3069186_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_005007860.1|3069317_3070055_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_001333468.1|3071346_3071727_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612610.1|3071723_3072071_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_153933118.1|3072119_3073658_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.0	1.4e-290
WP_046891728.1|3073742_3074162_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	76.3	1.4e-35
WP_000612610.1|3075051_3075399_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_001171522.1|3075395_3075776_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	98.4	3.5e-65
>prophage 15
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	3253805	3328150	4716545	tRNA,transposase	Stx2-converting_phage(38.46%)	55	NA	NA
WP_000695657.1|3253805_3255221_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001341599.1|3255271_3255643_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001296278.1|3255665_3256010_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005043438.1|3256644_3258834_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_171769611.1|3258929_3260276_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005031738.1|3260322_3261525_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_000186369.1|3261860_3263099_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_000490072.1|3263239_3263566_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000903157.1|3263680_3264937_-	ion channel protein	NA	NA	NA	NA	NA
WP_000598932.1|3265140_3266106_+	glucokinase	NA	NA	NA	NA	NA
WP_005043385.1|3266324_3266651_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_000985336.1|3266672_3267920_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000173245.1|3267934_3269020_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000366045.1|3269019_3269808_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000492409.1|3269847_3270057_+	aminopeptidase Y	NA	NA	NA	NA	NA
WP_000955852.1|3270081_3272577_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_005031743.1|3272579_3273317_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001295458.1|3273445_3274180_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
WP_000544359.1|3274194_3275892_-	two-component system sensor histidine kinase YpdA	NA	NA	NA	NA	NA
WP_000785925.1|3276268_3277507_+	alanine transaminase	NA	NA	NA	NA	NA
WP_010723117.1|3277571_3277643_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000484400.1|3277998_3278919_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.1	5.4e-75
WP_000639883.1|3279271_3279514_+	YfdY family protein	NA	NA	NA	NA	NA
WP_000867639.1|3279590_3279866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825604.1|3280161_3280794_+	YfdX family protein	NA	NA	NA	NA	NA
WP_129592899.1|3280959_3282115_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_000106759.1|3282573_3283824_+	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_001283487.1|3283877_3285572_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.8e-23
WP_000955028.1|3285641_3286586_+	transporter YfdV	NA	NA	NA	NA	NA
WP_094096497.1|3287617_3287947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024259641.1|3290785_3294379_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	31.8	2.3e-36
WP_000991370.1|3294383_3294998_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_000435167.1|3295413_3296577_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
WP_001018714.1|3296576_3298115_+	multidrug efflux MFS transporter permease subunit EmrY	NA	NA	NA	NA	NA
WP_001333468.1|3300739_3301120_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612610.1|3301116_3301464_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_000099181.1|3301512_3303051_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_088895425.1|3303961_3305189_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000844746.1|3305325_3305865_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714140.1|3305861_3306350_-	fimbrial protein	NA	NA	NA	NA	NA
WP_046891762.1|3306346_3306856_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482745.1|3306871_3307624_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000445012.1|3311143_3311398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033325.1|3312222_3312483_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|3313157_3313643_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000424994.1|3313845_3315990_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531964.1|3315989_3317300_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|3317478_3317763_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_005025042.1|3318134_3319475_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_005042757.1|3319939_3321136_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000776768.1|3323382_3324138_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_046891760.1|3324431_3325364_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	1.5e-165
WP_000435427.1|3325760_3326180_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	76.3	1.1e-35
WP_000624671.1|3326176_3326527_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_001072392.1|3326557_3328150_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	4.8e-172
>prophage 16
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	3420859	3474473	4716545	protease,tail,transposase	Shigella_phage(23.53%)	33	NA	NA
WP_000140570.1|3420859_3421762_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_001000359.1|3421954_3423145_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_001209905.1|3423141_3424401_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_000857231.1|3424390_3426019_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_000948732.1|3426291_3427650_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000779090.1|3427654_3428731_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_167544916.1|3428986_3430215_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000202532.1|3430225_3430450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000135040.1|3431233_3431488_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_005028363.1|3431487_3432618_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	4.3e-175
WP_001075159.1|3432764_3435050_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.5e-283
WP_073817308.1|3436611_3437748_+	autotransporter-associated beta strand repeat-containing protein	NA	NA	NA	NA	NA
WP_000990754.1|3439665_3440388_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_046891757.1|3440534_3443162_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.3	1.4e-91
WP_094096507.1|3444115_3445284_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
WP_077897128.1|3445338_3445518_+	IS1 encoded protein	NA	A0A0C4UQV0	Shigella_phage	66.7	2.4e-16
WP_000902853.1|3445520_3446066_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	68.7	2.2e-68
WP_000551126.1|3447410_3448034_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	5.4e-79
WP_001039895.1|3448033_3448213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000801158.1|3448213_3449977_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_001225840.1|3456736_3457432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153933120.1|3457366_3458535_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	2.9e-182
WP_094139026.1|3458573_3458765_+	DUF2135 domain-containing protein	NA	NA	NA	NA	NA
WP_000876039.1|3459039_3461889_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	4.1e-41
WP_001061917.1|3462088_3462739_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_001249158.1|3462755_3465428_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_000865598.1|3466166_3467297_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.2	6.3e-118
WP_000406113.1|3467408_3468464_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786355.1|3468537_3469602_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_000884959.1|3469601_3470252_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.1e-05
WP_000422160.1|3470327_3471971_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	2.8e-13
WP_000758039.1|3472188_3473835_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_005024548.1|3473984_3474473_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 17
