The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045059	Salmonella enterica subsp. enterica serovar Muenchen strain LG25 chromosome, complete genome	4930422	968248	975561	4930422	protease	Dickeya_phage(16.67%)	7	NA	NA
WP_001201759.1|968248_969367_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
WP_001748306.1|969363_971310_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|971439_971661_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520787.1|971984_972305_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_000934064.1|972335_974612_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|974824_975022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|975183_975561_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 2
NZ_CP045059	Salmonella enterica subsp. enterica serovar Muenchen strain LG25 chromosome, complete genome	4930422	1076969	1123441	4930422	head,protease,integrase,tail,lysis	Salmonella_phage(25.0%)	65	1072090:1072105	1103838:1103853
1072090:1072105	attL	GCGCCAGACGCGGCGC	NA	NA	NA	NA
WP_000374046.1|1076969_1077629_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_097361317.1|1078216_1079239_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	51.9	3.5e-91
WP_024134793.1|1079222_1079459_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_097361318.1|1079538_1079955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058645056.1|1080048_1080312_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_097361319.1|1080314_1080707_-	hypothetical protein	NA	A0A0M4RTV1	Salmonella_phage	42.4	6.6e-06
WP_057395058.1|1080703_1080973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153789541.1|1080969_1081161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361321.1|1081157_1081373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361322.1|1081372_1081660_-	hypothetical protein	NA	I6RSM9	Salmonella_phage	94.7	5.1e-24
WP_097361323.1|1081656_1081971_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	57.3	2.0e-34
WP_097361324.1|1082006_1082822_-	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	64.7	1.9e-87
WP_097361325.1|1082827_1085422_-	exonuclease VIII	NA	V5UQJ3	Shigella_phage	56.3	9.6e-162
WP_097361326.1|1085562_1085895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024153606.1|1085970_1086177_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_097361327.1|1086180_1086456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361328.1|1086481_1087333_-	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	57.4	5.5e-58
WP_058679873.1|1087641_1087884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079816621.1|1087944_1088214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361329.1|1088585_1089080_-	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	58.8	7.5e-15
WP_024153610.1|1089151_1089427_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	39.2	1.3e-08
WP_097361330.1|1089423_1089918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361331.1|1089965_1090973_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	69.6	1.0e-127
WP_097361332.1|1090965_1091427_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	76.2	3.2e-68
WP_097361333.1|1091442_1091838_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	37.4	1.5e-18
WP_097361334.1|1091834_1092107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023220363.1|1092231_1092444_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	77.1	1.8e-18
WP_097361335.1|1092910_1093510_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	1.5e-97
WP_097361336.1|1093506_1093701_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	7.9e-13
WP_097361337.1|1093697_1093979_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	1.7e-35
WP_097361338.1|1093975_1094512_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	66.3	1.1e-64
WP_097361339.1|1095042_1096473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001525456.1|1096657_1096960_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_097361340.1|1096937_1097477_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	69.5	2.4e-75
WP_097361563.1|1097794_1098250_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	81.9	1.9e-57
WP_070799731.1|1098475_1098664_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_079828278.1|1098727_1099357_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	3.3e-108
WP_079953322.1|1099359_1100979_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	80.1	1.7e-262
WP_097361341.1|1100978_1102487_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	42.7	1.4e-104
WP_097361342.1|1102527_1103217_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.9	1.8e-59
WP_097361343.1|1103213_1104569_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.8	9.4e-68
1103838:1103853	attR	GCGCCGCGTCTGGCGC	NA	NA	NA	NA
WP_097361344.1|1104570_1105053_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	49.4	1.4e-26
WP_079953317.1|1105052_1106081_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	49.1	1.7e-82
WP_097361345.1|1106084_1106432_+	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	33.3	3.1e-07
WP_079953315.1|1106437_1106884_+	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	43.8	1.4e-15
WP_097361346.1|1106877_1107462_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	27.9	1.7e-13
