The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045063	Salmonella enterica subsp. enterica serovar Muenchen strain LG26 chromosome, complete genome	4930420	968135	975448	4930420	protease	Dickeya_phage(16.67%)	7	NA	NA
WP_001201759.1|968135_969254_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
WP_001748306.1|969250_971197_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|971326_971548_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520787.1|971871_972192_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_000934064.1|972222_974499_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|974711_974909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|975070_975448_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 2
NZ_CP045063	Salmonella enterica subsp. enterica serovar Muenchen strain LG26 chromosome, complete genome	4930420	1076854	1123326	4930420	head,lysis,protease,tail,integrase	Salmonella_phage(25.0%)	65	1071975:1071990	1103723:1103738
1071975:1071990	attL	GCGCCAGACGCGGCGC	NA	NA	NA	NA
WP_000374046.1|1076854_1077514_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_097361317.1|1078101_1079124_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	51.9	3.5e-91
WP_024134793.1|1079107_1079344_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_097361318.1|1079423_1079840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058645056.1|1079933_1080197_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_097361319.1|1080199_1080592_-	hypothetical protein	NA	A0A0M4RTV1	Salmonella_phage	42.4	6.6e-06
WP_057395058.1|1080588_1080858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153789541.1|1080854_1081046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361321.1|1081042_1081258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361322.1|1081257_1081545_-	hypothetical protein	NA	I6RSM9	Salmonella_phage	94.7	5.1e-24
WP_097361323.1|1081541_1081856_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	57.3	2.0e-34
WP_097361324.1|1081891_1082707_-	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	64.7	1.9e-87
WP_097361325.1|1082712_1085307_-	exonuclease VIII	NA	V5UQJ3	Shigella_phage	56.3	9.6e-162
WP_097361326.1|1085447_1085780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024153606.1|1085855_1086062_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_097361327.1|1086065_1086341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361328.1|1086366_1087218_-	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	57.4	5.5e-58
WP_058679873.1|1087526_1087769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079816621.1|1087829_1088099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361329.1|1088470_1088965_-	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	58.8	7.5e-15
WP_024153610.1|1089036_1089312_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	39.2	1.3e-08
WP_097361330.1|1089308_1089803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361331.1|1089850_1090858_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	69.6	1.0e-127
WP_097361332.1|1090850_1091312_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	76.2	3.2e-68
WP_097361333.1|1091327_1091723_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	37.4	1.5e-18
WP_097361334.1|1091719_1091992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023220363.1|1092116_1092329_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	77.1	1.8e-18
WP_097361335.1|1092795_1093395_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	1.5e-97
WP_097361336.1|1093391_1093586_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	7.9e-13
WP_097361337.1|1093582_1093864_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	1.7e-35
WP_097361338.1|1093860_1094397_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	66.3	1.1e-64
WP_097361339.1|1094927_1096358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001525456.1|1096542_1096845_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_097361340.1|1096822_1097362_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	69.5	2.4e-75
WP_097361563.1|1097679_1098135_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	81.9	1.9e-57
WP_070799731.1|1098360_1098549_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_079828278.1|1098612_1099242_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	3.3e-108
WP_079953322.1|1099244_1100864_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	80.1	1.7e-262
WP_097361341.1|1100863_1102372_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	42.7	1.4e-104
WP_097361342.1|1102412_1103102_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.9	1.8e-59
WP_097361343.1|1103098_1104454_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.8	9.4e-68
1103723:1103738	attR	GCGCCGCGTCTGGCGC	NA	NA	NA	NA
WP_097361344.1|1104455_1104938_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	49.4	1.4e-26
WP_079953317.1|1104937_1105966_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	49.1	1.7e-82
WP_097361345.1|1105969_1106317_+	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	33.3	3.1e-07
WP_079953315.1|1106322_1106769_+	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	43.8	1.4e-15
WP_097361346.1|1106762_1107347_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	27.9	1.7e-13
WP_097361347.1|1107343_1107709_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	5.1e-21
WP_097361348.1|1107693_1108239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361349.1|1108219_1109704_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	40.2	3.4e-95
WP_000016414.1|1109704_1110151_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_000101348.1|1110150_1110555_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228831.1|1110596_1110779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741779.1|1110762_1112934_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_097361350.1|1112930_1113641_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	2.5e-27