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	3540459	3652919	4716545	head,portal,holin,tail,capsid,transposase,tRNA,lysis,terminase	Enterobacteria_phage(43.75%)	102	NA	NA
WP_000099181.1|3540459_3541998_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000612610.1|3542046_3542394_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_001333468.1|3542390_3542771_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001136326.1|3543767_3545006_-	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
WP_000383099.1|3545199_3545439_-	DUF2542 family protein	NA	NA	NA	NA	NA
WP_000920064.1|3545441_3546161_-	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000553568.1|3546310_3547195_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_000968208.1|3547324_3548020_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001295452.1|3548016_3548415_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_001311941.1|3548653_3549604_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000079515.1|3552188_3552950_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001296821.1|3553079_3553658_-	DedA family protein	NA	NA	NA	NA	NA
WP_001295454.1|3553827_3554415_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_005042675.1|3554588_3555521_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_000097366.1|3555558_3557274_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000871503.1|3557469_3559767_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001131257.1|3559977_3560895_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000221790.1|3560901_3562059_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569335.1|3562051_3562978_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G9BWD6	Planktothrix_phage	35.1	4.3e-24
WP_000783120.1|3562982_3563714_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3563694_3563802_-	protein YohO	NA	NA	NA	NA	NA
WP_032335723.1|3563861_3564563_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.4	5.7e-101
WP_000063632.1|3564583_3565870_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	99.8	2.9e-252
WP_001193437.1|3565903_3566158_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000457723.1|3566314_3566557_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_000208031.1|3566641_3567154_-	hypothetical protein	NA	A0A1U9AJ59	Stx1_converting_phage	96.7	9.3e-77
WP_000224224.1|3567164_3567428_-	hypothetical protein	NA	S4TNB5	Salmonella_phage	70.1	7.4e-30
WP_000034218.1|3567429_3567975_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	72.9	1.2e-69
WP_001300189.1|3567961_3568276_-	hypothetical protein	NA	B1GS43	Salmonella_phage	86.0	2.8e-39
WP_000179801.1|3568229_3568547_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	81.5	7.6e-37
WP_153933121.1|3568655_3569823_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	98.4	4.6e-180
WP_000838344.1|3570180_3570837_-	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	97.7	3.1e-125
WP_046891753.1|3570948_3571176_+	hypothetical protein	NA	Q8W647	Enterobacteria_phage	89.6	4.2e-29
WP_001090258.1|3571172_3571880_+	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	91.1	3.9e-118
WP_000587268.1|3571988_3572840_+	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	65.8	1.8e-93
WP_000626792.1|3572836_3573031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000618008.1|3573027_3573252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000061547.1|3573248_3574073_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	69.5	7.4e-92
WP_024259623.1|3574083_3574962_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.4	1.5e-138
WP_000203850.1|3574958_3576359_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	91.5	3.5e-243
WP_046891752.1|3576355_3576613_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	68.8	8.1e-21
WP_001202272.1|3576664_3577654_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.9	5.8e-192
WP_001204797.1|3577671_3578064_+	antitermination protein Q	NA	Q8W638	Enterobacteria_phage	57.6	2.7e-36
WP_167544908.1|3578087_3579316_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.8e-177
WP_000024336.1|3580198_3581248_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	89.6	1.0e-183
WP_005041363.1|3584095_3584311_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	98.6	2.0e-33
WP_000731248.1|3584315_3585041_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	94.5	6.4e-124
WP_001092855.1|3585935_3586469_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.6e-100
WP_153933122.1|3586767_3587235_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	91.0	1.2e-70
WP_001415975.1|3587428_3587623_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000867571.1|3588010_3588559_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	83.5	2.3e-57
WP_024259718.1|3588530_3590459_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.1e-258
WP_000259002.1|3590442_3590649_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_005046188.1|3590645_3592238_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	3.8e-185
WP_001253950.1|3592227_3593733_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.3	7.9e-100
WP_000256823.1|3593769_3594117_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522661.1|3594174_3595203_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	59.8	2.3e-111
WP_000201507.1|3595254_3595623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204201.1|3595615_3595969_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.9	4.6e-43
WP_000975009.1|3595983_3596559_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	2.1e-48
WP_000683082.1|3596555_3596951_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	1.7e-57
WP_046891750.1|3596958_3597711_+	Ig-like domain-containing protein	NA	Q687F6	Enterobacteria_phage	97.2	8.7e-132
WP_000479095.1|3597724_3598156_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|3598182_3598596_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082392.1|3598576_3601150_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.4	0.0e+00
WP_000847298.1|3601146_3601476_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_005046106.1|3601475_3602174_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	94.8	6.6e-126
WP_005046104.1|3602184_3602928_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	1.0e-145
WP_064717329.1|3602825_3603506_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.7	6.9e-112
WP_046891749.1|3603848_3607322_+	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001228313.1|3607389_3607989_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_000216492.1|3608139_3610944_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q858V4	Yersinia_virus	65.0	7.5e-03
WP_046891741.1|3611961_3613500_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	1.1e-293
WP_000612610.1|3613548_3613896_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_001333468.1|3613892_3614273_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000937505.1|3615698_3615956_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	70.2	5.1e-15
WP_001026780.1|3615966_3616512_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_001261938.1|3616828_3617077_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	98.8	7.0e-38
WP_005031165.1|3617591_3619277_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	4.3e-304
WP_000598642.1|3619273_3619993_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|3620039_3620510_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_005042702.1|3623826_3625860_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.8	8.0e-55
WP_001005448.1|3625991_3627101_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_072059034.1|3628146_3628422_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000677412.1|3629350_3630025_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000153067.1|3632843_3633182_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000019944.1|3634002_3634275_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_046891747.1|3634497_3635286_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_046891746.1|3635282_3636083_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_005031483.1|3636147_3636966_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	5.0e-24
WP_000434038.1|3637017_3637764_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000846236.1|3638602_3639607_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.7e-13