WP_097361347.1|1107458_1107824_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	5.1e-21
WP_097361348.1|1107808_1108354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361349.1|1108334_1109819_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	40.2	3.4e-95
WP_000016414.1|1109819_1110266_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_000101348.1|1110265_1110670_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228831.1|1110711_1110894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741779.1|1110877_1113049_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_097361350.1|1113045_1113756_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	2.5e-27
WP_000890115.1|1113755_1114058_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000122818.1|1114054_1114924_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_000068499.1|1114904_1115582_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.4	5.4e-32
WP_001191865.1|1115594_1115951_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_001293657.1|1115947_1117189_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_097361351.1|1117190_1117793_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	4.3e-33
WP_097361352.1|1117782_1119234_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	72.8	1.7e-46
WP_097361353.1|1119734_1120040_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	60.0	1.9e-29
WP_097361354.1|1120029_1120764_+	DUF4376 domain-containing protein	NA	A0A0M4RTP2	Salmonella_phage	76.1	1.7e-47
WP_097361355.1|1120818_1122936_+	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	53.7	2.4e-163
WP_057395107.1|1123066_1123441_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	41.3	1.5e-15
>prophage 3
NZ_CP045059	Salmonella enterica subsp. enterica serovar Muenchen strain LG25 chromosome, complete genome	4930422	1817349	1911741	4930422	head,protease,terminase,integrase,capsid,transposase,portal,tail,lysis,tRNA	Enterobacteria_phage(44.74%)	103	1809439:1809454	1907733:1907748
1809439:1809454	attL	CGCGTGAGCGCGATAT	NA	NA	NA	NA
WP_000173208.1|1817349_1818606_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000174484.1|1818919_1819543_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_000988258.1|1819539_1820391_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001518537.1|1820656_1821604_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
WP_001037188.1|1821728_1823414_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	2.3e-23
WP_000823878.1|1823458_1823737_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000365078.1|1823987_1824596_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001748456.1|1824712_1825804_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001748457.1|1825962_1827228_-	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
WP_001058311.1|1827727_1828846_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000070986.1|1828842_1830636_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_020438146.1|1830654_1831386_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000993801.1|1831382_1831979_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001615886.1|1831968_1832373_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000063377.1|1832369_1833218_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263613.1|1833292_1834837_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000888110.1|1834848_1835985_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270306.1|1835997_1836087_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001526439.1|1836481_1837756_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_020438149.1|1837969_1839682_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_000511323.1|1839744_1839999_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_020438150.1|1840167_1840902_+	flagellar brake protein YcgR	NA	NA	NA	NA	NA
WP_000776974.1|1840915_1841527_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_020438151.1|1841696_1842611_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000338376.1|1842707_1844441_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_023197862.1|1844502_1845573_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266937.1|1845586_1846885_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190831.1|1847207_1848740_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234826.1|1848786_1849506_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406446.1|1849725_1851270_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943475.1|1851411_1851942_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_079952872.1|1852177_1852315_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_079952870.1|1852874_1853255_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	41.6	5.2e-16
WP_153789548.1|1853385_1854672_-	hypothetical protein	NA	S5MDQ7	Escherichia_phage	38.3	2.1e-56
WP_097361386.1|1855751_1856375_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	37.8	2.2e-32
WP_097361387.1|1856386_1857583_-	hypothetical protein	NA	H6WZM9	Escherichia_phage	50.5	8.4e-20
WP_057393620.1|1857724_1857877_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_097361388.1|1861697_1862402_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	61.2	2.0e-66
WP_097361389.1|1862299_1863037_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.2	1.4e-113