WP_000890115.1|1113640_1113943_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000122818.1|1113939_1114809_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_000068499.1|1114789_1115467_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.4	5.4e-32
WP_001191865.1|1115479_1115836_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_001293657.1|1115832_1117074_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_097361351.1|1117075_1117678_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	4.3e-33
WP_097361352.1|1117667_1119119_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	72.8	1.7e-46
WP_097361353.1|1119619_1119925_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	60.0	1.9e-29
WP_097361354.1|1119914_1120649_+	DUF4376 domain-containing protein	NA	A0A0M4RTP2	Salmonella_phage	76.1	1.7e-47
WP_097361355.1|1120703_1122821_+	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	53.7	2.4e-163
WP_057395107.1|1122951_1123326_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	41.3	1.5e-15
>prophage 3
NZ_CP045063	Salmonella enterica subsp. enterica serovar Muenchen strain LG26 chromosome, complete genome	4930420	1817234	1911626	4930420	integrase,transposase,terminase,capsid,head,lysis,protease,portal,tail,tRNA	Enterobacteria_phage(44.74%)	103	1809324:1809339	1907618:1907633
1809324:1809339	attL	CGCGTGAGCGCGATAT	NA	NA	NA	NA
WP_000173208.1|1817234_1818491_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000174484.1|1818804_1819428_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_000988258.1|1819424_1820276_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001518537.1|1820541_1821489_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
WP_001037188.1|1821613_1823299_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	2.3e-23
WP_000823878.1|1823343_1823622_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000365078.1|1823872_1824481_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001748456.1|1824597_1825689_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001748457.1|1825847_1827113_-	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
WP_001058311.1|1827612_1828731_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000070986.1|1828727_1830521_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_020438146.1|1830539_1831271_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000993801.1|1831267_1831864_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001615886.1|1831853_1832258_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000063377.1|1832254_1833103_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263613.1|1833177_1834722_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000888110.1|1834733_1835870_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270306.1|1835882_1835972_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001526439.1|1836366_1837641_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_020438149.1|1837854_1839567_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_000511323.1|1839629_1839884_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_020438150.1|1840052_1840787_+	flagellar brake protein YcgR	NA	NA	NA	NA	NA
WP_000776974.1|1840800_1841412_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_020438151.1|1841581_1842496_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000338376.1|1842592_1844326_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_023197862.1|1844387_1845458_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266937.1|1845471_1846770_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190831.1|1847092_1848625_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234826.1|1848671_1849391_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406446.1|1849610_1851155_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943475.1|1851296_1851827_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_079952872.1|1852062_1852200_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_079952870.1|1852759_1853140_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	41.6	5.2e-16
WP_153789548.1|1853270_1854557_-	hypothetical protein	NA	S5MDQ7	Escherichia_phage	38.3	2.1e-56
WP_097361386.1|1855636_1856260_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	37.8	2.2e-32
WP_097361387.1|1856271_1857468_-	hypothetical protein	NA	H6WZM9	Escherichia_phage	50.5	8.4e-20
WP_057393620.1|1857609_1857762_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_097361388.1|1861582_1862287_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	61.2	2.0e-66
WP_097361389.1|1862184_1862922_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.2	1.4e-113
WP_097361390.1|1862931_1863627_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	69.3	1.1e-91
WP_097361391.1|1863781_1864945_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	55.6	5.3e-112
WP_079953114.1|1865082_1865415_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	61.1	7.0e-33
WP_097361392.1|1865411_1868507_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	51.8	1.9e-241
WP_079953116.1|1868490_1868793_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	59.4	7.5e-26
WP_057395189.1|1868813_1869203_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	57.0	6.5e-30
WP_057395195.1|1869259_1870012_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	70.4	1.0e-95
WP_001643846.1|1870024_1870426_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	60.6	9.6e-45
WP_057395188.1|1870425_1871025_-|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	69.7	9.9e-70
WP_097361393.1|1871041_1871398_-|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	58.5	1.7e-32
WP_057395186.1|1871408_1871783_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_057395185.1|1871847_1872876_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.1	1.9e-108