WP_000858484.1|3639603_3640881_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000129571.1|3641137_3642190_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289785.1|3642497_3643352_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000182920.1|3644652_3645105_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000490651.1|3646200_3647556_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844202.1|3647603_3648644_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178555.1|3648743_3649523_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807369.1|3649604_3650504_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	8.8e-14
WP_001318299.1|3650909_3651227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|3651557_3652919_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 18
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	3734075	3840325	4716545	tail,transposase	Escherichia_phage(21.21%)	80	NA	NA
WP_171769612.1|3734075_3735303_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.1e-176
WP_010723108.1|3735695_3735758_+	membrane protein YoeI	NA	NA	NA	NA	NA
WP_000019197.1|3735747_3737106_+	putrescine/proton symporter PlaP	NA	NA	NA	NA	NA
WP_000492322.1|3737284_3738343_+	transport protein YeeE	NA	NA	NA	NA	NA
WP_000985273.1|3738356_3738584_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_000980542.1|3738626_3740054_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001302630.1|3740177_3740336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001105385.1|3741546_3742020_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200876.1|3742217_3743276_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|3743447_3743777_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_024259628.1|3743877_3744060_-	ethanolamine utilization protein	NA	NA	NA	NA	NA
WP_167544914.1|3744684_3745898_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	7.1e-168
WP_000255950.1|3746425_3747448_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	8.6e-199
WP_167544908.1|3747529_3748758_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.8e-177
WP_000973150.1|3750986_3751532_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_005042779.1|3751528_3752272_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001166156.1|3752283_3753363_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986350.1|3753424_3754360_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_046891742.1|3754818_3755736_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001010986.1|3755837_3756788_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001060236.1|3761785_3763240_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_094096479.1|3767678_3768835_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_001302302.1|3775650_3776448_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001117462.1|3779240_3779510_+	DNA-binding protein	NA	A0A2I6PIE5	Escherichia_phage	61.3	4.1e-15
WP_000693856.1|3779506_3779932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024259707.1|3780003_3781074_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	3.8e-64
WP_001151146.1|3781114_3781537_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.7	3.9e-65
WP_001266147.1|3781533_3781839_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.1	1.1e-48
WP_000335375.1|3781825_3782281_+	ead/Ea22-like family protein	NA	Q5G8U8	Enterobacteria_phage	69.6	1.4e-28
WP_046891741.1|3782330_3783869_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	1.1e-293
WP_000612610.1|3783917_3784265_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_000477609.1|3784261_3784498_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	98.7	1.3e-36
WP_005069274.1|3784752_3785169_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.0	1.5e-24
WP_000935258.1|3785763_3785976_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_000929754.1|3786143_3786422_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	43.8	2.4e-10
WP_000902849.1|3788990_3789536_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	74.7	1.6e-74
WP_000551126.1|3790779_3791403_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	5.4e-79
WP_001039895.1|3791402_3791582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046891740.1|3791582_3793226_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_000239881.1|3794317_3794986_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_046891739.1|3795125_3796718_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.0	1.4e-171
WP_000624671.1|3796748_3797099_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_000435415.1|3797095_3797515_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	77.3	2.9e-36
WP_094096507.1|3797985_3799154_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
WP_171764904.1|3800589_3801817_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_153933124.1|3802157_3803314_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_001007759.1|3803531_3804182_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001241113.1|3804438_3805074_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740102.1|3805074_3806079_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920127.1|3806187_3806601_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001339045.1|3806733_3807405_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826750.1|3807404_3808763_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.3	6.6e-05
WP_114142771.1|3811867_3812395_-	porin	NA	Q1MVN1	Enterobacteria_phage	47.0	1.7e-36
WP_167544908.1|3812458_3813686_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.8e-177
WP_072135367.1|3814843_3815209_+	permease	NA	NA	NA	NA	NA
WP_000365569.1|3815248_3815944_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.8	5.6e-08
WP_001157235.1|3816010_3817429_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	3.0e-101
WP_000786008.1|3817409_3817880_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	4.4e-33
WP_001212273.1|3817868_3818789_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|3818961_3819879_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|3819957_3820140_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_077897541.1|3820310_3822005_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.1	8.5e-18
WP_000491513.1|3822001_3822817_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|3823114_3823342_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000867217.1|3823504_3823693_+	protein DsrB	NA	NA	NA	NA	NA
WP_024259586.1|3823736_3824345_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000187358.1|3826210_3826480_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253451.1|3826489_3827152_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_004982751.1|3827151_3827517_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282098.1|3827519_3827933_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_005040713.1|3827929_3828934_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133228.1|3828938_3829403_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001123475.1|3829507_3830662_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_001282673.1|3831884_3832571_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067936.1|3832563_3833559_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000994403.1|3833551_3834721_-	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_001274295.1|3834935_3835250_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070456.1|3835583_3835916_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000734031.1|3837199_3837751_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_129592877.1|3839168_3840325_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
>prophage 19
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	3871858	3955725	4716545	head,holin,tail,transposase,tRNA,lysis,terminase	Escherichia_phage(31.37%)	75	NA	NA
WP_094096479.1|3871858_3873015_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_129592854.1|3874144_3875311_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	9.9e-183