WP_097361390.1|1863046_1863742_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	69.3	1.1e-91
WP_097361391.1|1863896_1865060_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	55.6	5.3e-112
WP_079953114.1|1865197_1865530_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	61.1	7.0e-33
WP_097361392.1|1865526_1868622_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	51.8	1.9e-241
WP_079953116.1|1868605_1868908_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	59.4	7.5e-26
WP_057395189.1|1868928_1869318_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	57.0	6.5e-30
WP_057395195.1|1869374_1870127_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	70.4	1.0e-95
WP_001643846.1|1870139_1870541_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	60.6	9.6e-45
WP_057395188.1|1870540_1871140_-|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	69.7	9.9e-70
WP_097361393.1|1871156_1871513_-|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	58.5	1.7e-32
WP_057395186.1|1871523_1871898_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_057395185.1|1871962_1872991_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.1	1.9e-108
WP_057395184.1|1873084_1873432_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.8	2.1e-19
WP_057395183.1|1873428_1874952_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.7	4.5e-103
WP_097361394.1|1874941_1876537_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.4	2.6e-186
WP_057395181.1|1876533_1876737_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	80.0	1.3e-18
WP_079953120.1|1876720_1878655_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	65.8	2.9e-256
WP_057395179.1|1878626_1879172_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	7.6e-53
WP_097361395.1|1879632_1880829_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_070809067.1|1881009_1881300_+	lipoprotein bor	NA	C6ZCX3	Enterobacteria_phage	62.9	8.2e-30
WP_097361565.1|1881331_1881766_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	73.9	4.1e-49
WP_153789549.1|1881918_1882086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079953123.1|1882403_1882889_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	69.4	1.1e-58
WP_097361566.1|1882869_1883157_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_079953022.1|1883333_1883561_+	hypothetical protein	NA	Q38575	Escherichia_phage	42.5	2.4e-08
WP_097361396.1|1883550_1883931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079953024.1|1884606_1885089_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_079953025.1|1885308_1885563_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	42.9	5.0e-15
WP_079953026.1|1885559_1885901_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_079953027.1|1886043_1886793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361397.1|1886693_1887830_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	33.9	4.6e-52
WP_097361398.1|1887851_1888220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361399.1|1888291_1890244_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	33.4	7.6e-95
WP_097361400.1|1890322_1890550_-	derepression protein	NA	NA	NA	NA	NA
WP_057394489.1|1891043_1891307_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_097361402.1|1891309_1891732_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	56.6	3.8e-28
WP_097361403.1|1891735_1892209_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.5	5.2e-66
WP_058645051.1|1893269_1893518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079953034.1|1893514_1893910_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	36.9	2.7e-15
WP_097361404.1|1893906_1896225_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	27.1	1.6e-38
WP_153789550.1|1896182_1896425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361405.1|1896714_1896972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057395050.1|1897358_1897550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057395049.1|1897546_1897741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361406.1|1897894_1898473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057395047.1|1898990_1899458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125468762.1|1899542_1899821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361407.1|1899777_1900200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079953039.1|1900227_1900728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361408.1|1900840_1901182_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058645046.1|1901252_1902242_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	54.0	1.7e-98
WP_000018967.1|1902433_1902775_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001083582.1|1902846_1903020_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001519337.1|1903211_1903349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785716.1|1903700_1904162_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001519895.1|1904239_1904899_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001525604.1|1904948_1905242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072527.1|1905367_1906075_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101047.1|1906098_1906911_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185666.1|1906914_1907181_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_097361409.1|1907302_1908430_-	ribonuclease D	NA	NA	NA	NA	NA