WP_057395184.1|1872969_1873317_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.8	2.1e-19
WP_057395183.1|1873313_1874837_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.7	4.5e-103
WP_097361394.1|1874826_1876422_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.4	2.6e-186
WP_057395181.1|1876418_1876622_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	80.0	1.3e-18
WP_079953120.1|1876605_1878540_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	65.8	2.9e-256
WP_057395179.1|1878511_1879057_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	7.6e-53
WP_097361395.1|1879517_1880714_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_070809067.1|1880894_1881185_+	lipoprotein bor	NA	C6ZCX3	Enterobacteria_phage	62.9	8.2e-30
WP_097361565.1|1881216_1881651_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	73.9	4.1e-49
WP_153789549.1|1881803_1881971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079953123.1|1882288_1882774_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	69.4	1.1e-58
WP_097361566.1|1882754_1883042_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_079953022.1|1883218_1883446_+	hypothetical protein	NA	Q38575	Escherichia_phage	42.5	2.4e-08
WP_097361396.1|1883435_1883816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079953024.1|1884491_1884974_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_079953025.1|1885193_1885448_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	42.9	5.0e-15
WP_079953026.1|1885444_1885786_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_079953027.1|1885928_1886678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361397.1|1886578_1887715_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	33.9	4.6e-52
WP_097361398.1|1887736_1888105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361399.1|1888176_1890129_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	33.4	7.6e-95
WP_097361400.1|1890207_1890435_-	derepression protein	NA	NA	NA	NA	NA
WP_057394489.1|1890928_1891192_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_097361402.1|1891194_1891617_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	56.6	3.8e-28
WP_097361403.1|1891620_1892094_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.5	5.2e-66
WP_058645051.1|1893154_1893403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079953034.1|1893399_1893795_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	36.9	2.7e-15
WP_097361404.1|1893791_1896110_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	27.1	1.6e-38
WP_153789550.1|1896067_1896310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361405.1|1896599_1896857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057395050.1|1897243_1897435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057395049.1|1897431_1897626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361406.1|1897779_1898358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057395047.1|1898875_1899343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125468762.1|1899427_1899706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361407.1|1899662_1900085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079953039.1|1900112_1900613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361408.1|1900725_1901067_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058645046.1|1901137_1902127_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	54.0	1.7e-98
WP_000018967.1|1902318_1902660_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001083582.1|1902731_1902905_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001519337.1|1903096_1903234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785716.1|1903585_1904047_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001519895.1|1904124_1904784_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001525604.1|1904833_1905127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072527.1|1905252_1905960_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101047.1|1905983_1906796_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185666.1|1906799_1907066_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_097361409.1|1907187_1908315_-	ribonuclease D	NA	NA	NA	NA	NA
1907618:1907633	attR	ATATCGCGCTCACGCG	NA	NA	NA	NA
WP_000758418.1|1908387_1910073_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
WP_021294445.1|1910277_1910859_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_001221014.1|1910930_1911626_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP045063	Salmonella enterica subsp. enterica serovar Muenchen strain LG26 chromosome, complete genome	4930420	1965728	1971118	4930420	integrase	uncultured_Caudovirales_phage(33.33%)	9	1965775:1965789	1976663:1976677
WP_097361410.1|1965728_1966262_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	50.0	2.4e-11
1965775:1965789	attL	CGTTCACACGTCATT	NA	NA	NA	NA
WP_001013467.1|1966315_1966546_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_020438171.1|1966576_1967683_+	hypothetical protein	NA	Q9QF34	Lambdoid_phage	65.0	1.1e-53
WP_071602162.1|1967679_1967874_+	hypothetical protein	NA	A0A2H4IYC8	uncultured_Caudovirales_phage	59.5	5.9e-08
WP_072205508.1|1967902_1968757_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.0	1.2e-71
WP_000722368.1|1969129_1969483_-	YebY family protein	NA	NA	NA	NA	NA
WP_000979705.1|1969499_1970375_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1970375_1970750_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1970887_1971118_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
1976663:1976677	attR	CGTTCACACGTCATT	NA	NA	NA	NA
>prophage 5
NZ_CP045063	Salmonella enterica subsp. enterica serovar Muenchen strain LG26 chromosome, complete genome	4930420	2073791	2085202	4930420		Morganella_phage(25.0%)	12	NA	NA