WP_000122426.1|3875873_3876302_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_046891733.1|3878134_3879022_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000795952.1|3879018_3879945_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000147298.1|3881641_3882145_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_046891732.1|3882289_3883705_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.0	1.4e-10
WP_000204335.1|3885311_3886172_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036408.1|3886174_3887224_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	33.6	4.6e-06
WP_000763866.1|3887238_3887628_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	31.7	1.0e-06
WP_000983609.1|3887638_3888283_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001259583.1|3891539_3891932_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001297434.1|3892051_3892540_-	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001025342.1|3892716_3894450_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_004982864.1|3894665_3895232_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185757.1|3895245_3895992_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214302.1|3897155_3898256_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_000564739.1|3900873_3901845_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019618.1|3901841_3902585_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_094096507.1|3903026_3904194_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
WP_000061535.1|3904537_3905362_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_000055050.1|3905358_3905847_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.5	2.7e-86
WP_000066914.1|3905846_3906500_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.1	1.2e-126
WP_001061419.1|3906905_3907715_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	98.1	1.3e-149
WP_005041034.1|3907722_3908712_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	6.2e-194
WP_001204806.1|3908729_3909110_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_000024336.1|3909674_3910724_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	89.6	1.0e-183
WP_000874453.1|3911525_3911759_+	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	84.4	1.3e-30
WP_000323228.1|3911792_3913487_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	S5MDQ7	Escherichia_phage	61.7	4.9e-199
WP_000142784.1|3913622_3913757_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	93.2	3.1e-16
WP_094096479.1|3913797_3914954_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_001289722.1|3915109_3915379_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	74.2	8.2e-08
WP_000284492.1|3915454_3915670_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	98.6	1.0e-32
WP_000193278.1|3915674_3916019_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|3915984_3916257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992061.1|3916362_3916896_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	92.1	1.3e-94
WP_000675931.1|3917116_3917230_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001082565.1|3917231_3917699_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	95.5	1.1e-73
WP_000828072.1|3918037_3918364_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	3.4e-56
WP_000095744.1|3918495_3918696_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829198.1|3918737_3919103_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	6.2e-59
WP_001487956.1|3919393_3919954_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	83.9	6.4e-71
WP_005041499.1|3919950_3921612_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.4	0.0e+00
WP_001063100.1|3923656_3923878_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	97.3	1.9e-34
WP_000126030.1|3926242_3926569_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	99.1	1.2e-53
WP_001018521.1|3926578_3926929_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	98.3	1.7e-58
WP_000569977.1|3926925_3927372_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	97.3	4.9e-74
WP_000133373.1|3927368_3927713_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.2	2.1e-56
WP_024259601.1|3927777_3928134_+	hypothetical protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.1	4.5e-54
WP_114142276.1|3928857_3929271_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.2	1.5e-64
WP_000710953.1|3929285_3929660_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	3.0e-64
WP_128566924.1|3929755_3929965_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	97.1	4.4e-33
WP_000224021.1|3930012_3930273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077897571.1|3930407_3932009_-|transposase	IS66-like element ISEc49 family transposase	transposase	A0A218MNE7	uncultured_virus	36.4	7.7e-77
WP_000950648.1|3932015_3932408_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000042910.1|3932394_3932724_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_046891730.1|3932768_3936029_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	96.6	0.0e+00
WP_005046106.1|3936361_3937060_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	94.8	6.6e-126
WP_005046104.1|3937070_3937814_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	1.0e-145
WP_064717329.1|3937711_3938392_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.7	6.9e-112
WP_001233150.1|3942174_3942774_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	98.0	9.7e-110
WP_000216457.1|3942838_3944398_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZGT8	Escherichia_phage	98.5	2.2e-68
WP_000539253.1|3944483_3944996_+	receptor recognizing protein Gp38	NA	A0A0P0ZFL3	Escherichia_phage	92.9	1.1e-85
WP_001114260.1|3945071_3945284_+	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	63.6	7.1e-15
WP_005042757.1|3945590_3946787_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001217553.1|3947340_3947589_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000530012.1|3947685_3947862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005026374.1|3948317_3949514_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000891627.1|3949704_3949959_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_001258662.1|3950267_3952040_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001300367.1|3952157_3952610_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907247.1|3952638_3953379_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000974711.1|3953413_3953935_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_005029473.1|3953936_3954089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171769613.1|3954496_3955725_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	3.7e-172
>prophage 20
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	3998304	4058511	4716545	protease,integrase,tRNA,transposase	Stx2-converting_phage(34.78%)	53	3994426:3994440	4019961:4019975
3994426:3994440	attL	GGCGCTGGCAGAAGA	NA	NA	NA	NA
WP_171769614.1|3998304_3999533_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_046891729.1|3999638_4000460_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976476.1|4000472_4000814_+	YebY family protein	NA	NA	NA	NA	NA
WP_071821702.1|4001206_4001677_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.3	6.6e-37
WP_129592854.1|4003511_4004678_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	9.9e-183
WP_001333468.1|4005142_4005523_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612610.1|4005519_4005867_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_000099181.1|4005915_4007454_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_001277359.1|4007610_4007907_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	83.5	6.2e-41
WP_005029490.1|4007884_4009825_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	57.0	1.9e-186
WP_001063816.1|4010474_4011602_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_167544914.1|4011835_4013048_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	7.1e-168
WP_001171522.1|4013269_4013650_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	98.4	3.5e-65
WP_000612610.1|4013646_4013994_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_046891728.1|4014883_4015303_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	76.3	1.4e-35
WP_046891741.1|4015387_4016926_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	1.1e-293
WP_000612626.1|4016974_4017322_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333468.1|4017318_4017699_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_024259614.1|4018949_4019573_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	2.1e-78