1907733:1907748	attR	ATATCGCGCTCACGCG	NA	NA	NA	NA
WP_000758418.1|1908502_1910188_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
WP_021294445.1|1910392_1910974_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_001221014.1|1911045_1911741_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP045059	Salmonella enterica subsp. enterica serovar Muenchen strain LG25 chromosome, complete genome	4930422	1965843	1971233	4930422	integrase	uncultured_Caudovirales_phage(33.33%)	9	1965890:1965904	1976778:1976792
WP_097361410.1|1965843_1966377_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	50.0	2.4e-11
1965890:1965904	attL	CGTTCACACGTCATT	NA	NA	NA	NA
WP_001013467.1|1966430_1966661_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_020438171.1|1966691_1967798_+	hypothetical protein	NA	Q9QF34	Lambdoid_phage	65.0	1.1e-53
WP_071602162.1|1967794_1967989_+	hypothetical protein	NA	A0A2H4IYC8	uncultured_Caudovirales_phage	59.5	5.9e-08
WP_072205508.1|1968017_1968872_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.0	1.2e-71
WP_000722368.1|1969244_1969598_-	YebY family protein	NA	NA	NA	NA	NA
WP_000979705.1|1969614_1970490_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1970490_1970865_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1971002_1971233_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
1976778:1976792	attR	CGTTCACACGTCATT	NA	NA	NA	NA
>prophage 5
NZ_CP045059	Salmonella enterica subsp. enterica serovar Muenchen strain LG25 chromosome, complete genome	4930422	2073906	2085317	4930422		Morganella_phage(25.0%)	12	NA	NA
WP_001157315.1|2073906_2075337_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_001748531.1|2075410_2076106_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107434.1|2076185_2076497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017465542.1|2077148_2078360_+	porin	NA	Q1MVN1	Enterobacteria_phage	56.2	4.4e-109
WP_024131109.1|2078619_2078808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2078818_2079031_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457663.1|2079485_2080754_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000394197.1|2080756_2081176_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_001537372.1|2081302_2081464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598921.1|2081944_2082742_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001683376.1|2083113_2083404_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	52.6	2.1e-09
WP_153789552.1|2084048_2085317_+	DUF4102 domain-containing protein	NA	A0A0U1UNT3	Pseudomonas_phage	36.5	4.2e-62
>prophage 6
NZ_CP045059	Salmonella enterica subsp. enterica serovar Muenchen strain LG25 chromosome, complete genome	4930422	2209258	2219765	4930422		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126351.1|2209258_2210572_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
WP_000565902.1|2210598_2211678_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000648783.1|2211682_2212456_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_020437413.1|2212471_2213446_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973714.1|2213451_2214003_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000857530.1|2214003_2214882_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_001023659.1|2214929_2215829_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697840.1|2215828_2216914_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981471.1|2217290_2218184_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111837.1|2218361_2219765_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
>prophage 7
NZ_CP045059	Salmonella enterica subsp. enterica serovar Muenchen strain LG25 chromosome, complete genome	4930422	2298220	2307391	4930422	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_021294257.1|2298220_2300254_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2300494_2300953_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|2301124_2301655_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2301711_2302179_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2302225_2302945_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2302941_2304627_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|2304849_2305581_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2305640_2305748_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2305728_2306460_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2306443_2307391_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 8
NZ_CP045059	Salmonella enterica subsp. enterica serovar Muenchen strain LG25 chromosome, complete genome	4930422	3441782	3481387	4930422	head,integrase,terminase,transposase,tail,plate	Pseudomonas_phage(24.24%)	55	3441529:3441544	3481496:3481511
3441529:3441544	attL	CAATCAATTCTGGACA	NA	NA	NA	NA
WP_153789573.1|3441782_3442364_-	helix-turn-helix domain-containing protein	NA	A0A1C6ZDG7	Pseudomonas_phage	34.0	2.0e-06
WP_153789574.1|3442530_3442797_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_153789575.1|3442806_3444870_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	42.1	1.4e-144
WP_153789576.1|3444887_3445781_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	54.9	5.6e-85