WP_001157315.1|2073791_2075222_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_001748531.1|2075295_2075991_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107434.1|2076070_2076382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017465542.1|2077033_2078245_+	porin	NA	Q1MVN1	Enterobacteria_phage	56.2	4.4e-109
WP_024131109.1|2078504_2078693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2078703_2078916_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457663.1|2079370_2080639_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000394197.1|2080641_2081061_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_001537372.1|2081187_2081349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598921.1|2081829_2082627_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001683376.1|2082998_2083289_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	52.6	2.1e-09
WP_153789552.1|2083933_2085202_+	DUF4102 domain-containing protein	NA	A0A0U1UNT3	Pseudomonas_phage	36.5	4.2e-62
>prophage 6
NZ_CP045063	Salmonella enterica subsp. enterica serovar Muenchen strain LG26 chromosome, complete genome	4930420	2209143	2219650	4930420		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126351.1|2209143_2210457_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
WP_000565902.1|2210483_2211563_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000648783.1|2211567_2212341_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_020437413.1|2212356_2213331_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973714.1|2213336_2213888_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000857530.1|2213888_2214767_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_001023659.1|2214814_2215714_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697840.1|2215713_2216799_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981471.1|2217175_2218069_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111837.1|2218246_2219650_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
>prophage 7
NZ_CP045063	Salmonella enterica subsp. enterica serovar Muenchen strain LG26 chromosome, complete genome	4930420	2298105	2307276	4930420	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_021294257.1|2298105_2300139_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2300379_2300838_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|2301009_2301540_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2301596_2302064_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2302110_2302830_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2302826_2304512_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|2304734_2305466_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2305525_2305633_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2305613_2306345_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2306328_2307276_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 8
NZ_CP045063	Salmonella enterica subsp. enterica serovar Muenchen strain LG26 chromosome, complete genome	4930420	3441669	3481274	4930420	transposase,terminase,head,tail,integrase,plate	Pseudomonas_phage(23.53%)	56	3441416:3441431	3481383:3481398
3441416:3441431	attL	CAATCAATTCTGGACA	NA	NA	NA	NA
WP_153789573.1|3441669_3442251_-	helix-turn-helix domain-containing protein	NA	A0A1C6ZDG7	Pseudomonas_phage	34.0	2.0e-06
WP_153789574.1|3442417_3442684_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_153789575.1|3442693_3444757_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	42.1	1.4e-144
WP_153789576.1|3444774_3445668_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	54.9	5.6e-85
WP_153789577.1|3445681_3445954_+	hypothetical protein	NA	A0A0F6WDF2	Pseudomonas_phage	39.0	3.5e-06
WP_153789578.1|3445966_3446248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789579.1|3446262_3446484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789580.1|3446495_3446711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789581.1|3446725_3446932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789582.1|3446921_3447614_+	DUF3164 family protein	NA	Q6QIE4	Burkholderia_phage	55.3	3.0e-62
WP_153789583.1|3447540_3447843_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153789584.1|3448097_3448364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789585.1|3448364_3448583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789586.1|3448564_3449266_+	DUF4406 domain-containing protein	NA	A0A0K1LK36	Vibrio_phage	53.7	1.7e-17
WP_153789587.1|3449456_3449792_+	hypothetical protein	NA	A0A219YC07	Aeromonas_phage	37.7	4.7e-05
WP_153789588.1|3449896_3450445_+	AsnC family protein	NA	NA	NA	NA	NA
WP_153789589.1|3450470_3450848_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	45.4	2.4e-13
WP_153789590.1|3450844_3451258_+	DUF1018 domain-containing protein	NA	A0A2D1GNN4	Pseudomonas_phage	53.6	5.1e-33
WP_153789591.1|3451379_3451847_+	mor transcription activator family protein	NA	A0A2D1GNW5	Pseudomonas_phage	45.0	5.0e-21
WP_153789592.1|3451885_3452194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789593.1|3452299_3452512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789594.1|3452514_3453042_+	glycoside hydrolase family protein	NA	A0A0M3LPQ1	Mannheimia_phage	46.8	1.8e-38
WP_153789595.1|3453026_3453605_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	31.3	1.1e-09
WP_153789596.1|3453582_3453828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789597.1|3453827_3454328_+	DUF1804 family protein	NA	I6PBD1	Pseudomonas_phage	50.0	1.8e-37
WP_153789598.1|3454314_3454530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789599.1|3455047_3455515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153789600.1|3455529_3455703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153789601.1|3455821_3457465_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	61.7	4.2e-187
WP_153789602.1|3457474_3459064_+	DUF935 family protein	NA	H1ZZE2	Pseudomonas_virus	42.9	6.2e-111