WP_001039895.1|4019572_4019752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000026175.1|4019752_4021468_-	T3SS effector E3 ubiquitin-protein ligase IpaH3	NA	NA	NA	NA	NA
4019961:4019975	attR	TCTTCTGCCAGCGCC	NA	NA	NA	NA
WP_171769615.1|4022492_4023705_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.3	2.2e-164
WP_000457842.1|4024180_4024372_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|4024476_4024713_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_005024823.1|4024830_4026270_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_005042252.1|4026349_4028983_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_024259618.1|4028951_4030235_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043888.1|4030364_4030862_+	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_000431370.1|4030958_4031657_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_024259617.1|4031676_4033725_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|4033916_4034798_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127216.1|4034843_4036217_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262182.1|4036393_4037185_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211011.1|4037327_4037567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|4037725_4037869_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006852.1|4037943_4038231_+	YebO family protein	NA	NA	NA	NA	NA
WP_001295496.1|4039556_4039700_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|4039712_4039922_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010113.1|4040087_4040897_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001296134.1|4040893_4041460_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000156259.1|4041887_4042346_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|4042400_4043252_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|4043264_4044065_-	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150543.1|4044127_4045099_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_046891727.1|4045561_4047118_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.8	4.6e-42
WP_129592899.1|4048573_4049730_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_000624300.1|4050681_4052046_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000456725.1|4052229_4052808_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000855021.1|4052811_4054173_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	5.8e-41
WP_000457334.1|4054246_4054426_+	YoaH family protein	NA	NA	NA	NA	NA
WP_005042226.1|4055371_4055716_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128834.1|4055847_4057758_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	5.9e-92
WP_001220988.1|4057815_4058511_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	4095833	4233065	4716545	tRNA,transposase,tail	Enterobacteria_phage(25.0%)	105	NA	NA
WP_153933128.1|4095833_4097372_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.8	1.5e-292
WP_000373055.1|4098333_4099677_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000085238.1|4099912_4100185_+	YnjH family protein	NA	NA	NA	NA	NA
WP_000781878.1|4100150_4100558_-	CTP pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_004983358.1|4100644_4101256_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_001299561.1|4102638_4103292_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.7	3.8e-14
WP_165850853.1|4103291_4103945_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000524080.1|4105976_4106525_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_000977129.1|4106524_4107232_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_000673918.1|4109582_4110389_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_000081975.1|4110834_4112055_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	4.2e-27
WP_000989446.1|4112051_4113086_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_000994988.1|4114541_4115885_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_000368526.1|4115877_4116846_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_001228966.1|4117175_4117646_+	ATP-independent periplasmic protein-refolding chaperone	NA	NA	NA	NA	NA
WP_046891726.1|4117848_4118424_+	environmental stress-induced protein Ves	NA	NA	NA	NA	NA
WP_000252396.1|4118383_4119271_-	excinuclease Cho	NA	NA	NA	NA	NA
WP_000175034.1|4119500_4120328_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	7.7e-73
WP_001039044.1|4120529_4120868_+	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_000412169.1|4121165_4121486_+	PTS N,N'-diacetylchitobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_001010702.1|4124297_4125689_-	cystine/sulfocysteine:cation symporter	NA	NA	NA	NA	NA
WP_004983374.1|4125821_4126412_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000106834.1|4126574_4127243_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_000222172.1|4127389_4127926_+	YniB family protein	NA	NA	NA	NA	NA
WP_000267654.1|4127966_4128827_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000146159.1|4128932_4129223_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000251738.1|4129323_4130253_-	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_001144196.1|4131802_4133731_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	1.6e-129
WP_032155788.1|4133734_4134277_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
WP_001124225.1|4134373_4134571_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|4134623_4134980_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|4135102_4135147_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018583.1|4135429_4136413_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.0	3.2e-33
WP_000672350.1|4136427_4138815_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|4138819_4139119_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000078916.1|4139422_4139563_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_171769616.1|4139914_4141142_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	7.2e-176
WP_032324284.1|4141113_4141350_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_046891725.1|4141485_4142589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000005370.1|4146897_4148082_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
WP_114142759.1|4148120_4148990_+	tagaturonate reductase	NA	A0A0A7NPV8	Enterobacteria_phage	62.5	1.0e-06
WP_005025442.1|4149186_4150101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024258604.1|4150104_4150863_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000483770.1|4150925_4152272_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001074427.1|4152325_4152709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000753022.1|4152720_4153089_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	57.9	3.1e-26
WP_001264267.1|4153075_4153663_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	75.5	1.6e-72
WP_000287959.1|4154062_4154749_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	94.3	8.8e-115
WP_000478929.1|4154807_4155194_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	90.6	2.0e-60
WP_000371977.1|4155502_4158544_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	84.8	0.0e+00
WP_000447385.1|4158543_4158873_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	93.5	2.9e-55
WP_001152578.1|4158872_4159571_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	91.8	4.8e-124
WP_000194737.1|4159575_4160319_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.8e-145
WP_001233102.1|4165241_4165841_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	5.5e-105
WP_024259614.1|4167142_4167766_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	2.1e-78
WP_001039895.1|4167765_4167945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005031414.1|4167945_4169697_-	T3SS effector E3 ubiquitin-protein ligase IpaH2	NA	NA	NA	NA	NA
WP_001397278.1|4170811_4170937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046891724.1|4171025_4172486_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.3	7.3e-42