WP_153789577.1|3445794_3446067_+	hypothetical protein	NA	A0A0F6WDF2	Pseudomonas_phage	39.0	3.5e-06
WP_153789578.1|3446079_3446361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789579.1|3446375_3446597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789580.1|3446608_3446824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789581.1|3446838_3447045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789582.1|3447034_3447727_+	DUF3164 family protein	NA	Q6QIE4	Burkholderia_phage	55.3	3.0e-62
WP_153789583.1|3447653_3447956_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153789584.1|3448210_3448477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789585.1|3448477_3448696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789586.1|3448677_3449379_+	DUF4406 domain-containing protein	NA	A0A0K1LK36	Vibrio_phage	53.7	1.7e-17
WP_153789587.1|3449569_3449905_+	hypothetical protein	NA	A0A219YC07	Aeromonas_phage	37.7	4.7e-05
WP_153789588.1|3450009_3450558_+	AsnC family protein	NA	NA	NA	NA	NA
WP_153789589.1|3450583_3450961_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	45.4	2.4e-13
WP_153789590.1|3450957_3451371_+	DUF1018 domain-containing protein	NA	A0A2D1GNN4	Pseudomonas_phage	53.6	5.1e-33
WP_153789591.1|3451492_3451960_+	mor transcription activator family protein	NA	A0A2D1GNW5	Pseudomonas_phage	45.0	5.0e-21
WP_153789592.1|3451998_3452307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789593.1|3452412_3452625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789594.1|3452627_3453155_+	glycoside hydrolase family protein	NA	A0A0M3LPQ1	Mannheimia_phage	46.8	1.8e-38
WP_153789595.1|3453139_3453718_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	31.3	1.1e-09
WP_153789596.1|3453695_3453941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789597.1|3453940_3454441_+	DUF1804 family protein	NA	I6PBD1	Pseudomonas_phage	50.0	1.8e-37
WP_153789598.1|3454427_3454643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789599.1|3455160_3455628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153789600.1|3455642_3455816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153789601.1|3455934_3457578_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	61.7	4.2e-187
WP_153789602.1|3457587_3459177_+	DUF935 family protein	NA	H1ZZE2	Pseudomonas_virus	42.9	6.2e-111
WP_153789603.1|3459166_3460327_+|head	phage head morphogenesis protein	head	Q6QIB9	Burkholderia_phage	41.5	8.1e-52
WP_153789604.1|3460307_3460859_+	phage virion morphogenesis protein	NA	A0A2K9VH22	Faecalibacterium_phage	32.2	1.3e-12
WP_153789605.1|3461076_3462240_+	hypothetical protein	NA	A0A2D1GNS3	Pseudomonas_phage	40.0	6.2e-60
WP_153789606.1|3462239_3462638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789607.1|3462647_3463559_+|head	head protein	head	A0A2H4J778	uncultured_Caudovirales_phage	57.6	2.0e-98
WP_153789608.1|3463555_3464005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789609.1|3464014_3464440_+	DUF1320 domain-containing protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	36.1	2.8e-10
WP_153789610.1|3464436_3465129_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_153789611.1|3465088_3465265_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_153789612.1|3465257_3466667_+|tail	phage tail protein	tail	A0A0M3LQC3	Mannheimia_phage	43.8	1.6e-94
WP_153789613.1|3466675_3467050_+|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	51.7	7.9e-25
WP_153789614.1|3467046_3467433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789615.1|3467587_3469894_+|tail	tail length tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	34.0	7.2e-68
WP_153789616.1|3469890_3471291_+	multidrug DMT transporter permease	NA	A0A0M3LQ21	Mannheimia_phage	26.3	1.4e-29
WP_153789641.1|3471280_3472468_+|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	37.1	9.4e-72
WP_153789617.1|3472464_3473163_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	44.2	5.7e-45
WP_153789618.1|3473235_3473586_+	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	55.7	1.8e-26
WP_153789619.1|3473585_3474644_+|tail	phage tail protein	tail	A0A0M3LQN4	Mannheimia_phage	45.6	1.8e-74
WP_153789620.1|3474643_3475216_+	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	39.2	1.2e-29
WP_153789621.1|3476407_3477097_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	53.1	7.1e-64
WP_153789622.1|3477195_3477705_-	hypothetical protein	NA	Q37842	Escherichia_phage	40.2	1.2e-28
WP_153789623.1|3477838_3478399_+	helix-turn-helix domain-containing protein	NA	A0A0A7NPV4	Enterobacteria_phage	77.0	5.8e-72
WP_153789624.1|3478472_3478649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153789625.1|3478693_3478957_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_153789642.1|3479341_3481387_+	sialate O-acetylesterase	NA	G9L6J1	Escherichia_phage	51.7	4.0e-163
3481496:3481511	attR	TGTCCAGAATTGATTG	NA	NA	NA	NA
>prophage 9
NZ_CP045059	Salmonella enterica subsp. enterica serovar Muenchen strain LG25 chromosome, complete genome	4930422	4292993	4388471	4930422	holin,head,protease,integrase,terminase,plate,capsid,portal,tail,tRNA	Salmonella_phage(77.78%)	110	4325892:4325936	4358563:4358607
WP_001621365.1|4292993_4293431_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001518251.1|4293475_4294417_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001259012.1|4294431_4294878_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