WP_153789603.1|3459053_3460214_+|head	phage head morphogenesis protein	head	Q6QIB9	Burkholderia_phage	41.5	8.1e-52
WP_153789604.1|3460194_3460746_+	phage virion morphogenesis protein	NA	A0A2K9VH22	Faecalibacterium_phage	32.2	1.3e-12
WP_153789605.1|3460963_3462127_+	hypothetical protein	NA	A0A2D1GNS3	Pseudomonas_phage	40.0	6.2e-60
WP_153789606.1|3462126_3462525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789607.1|3462534_3463446_+|head	head protein	head	A0A2H4J778	uncultured_Caudovirales_phage	57.6	2.0e-98
WP_153789608.1|3463442_3463892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789609.1|3463901_3464327_+	DUF1320 domain-containing protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	36.1	2.8e-10
WP_153789610.1|3464323_3465016_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_153789611.1|3464975_3465152_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_153789612.1|3465144_3466554_+|tail	phage tail protein	tail	A0A0M3LQC3	Mannheimia_phage	43.8	1.6e-94
WP_153789613.1|3466562_3466937_+|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	51.7	7.9e-25
WP_153789614.1|3466933_3467320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789615.1|3467474_3469781_+|tail	tail length tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	34.0	7.2e-68
WP_153789616.1|3469777_3471178_+	multidrug DMT transporter permease	NA	A0A0M3LQ21	Mannheimia_phage	26.3	1.4e-29
WP_153789641.1|3471167_3472355_+|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	37.1	9.4e-72
WP_153789617.1|3472351_3473050_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	44.2	5.7e-45
WP_153789618.1|3473122_3473473_+	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	55.7	1.8e-26
WP_153789619.1|3473472_3474531_+|tail	phage tail protein	tail	A0A0M3LQN4	Mannheimia_phage	45.6	1.8e-74
WP_153789620.1|3474530_3475103_+	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	39.2	1.2e-29
WP_153793124.1|3475099_3476464_+	hypothetical protein	NA	A0A0M3ULH6	Salmonella_phage	59.2	1.5e-49
WP_153789621.1|3476562_3477252_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	53.1	7.1e-64
WP_153793125.1|3477298_3477610_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	42.4	5.9e-10
WP_153789623.1|3477725_3478286_+	helix-turn-helix domain-containing protein	NA	A0A0A7NPV4	Enterobacteria_phage	77.0	5.8e-72
WP_153789624.1|3478359_3478536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789625.1|3478580_3478844_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_153789642.1|3479228_3481274_+	sialate O-acetylesterase	NA	G9L6J1	Escherichia_phage	51.7	4.0e-163
3481383:3481398	attR	TGTCCAGAATTGATTG	NA	NA	NA	NA
>prophage 9
NZ_CP045063	Salmonella enterica subsp. enterica serovar Muenchen strain LG26 chromosome, complete genome	4930420	4292878	4388356	4930420	holin,tRNA,terminase,capsid,head,protease,portal,tail,integrase,plate	Salmonella_phage(77.78%)	110	4325777:4325821	4358448:4358492
WP_001621365.1|4292878_4293316_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001518251.1|4293360_4294302_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001259012.1|4294316_4294763_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
WP_000558166.1|4294759_4295071_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_021294279.1|4295156_4296086_-	alpha/beta hydrolase	NA	A0A2K9L5W3	Tupanvirus	44.4	1.3e-07
WP_001159630.1|4296303_4296615_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_000362050.1|4296615_4296906_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000027730.1|4296952_4297882_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829025.1|4297878_4298514_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331361.1|4298510_4299413_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_077248424.1|4299425_4302476_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
WP_001059740.1|4302670_4303507_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000710966.1|4303774_4304806_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000828039.1|4304988_4306089_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000527677.1|4306432_4306756_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000683586.1|4306755_4307415_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010989088.1|4307497_4308064_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000619475.1|4308152_4308467_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_097361574.1|4308463_4309612_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179690.1|4309738_4310566_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001661624.1|4310708_4311968_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_023197765.1|4311964_4313434_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217112.1|4313721_4314558_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000013291.1|4314710_4315559_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063541.1|4315555_4316590_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000378721.1|4317208_4317892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000566800.1|4318049_4319357_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001091413.1|4319349_4319865_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000812816.1|4319883_4320867_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_097361573.1|4321195_4321816_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	3.2e-63
WP_011233226.1|4321822_4322575_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_021294276.1|4322586_4322982_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000580402.1|4323032_4324406_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033731.1|4324402_4325101_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001233463.1|4325251_4325752_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4325777:4325821	attL	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_079953016.1|4325928_4326909_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	97.9	1.5e-184