WP_000214712.1|4172521_4172725_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_046891723.1|4172902_4173589_-	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000636571.1|4173677_4174424_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000210377.1|4174560_4176606_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_094096479.1|4177979_4179136_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_000428998.1|4179656_4180187_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|4180431_4180605_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001320773.1|4180676_4180826_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_001098564.1|4181224_4182865_+	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_032335682.1|4182902_4183832_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000013794.1|4184041_4185385_+	VOC family protein	NA	NA	NA	NA	NA
WP_000375956.1|4185609_4187265_+	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_004983724.1|4187404_4187629_+	YdcH family protein	NA	NA	NA	NA	NA
WP_000140882.1|4187691_4188228_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_004983796.1|4189325_4190318_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000586728.1|4190314_4190908_+	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_171769617.1|4192204_4193418_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.0	1.3e-164
WP_134805288.1|4195135_4196363_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001333468.1|4198332_4198713_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612626.1|4198709_4199057_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099181.1|4199105_4200644_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000680280.1|4200890_4202504_+	murein tripeptide ABC transporter substrate-binding protein MppA	NA	NA	NA	NA	NA
WP_000559900.1|4202554_4203586_-	low conductance mechanosensitive channel YnaI	NA	NA	NA	NA	NA
WP_000605090.1|4204606_4204864_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|4204913_4205864_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|4206015_4206768_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945012.1|4206962_4207478_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	8.3e-25
WP_001156464.1|4209050_4210496_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444944.1|4210495_4211806_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885469.1|4211981_4212890_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046837.1|4213219_4213783_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628065.1|4213803_4215036_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|4215290_4216274_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123759.1|4216750_4218124_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157397.1|4218252_4219188_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.1	4.2e-144
WP_153933131.1|4220633_4221802_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	98.7	4.2e-181
WP_012421537.1|4221970_4222636_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000882658.1|4222806_4223019_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	88.6	1.2e-25
WP_000687450.1|4223268_4223478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094096479.1|4223529_4224685_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.2e-66
WP_000640137.1|4224741_4225296_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.7	1.3e-68
WP_089519923.1|4227690_4227873_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_167544910.1|4229119_4230333_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.0	1.3e-164
WP_000435423.1|4230675_4231095_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	75.3	3.2e-35
WP_000624671.1|4231091_4231442_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_046891721.1|4231472_4233065_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.0	1.4e-171
>prophage 22
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	4251165	4283446	4716545	integrase,transposase	Stx2-converting_phage(23.08%)	27	4262199:4262223	4292525:4292549
WP_134805288.1|4251165_4252394_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_046891798.1|4252425_4253031_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_005041006.1|4253030_4253612_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000627388.1|4256021_4257338_+	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000048944.1|4257388_4257994_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000139622.1|4258194_4262097_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
4262199:4262223	attL	ATGCTGCCAACTTACTGATTTAGTG	NA	NA	NA	NA
WP_001333468.1|4262315_4262696_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612610.1|4262692_4263040_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_000099204.1|4263088_4264627_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.0	6.3e-294
WP_001027927.1|4265593_4266394_+	YdcF family protein	NA	NA	NA	NA	NA
WP_000115910.1|4266590_4268030_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_094112601.1|4268852_4269994_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.1e-66
WP_171769618.1|4270031_4271244_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	4.6e-167
WP_001151410.1|4271501_4271780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000904672.1|4271876_4272185_+	helix-turn-helix domain-containing protein	NA	A0A0M5M1I9	Salmonella_phage	53.1	1.3e-22
WP_000336262.1|4272273_4273212_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.8	4.3e-80
WP_000668483.1|4273214_4273577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997174.1|4273684_4274014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001154172.1|4275263_4275815_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029458.1|4275814_4276564_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	27.2	1.0e-07
WP_001209786.1|4276641_4277106_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	35.3	1.1e-12
WP_001300634.1|4277352_4278066_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000175699.1|4278128_4279565_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270810.1|4279568_4279760_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|4279891_4280938_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368051.1|4281094_4281928_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_088895425.1|4282218_4283446_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
4292525:4292549	attR	CACTAAATCAGTAAGTTGGCAGCAT	NA	NA	NA	NA
>prophage 23
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	4532583	4600539	4716545	portal,holin,lysis,tail,terminase,integrase,transposase,protease,head,capsid	Escherichia_phage(43.33%)	80	4537304:4537318	4607908:4607922
WP_000422066.1|4532583_4533633_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	3.0e-21
WP_000559290.1|4533852_4534611_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	2.0e-06
WP_001291216.1|4535238_4536111_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_005041692.1|4536321_4538217_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
4537304:4537318	attL	AAACCTTTATCGTCG	NA	NA	NA	NA
WP_001295575.1|4538244_4538865_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285651.1|4538861_4539743_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001386774.1|4539880_4539925_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_046891713.1|4540016_4541579_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763539.1|4541578_4543174_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_000983895.1|4543174_4544536_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	5.6e-36
WP_000209505.1|4544547_4545741_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443080.1|4545740_4546547_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000251936.1|4548028_4548199_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000240999.1|4548638_4549307_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885580.1|4549361_4549946_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_032335670.1|4549945_4552921_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	88.0	2.7e-51
WP_001228225.1|4552985_4553585_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	3.7e-101
WP_000515473.1|4553652_4557132_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.4	0.0e+00
WP_153933134.1|4557198_4557537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050546148.1|4557609_4558212_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	6.8e-87
WP_000140710.1|4558148_4558892_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.1e-146
WP_001152648.1|4558896_4559595_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	3.6e-132