WP_000558166.1|4294874_4295186_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_021294279.1|4295271_4296201_-	alpha/beta hydrolase	NA	A0A2K9L5W3	Tupanvirus	44.4	1.3e-07
WP_001159630.1|4296418_4296730_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_000362050.1|4296730_4297021_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000027730.1|4297067_4297997_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829025.1|4297993_4298629_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331361.1|4298625_4299528_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_077248424.1|4299540_4302591_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
WP_001059740.1|4302785_4303622_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000710966.1|4303889_4304921_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000828039.1|4305103_4306204_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000527677.1|4306547_4306871_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000683586.1|4306870_4307530_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010989088.1|4307612_4308179_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000619475.1|4308267_4308582_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_097361574.1|4308578_4309727_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179690.1|4309853_4310681_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001661624.1|4310823_4312083_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_023197765.1|4312079_4313549_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217112.1|4313836_4314673_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000013291.1|4314825_4315674_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063541.1|4315670_4316705_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000378721.1|4317323_4318007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000566800.1|4318164_4319472_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001091413.1|4319464_4319980_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000812816.1|4319998_4320982_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_097361573.1|4321310_4321931_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	3.2e-63
WP_011233226.1|4321937_4322690_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_021294276.1|4322701_4323097_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000580402.1|4323147_4324521_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033731.1|4324517_4325216_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001233463.1|4325366_4325867_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4325892:4325936	attL	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_079953016.1|4326043_4327024_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	97.9	1.5e-184
WP_099706372.1|4327093_4327447_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	100.0	1.2e-59
WP_024153929.1|4327518_4327980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422421.1|4327930_4328386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031607754.1|4328524_4328806_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	100.0	1.4e-50
WP_000078935.1|4328816_4329020_+	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	98.5	1.2e-30
WP_000290619.1|4329030_4329237_+	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	100.0	4.3e-33
WP_000543629.1|4329226_4329457_+	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	76.0	1.2e-28
WP_000482341.1|4329551_4329986_+	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	91.0	5.1e-68
WP_000946669.1|4329985_4330168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166617.1|4330211_4330424_+	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	95.7	6.4e-32
WP_000620901.1|4330425_4331307_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	82.3	6.6e-131
WP_097361544.1|4331306_4331504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128157.1|4331504_4332539_+	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	61.9	5.6e-129
WP_058648989.1|4332535_4334896_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	86.1	0.0e+00
WP_024153925.1|4334971_4335565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024153924.1|4335578_4336691_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	31.1	4.4e-31
WP_000014576.1|4337093_4338143_-|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	100.0	6.7e-207
WP_024153923.1|4338143_4339856_-	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	98.6	0.0e+00
WP_024153922.1|4340009_4340855_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	98.2	1.4e-154
WP_001246220.1|4340895_4341942_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	99.7	3.7e-197
WP_044144072.1|4341984_4342833_+|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	96.5	4.7e-134
WP_024153920.1|4342935_4343424_+|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	96.9	1.5e-84
WP_001102549.1|4343423_4343624_+|tail	tail protein	tail	A0A0M4RTN6	Salmonella_phage	100.0	1.8e-31
WP_000543937.1|4343634_4343970_+|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	98.2	2.1e-53
WP_024153919.1|4343953_4344394_+	lysozyme	NA	A0A0M5M782	Salmonella_phage	97.9	1.4e-76
WP_024153918.1|4344494_4345025_+	DUF2514 family protein	NA	A0A0M4S5V1	Salmonella_phage	93.8	7.4e-45