WP_099706372.1|4326978_4327332_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	100.0	1.2e-59
WP_024153929.1|4327403_4327865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422421.1|4327815_4328271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031607754.1|4328409_4328691_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	100.0	1.4e-50
WP_000078935.1|4328701_4328905_+	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	98.5	1.2e-30
WP_000290619.1|4328915_4329122_+	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	100.0	4.3e-33
WP_000543629.1|4329111_4329342_+	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	76.0	1.2e-28
WP_000482341.1|4329436_4329871_+	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	91.0	5.1e-68
WP_000946669.1|4329870_4330053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166617.1|4330096_4330309_+	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	95.7	6.4e-32
WP_000620901.1|4330310_4331192_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	82.3	6.6e-131
WP_097361544.1|4331191_4331389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128157.1|4331389_4332424_+	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	61.9	5.6e-129
WP_058648989.1|4332420_4334781_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	86.1	0.0e+00
WP_024153925.1|4334856_4335450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024153924.1|4335463_4336576_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	31.1	4.4e-31
WP_000014576.1|4336978_4338028_-|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	100.0	6.7e-207
WP_024153923.1|4338028_4339741_-	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	98.6	0.0e+00
WP_024153922.1|4339894_4340740_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	98.2	1.4e-154
WP_001246220.1|4340780_4341827_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	99.7	3.7e-197
WP_044144072.1|4341869_4342718_+|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	96.5	4.7e-134
WP_024153920.1|4342820_4343309_+|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	96.9	1.5e-84
WP_001102549.1|4343308_4343509_+|tail	tail protein	tail	A0A0M4RTN6	Salmonella_phage	100.0	1.8e-31
WP_000543937.1|4343519_4343855_+|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	98.2	2.1e-53
WP_024153919.1|4343838_4344279_+	lysozyme	NA	A0A0M5M782	Salmonella_phage	97.9	1.4e-76
WP_024153918.1|4344379_4344910_+	DUF2514 family protein	NA	A0A0M4S5V1	Salmonella_phage	93.8	7.4e-45
WP_000917105.1|4344909_4345404_+|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	98.0	8.7e-80
WP_058648991.1|4345364_4346009_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	96.7	2.8e-115
WP_097361545.1|4346165_4346795_+|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	97.6	9.3e-111
WP_000108899.1|4346791_4347154_+|plate	baseplate assembly protein	plate	A0A0M4S6L5	Salmonella_phage	99.2	3.3e-60
WP_024153915.1|4347150_4348062_+|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	97.7	7.0e-160
WP_097361546.1|4348054_4348669_+|tail	phage tail protein I	tail	A0A1J0I2I4	Salmonella_phage	97.9	1.9e-108
WP_044144047.1|4348658_4350395_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	74.8	3.6e-197
WP_024153912.1|4350394_4350964_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	95.2	6.0e-101
WP_024153911.1|4351168_4351618_-|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	97.3	2.5e-78
WP_024153910.1|4351628_4354556_-|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	92.5	0.0e+00
WP_000763324.1|4354556_4354673_-|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	100.0	6.6e-15
WP_000047593.1|4354681_4355017_-	hypothetical protein	NA	A0A0M4RCV2	Salmonella_phage	99.1	3.0e-52
WP_001207579.1|4355031_4355547_-|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	95.9	3.9e-91
WP_000224787.1|4355559_4356753_-|tail	tail protein	tail	A0A0M4S6M1	Salmonella_phage	94.2	1.0e-214
WP_024153908.1|4356910_4358029_+	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	99.5	3.8e-192
WP_001251454.1|4358077_4358320_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001077320.1|4358570_4359473_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4358448:4358492	attR	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591793.1|4359657_4360620_+	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758711.1|4360823_4361813_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000750756.1|4361913_4362669_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000777314.1|4362933_4364268_+	MFS transporter	NA	NA	NA	NA	NA
WP_021294116.1|4364278_4365238_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000557881.1|4365247_4366288_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001535809.1|4366350_4367073_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000060999.1|4367170_4367341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621105.1|4367356_4367488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173083.1|4367577_4367928_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000113085.1|4367941_4369534_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_023197763.1|4369620_4370580_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001167255.1|4370835_4372371_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	8.3e-20
WP_000911133.1|4372364_4373408_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000981826.1|4373404_4374406_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000090737.1|4374434_4375457_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774146.1|4375485_4376361_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_001738619.1|4376443_4376734_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001088050.1|4376743_4377508_+	epimerase	NA	NA	NA	NA	NA