WP_000847332.1|4559594_4559924_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	5.6e-59
WP_046891712.1|4559920_4562494_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	85.2	0.0e+00
WP_000533402.1|4562474_4562888_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479095.1|4562914_4563346_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_001454438.1|4563359_4563965_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	7.6e-102
WP_000683079.1|4563972_4564368_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974980.1|4564364_4564898_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_001204568.1|4564913_4565267_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	68.4	1.3e-40
WP_000201502.1|4565259_4565643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522588.1|4565694_4566723_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256833.1|4566780_4567128_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	7.5e-22
WP_128832178.1|4567198_4568671_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.3	7.7e-100
WP_005046188.1|4568660_4570253_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	3.8e-185
WP_000259002.1|4570249_4570456_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_024259736.1|4570439_4572368_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	9.7e-260
WP_000867569.1|4572339_4572888_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_153933135.1|4573330_4573798_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	91.0	7.7e-70
WP_000992072.1|4574096_4574630_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	2.4e-99
WP_000369850.1|4574735_4575008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193262.1|4574973_4575318_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	6.3e-37
WP_000284510.1|4575322_4575538_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000874316.1|4577023_4578880_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	89.6	0.0e+00
WP_000871291.1|4579139_4579475_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_071782237.1|4579545_4579758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000226110.1|4580223_4580364_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	93.5	2.2e-12
WP_153933136.1|4580623_4581682_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.9	1.4e-199
WP_000762933.1|4582256_4583078_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	5.5e-79
WP_000904094.1|4583074_4583449_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.4e-35
WP_001265099.1|4583461_4584508_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_032335658.1|4584509_4584788_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.7e-05
WP_000980988.1|4584854_4585106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|4585322_4585535_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000350274.1|4585769_4586003_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
WP_088895425.1|4586017_4587246_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000207997.1|4587445_4587613_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000224216.1|4587623_4587887_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
WP_001142588.1|4587888_4588107_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	3.6e-30
WP_000510389.1|4588108_4588324_-	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	93.0	6.3e-35
WP_001289986.1|4588324_4588684_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	73.5	1.7e-37
WP_000753053.1|4588680_4588857_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001224665.1|4588849_4589032_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_000403782.1|4589127_4589484_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
WP_001209470.1|4589461_4589923_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	1.3e-37
WP_001266130.1|4589919_4590216_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001141099.1|4590212_4590605_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_000450707.1|4590620_4591391_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	6.7e-87
WP_001309414.1|4591424_4591967_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000020542.1|4591878_4592919_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	2.3e-90
WP_000705383.1|4592890_4593442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|4593425_4593653_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|4593730_4594138_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379596.1|4594327_4594480_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_005031383.1|4594491_4594866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032335657.1|4596204_4596363_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|4596359_4596548_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048473.1|4596643_4599118_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|4599182_4599431_+	excisionase	NA	NA	NA	NA	NA
WP_000113688.1|4599408_4600539_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	2.2e-102
4607908:4607922	attR	CGACGATAAAGGTTT	NA	NA	NA	NA
>prophage 24
NZ_CP045784	Shigella dysenteriae strain CFSAN029786 chromosome, complete genome	4716545	4643395	4650295	4716545	transposase	Stx2-converting_phage(50.0%)	8	NA	NA
WP_088895425.1|4643395_4644624_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001146442.1|4644729_4644960_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
WP_001295620.1|4645229_4646330_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000099181.1|4646713_4648252_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000612610.1|4648300_4648648_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_001333468.1|4648644_4649025_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000170926.1|4649184_4649292_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_000811065.1|4649440_4650295_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 1
NZ_CP045785	Shigella dysenteriae strain CFSAN029786 plasmid p1CFSAN029786, complete sequence	223637	0	98550	223637	protease,transposase	Stx2-converting_phage(50.0%)	59	NA	NA
WP_114142767.1|3924_5081_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.2e-66
WP_000701115.1|5418_6873_-	T3SS effector OspC family protein	NA	NA	NA	NA	NA
WP_171769620.1|7241_8455_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.3	4.3e-165
WP_012421703.1|8506_10231_-	T3SS effector E3 ubiquitin-protein ligase IpaH4.5	NA	NA	NA	NA	NA
WP_032490755.1|10658_12356_-	T3SS effector E3 ubiquitin-protein ligase IpaH7.8	NA	NA	NA	NA	NA
WP_046891828.1|16706_17915_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000019158.1|17895_18168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001343187.1|18570_20268_-	type III secretion system effector OspD3	NA	NA	NA	NA	NA
WP_046891811.1|20595_22008_-	type 3 secretion system effector OspC1	NA	NA	NA	NA	NA
WP_001333468.1|23084_23465_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612626.1|23461_23809_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099181.1|23857_25396_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_001020414.1|26163_27339_-	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_001100761.1|27407_29669_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000981088.1|29837_30614_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_001224621.1|30621_31497_-	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_171769621.1|32055_33402_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000124126.1|34500_34866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001063816.1|36033_37161_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_001333468.1|38985_39366_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612610.1|39362_39710_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_046891815.1|39758_41183_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	92.0	2.3e-266
WP_000624671.1|41411_41762_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_000435424.1|41758_42178_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	76.3	8.5e-36
WP_011114782.1|42552_42705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153933141.1|44013_45741_+	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_000865087.1|46756_47044_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	88.4	1.7e-40