WP_001216335.1|4377599_4378367_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802241.1|4378479_4379076_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155237.1|4379176_4379605_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000796303.1|4379711_4380458_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250624.1|4380554_4381565_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136809.1|4381676_4383185_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084285.1|4383205_4384051_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000051370.1|4384449_4384689_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|4384910_4385396_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139639.1|4385488_4386418_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293360.1|4386484_4387816_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000208240.1|4387825_4388356_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 10
NZ_CP045063	Salmonella enterica subsp. enterica serovar Muenchen strain LG26 chromosome, complete genome	4930420	4506973	4525125	4930420	tail,plate	Burkholderia_phage(40.0%)	23	NA	NA
WP_001177097.1|4506973_4507489_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
WP_000368203.1|4507498_4508980_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_000359500.1|4508982_4509615_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_020437568.1|4509607_4510723_-|plate	phage baseplate	plate	Q6QI99	Burkholderia_phage	51.7	3.4e-100
WP_001093501.1|4510713_4511073_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632048.1|4511236_4512784_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
WP_020437570.1|4512783_4513713_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	3.9e-150
WP_000593184.1|4513709_4514072_-	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_017465888.1|4514399_4515122_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_017465889.1|4515131_4516175_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	6.5e-77
WP_001269716.1|4516162_4516372_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_020437572.1|4516371_4517325_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	51.5	1.0e-36
WP_153789630.1|4517324_4519676_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.2	2.4e-66
WP_001185655.1|4519772_4519901_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_020437574.1|4519860_4520178_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_020437575.1|4520229_4520754_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	3.6e-68
WP_000729853.1|4520753_4522181_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.4e-194
WP_097361551.1|4522170_4522368_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	51.0	5.6e-06
WP_000449439.1|4522364_4522820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777267.1|4522978_4523293_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	8.3e-20
WP_020437576.1|4523305_4523911_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	1.4e-60
WP_001226439.1|4523913_4524201_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_000615248.1|4524777_4525125_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP045061	Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence	270863	24831	136604	270863	holin,terminase,integrase,plate,protease,tail,head,bacteriocin,lysis,transposase,portal,capsid	Salmonella_phage(36.21%)	97	25109:25125	71702:71718
WP_097361660.1|24831_25506_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.2e-11
25109:25125	attL	AACAGCAGGTTATCATT	NA	NA	NA	NA
WP_057393574.1|26360_27257_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_139760138.1|29096_30011_+	pyocin	NA	NA	NA	NA	NA
WP_057395147.1|30007_30280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139760136.1|30872_30986_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	94.6	1.4e-09
WP_057395148.1|31021_31591_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.4	8.4e-95
WP_097361583.1|31590_32766_-|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	80.3	3.4e-50
WP_097361584.1|32752_33340_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	97.9	7.8e-112
WP_097361585.1|33342_34422_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	95.8	1.2e-198
WP_000605053.1|34414_34828_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	94.9	3.3e-72
WP_001273646.1|34832_35366_-|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	98.9	1.0e-94
WP_097361587.1|35365_36424_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.1	4.3e-201
WP_097361588.1|36420_37761_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	98.9	5.3e-249
WP_000497739.1|40928_41093_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779212.1|41096_41657_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	97.3	3.7e-103
WP_079953067.1|41653_42166_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	96.5	8.1e-89
WP_000702382.1|42137_42542_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	88.1	9.3e-64
WP_000927721.1|42538_42862_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_000601365.1|42864_43065_-	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_079781928.1|43114_44320_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.5	1.1e-221
WP_153789523.1|44334_44985_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	96.3	1.5e-116
WP_000466255.1|44962_46204_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_097361591.1|46203_46386_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	98.3	5.0e-25
WP_153789524.1|46397_46538_-	hypothetical protein	NA	Q8HAD6	Salmonella_phage	97.8	1.7e-17
WP_153789525.1|46586_48131_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.6	7.4e-311
WP_079953069.1|48127_48622_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	99.4	7.8e-89
WP_001135222.1|48752_49103_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	96.6	1.0e-63
WP_001292891.1|49163_49466_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	97.0	5.1e-51
WP_000501908.1|49542_49830_-	TonB family protein	NA	H6WZK5	Escherichia_phage	50.0	7.6e-20
WP_001050801.1|50007_50553_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	58.1	2.8e-07
WP_001527046.1|51166_51511_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_070801491.1|52432_53245_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	47.0	1.4e-63
WP_080198751.1|53536_54352_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	74.2	1.8e-106
WP_097361593.1|54348_55209_-	helix-turn-helix domain containing protein	NA	A0A1B5FPA6	Escherichia_phage	80.6	8.7e-128
WP_097361594.1|55208_56177_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	87.9	7.0e-166
WP_097361595.1|56173_57778_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	85.4	1.2e-274
WP_079953078.1|58835_59492_+	LexA family transcriptional regulator	NA	Q8W648	Enterobacteria_phage	74.3	1.8e-93
WP_000560246.1|59632_59830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361596.1|59832_60024_+	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	53.2	1.4e-09
WP_079953080.1|60097_60292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155900.1|60288_60474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079916472.1|60661_60871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079953081.1|60794_61211_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	56.4	7.2e-27
WP_097361597.1|61210_61411_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	71.7	1.9e-14
WP_079953083.1|61441_62347_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	77.6	2.9e-129
WP_070801904.1|62343_62910_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	39.4	1.8e-28
WP_079953084.1|62906_63131_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	65.8	1.2e-17
WP_079953085.1|63127_63592_+	ATPase	NA	A0A1B5FPC7	Escherichia_phage	51.7	4.4e-41
WP_000202173.1|63591_63807_+	hypothetical protein	NA	A0A248XD10	Klebsiella_phage	43.1	1.6e-06
WP_070789913.1|63957_64200_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	68.4	1.1e-22
WP_097361598.1|64225_65551_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	64.5	1.1e-164
WP_079953089.1|66042_67593_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.9	3.0e-09
WP_079953095.1|71578_71992_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	38.5	5.8e-13
71702:71718	attR	AATGATAACCTGCTGTT	NA	NA	NA	NA
WP_079953096.1|71991_72312_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	65.6	2.3e-33
WP_097361599.1|73337_74243_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	58.8	6.2e-84
WP_058644812.1|74409_75498_+	quinol oxidase	NA	NA	NA	NA	NA
WP_097361600.1|76471_77674_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.5	8.9e-78
WP_079953100.1|77613_77898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361601.1|77926_78682_-	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	41.8	3.8e-42
WP_097361602.1|81917_84119_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_023247018.1|84144_85479_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_097361603.1|85482_87216_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_097361604.1|87215_88163_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_153789526.1|88163_89888_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_097361605.1|90020_91232_+	MFS transporter	NA	NA	NA	NA	NA
WP_097361606.1|91247_92135_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_023247011.1|93840_94377_+	fimbrial protein	NA	NA	NA	NA	NA
WP_079953106.1|94502_95165_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_097361607.1|95175_97722_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_097361662.1|97852_98905_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_097361608.1|99067_99520_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_057394607.1|99659_100034_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_047643234.1|100217_100544_-	nucleoside transporter	NA	NA	NA	NA	NA
WP_077917243.1|100565_101192_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	4.1e-50
WP_097361454.1|101188_102418_-	DUF3440 domain-containing protein	NA	A0A068F1U8	Mycobacterium_phage	34.1	1.7e-60
WP_097361455.1|102411_103143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361456.1|103132_103663_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000984349.1|104185_104656_-	DUF2919 family protein	NA	NA	NA	NA	NA
WP_153793118.1|106788_107754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153793119.1|107636_112469_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_097361609.1|112647_114444_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_000493286.1|115580_115910_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_057394952.1|115890_116172_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	39.1	5.9e-09
WP_153793120.1|116630_116801_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	60.9	1.8e-08
WP_097361610.1|117061_118813_+	colicin	NA	NA	NA	NA	NA
WP_057394954.1|118815_119079_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_057394955.1|119162_119309_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_057393714.1|122990_123563_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	86.8	8.2e-82
WP_057393711.1|123683_124136_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_153793121.1|124167_125589_-	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_153793122.1|125474_125699_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_079953337.1|125695_125965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057394178.1|127617_127890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057393723.1|132374_132983_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	33.9	1.2e-17
WP_057393721.1|133471_133816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361613.1|135123_136271_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	4.3e-146
WP_153789528.1|136331_136604_-|bacteriocin	colicin-V (microcin-V bacteriocin)	bacteriocin	NA	NA	NA	NA