WP_046891819.1|47043_47355_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	94.2	1.4e-48
WP_153933142.1|47819_49016_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000957714.1|49387_49654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001063816.1|50556_51684_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_046891821.1|52182_52971_+	AraC family invasion system transcriptional regulator VirF	NA	NA	NA	NA	NA
WP_073691766.1|52912_53335_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	97.2	8.5e-52
WP_153933143.1|53825_54993_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.3e-182
WP_001063816.1|55051_56179_-|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_171769622.1|56838_58067_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000607008.1|58538_59177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004967149.1|59832_61434_-|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.5	4.9e-148
WP_089519923.1|61453_61636_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	71.2	2.5e-16
WP_000878030.1|61910_62930_-|transposase	IS110-like element ISEc11 family transposase	transposase	NA	NA	NA	NA
WP_005031011.1|63239_63914_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	7.6e-10
WP_171769623.1|64215_65428_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	2.1e-167
WP_073691216.1|66170_67349_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.1	1.7e-28
WP_000431557.1|68378_69359_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	58.2	8.5e-95
WP_000200287.1|69358_70558_-	AAA family ATPase	NA	Q71TL9	Escherichia_phage	75.1	2.0e-175
WP_004979576.1|70695_70857_-	hypothetical protein	NA	A0A0P0ZEB3	Stx2-converting_phage	55.0	3.9e-05
WP_024259653.1|74952_75519_-	type III secretion effector IpgB2	NA	NA	NA	NA	NA
WP_011114726.1|75800_76115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046891824.1|76626_77304_-	type 3 secretion system effector OspD1	NA	NA	NA	NA	NA
WP_000622995.1|80117_80465_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	3.4e-46
WP_001077959.1|82578_82866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868557.1|84217_84796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121865.1|85834_86554_+	type III secretion system effector phosphothreonine lyase	NA	NA	NA	NA	NA
WP_005041841.1|86985_88695_+	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_005008498.1|88776_88974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114142765.1|92867_92954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000850660.1|93313_94054_-	PAP2 family phosphatase PhoN2	NA	A0A1B1IUP6	uncultured_Mediterranean_phage	28.9	2.6e-11
WP_001046941.1|94381_95248_-	type 3 secretion system effector OspB	NA	A0A0P0ZCT1	Stx2-converting_phage	35.3	7.2e-29
WP_005041436.1|97602_98550_-|protease	omptin family outer membrane protease IcsP	protease	NA	NA	NA	NA
>prophage 2
NZ_CP045785	Shigella dysenteriae strain CFSAN029786 plasmid p1CFSAN029786, complete sequence	223637	104367	176348	223637	protease,tRNA,transposase	Stx2-converting_phage(28.57%)	55	NA	NA
WP_153933146.1|104367_105576_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000701106.1|106024_107479_-	type 3 secretion system effector OspC2	NA	NA	NA	NA	NA
WP_153933147.1|107903_108747_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_000957863.1|109690_109879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130973.1|114004_114862_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|114854_114929_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083819.1|115152_115413_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000766818.1|115652_116243_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001299729.1|116281_116491_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001233866.1|116536_116998_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.7	3.2e-20
WP_011379083.1|117241_117454_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005045523.1|117584_118145_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205722.1|118199_118946_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	32.0	5.4e-09
WP_171539520.1|123822_124239_-	conjugative relaxase	NA	NA	NA	NA	NA
WP_000450530.1|124323_124551_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911318.1|124550_124949_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_000009311.1|124957_127165_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_005027201.1|128950_129895_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_005045525.1|129959_130910_-	virulence factor VirK	NA	NA	NA	NA	NA
WP_005027207.1|130914_132003_-	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_000931198.1|132005_132848_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_004996477.1|133211_133328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000705599.1|134245_134731_-	protein kinase	NA	NA	NA	NA	NA
WP_000079956.1|134982_135252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000936802.1|135459_137097_-	T3SS effector E3 ubiquitin-protein ligase IpaH9.8	NA	NA	NA	NA	NA
WP_001159860.1|137489_137795_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813626.1|137796_138015_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_088895425.1|138258_139486_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000019158.1|139943_140216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167544920.1|140310_141523_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	96.6	8.2e-164
WP_050546159.1|141587_142718_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000766699.1|145039_145177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000421262.1|145308_145584_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001178088.1|145583_145868_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000435424.1|147101_147521_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	76.3	8.5e-36
WP_000624671.1|147517_147868_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.7e-40
WP_046891721.1|147898_149491_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.0	1.4e-171
WP_046891833.1|149847_150522_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.4e-10
WP_134806647.1|151065_152233_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	2.9e-182
WP_046891834.1|153251_154211_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	40.9	4.2e-62
WP_000445931.1|154210_154606_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_088895425.1|154773_156002_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_073691780.1|156094_156460_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_094096542.1|156505_157349_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_000828661.1|157521_158271_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_171769624.1|159983_161196_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	7.9e-167
WP_094096743.1|161355_162523_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	8.4e-182
WP_088895425.1|162893_164121_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000099181.1|164551_166090_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000612610.1|166138_166486_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_001333468.1|166482_166863_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_046891837.1|167467_169120_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_171769625.1|169460_170674_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	3.5e-167
WP_069375727.1|171308_174617_-	outer membrane autotransporter IcsA	NA	A0A2L1IV18	Escherichia_phage	28.8	3.9e-75
WP_046891839.1|175145_176348_+|protease	alpha-tubulin-specific protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP045785	Shigella dysenteriae strain CFSAN029786 plasmid p1CFSAN029786, complete sequence	223637	185830	188142	223637	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_000099181.1|185830_187369_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	2.8e-294
WP_000612610.1|187417_187765_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	2.8e-61
WP_001333468.1|187761_188142_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
>prophage 4
NZ_CP045785	Shigella dysenteriae strain CFSAN029786 plasmid p1CFSAN029786, complete sequence	223637	218995	219925	223637		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000227976.1|218995_219925_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	42.6	1.4e-51