WP_000917105.1|4345024_4345519_+|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	98.0	8.7e-80
WP_058648991.1|4345479_4346124_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	96.7	2.8e-115
WP_097361545.1|4346280_4346910_+|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	97.6	9.3e-111
WP_000108899.1|4346906_4347269_+|plate	baseplate assembly protein	plate	A0A0M4S6L5	Salmonella_phage	99.2	3.3e-60
WP_024153915.1|4347265_4348177_+|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	97.7	7.0e-160
WP_097361546.1|4348169_4348784_+|tail	phage tail protein I	tail	A0A1J0I2I4	Salmonella_phage	97.9	1.9e-108
WP_044144047.1|4348773_4350510_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	74.8	3.6e-197
WP_024153912.1|4350509_4351079_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	95.2	6.0e-101
WP_024153911.1|4351283_4351733_-|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	97.3	2.5e-78
WP_024153910.1|4351743_4354671_-|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	92.5	0.0e+00
WP_000763324.1|4354671_4354788_-|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	100.0	6.6e-15
WP_000047593.1|4354796_4355132_-	hypothetical protein	NA	A0A0M4RCV2	Salmonella_phage	99.1	3.0e-52
WP_001207579.1|4355146_4355662_-|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	95.9	3.9e-91
WP_000224787.1|4355674_4356868_-|tail	tail protein	tail	A0A0M4S6M1	Salmonella_phage	94.2	1.0e-214
WP_024153908.1|4357025_4358144_+	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	99.5	3.8e-192
WP_001251454.1|4358192_4358435_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001077320.1|4358685_4359588_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4358563:4358607	attR	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591793.1|4359772_4360735_+	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758711.1|4360938_4361928_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000750756.1|4362028_4362784_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000777314.1|4363048_4364383_+	MFS transporter	NA	NA	NA	NA	NA
WP_021294116.1|4364393_4365353_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000557881.1|4365362_4366403_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001535809.1|4366465_4367188_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000060999.1|4367285_4367456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621105.1|4367471_4367603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173083.1|4367692_4368043_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000113085.1|4368056_4369649_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_023197763.1|4369735_4370695_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001167255.1|4370950_4372486_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	8.3e-20
WP_000911133.1|4372479_4373523_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000981826.1|4373519_4374521_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000090737.1|4374549_4375572_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774146.1|4375600_4376476_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_001738619.1|4376558_4376849_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001088050.1|4376858_4377623_+	epimerase	NA	NA	NA	NA	NA
WP_001216335.1|4377714_4378482_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802241.1|4378594_4379191_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155237.1|4379291_4379720_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000796303.1|4379826_4380573_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250624.1|4380669_4381680_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136809.1|4381791_4383300_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084285.1|4383320_4384166_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000051370.1|4384564_4384804_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|4385025_4385511_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139639.1|4385603_4386533_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293360.1|4386599_4387931_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000208240.1|4387940_4388471_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 10
NZ_CP045059	Salmonella enterica subsp. enterica serovar Muenchen strain LG25 chromosome, complete genome	4930422	4507088	4525240	4930422	tail,plate	Burkholderia_phage(40.0%)	23	NA	NA
WP_001177097.1|4507088_4507604_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
WP_000368203.1|4507613_4509095_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_000359500.1|4509097_4509730_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_020437568.1|4509722_4510838_-|plate	phage baseplate	plate	Q6QI99	Burkholderia_phage	51.7	3.4e-100
WP_001093501.1|4510828_4511188_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632048.1|4511351_4512899_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
WP_020437570.1|4512898_4513828_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	3.9e-150
WP_000593184.1|4513824_4514187_-	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_017465888.1|4514514_4515237_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_017465889.1|4515246_4516290_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	6.5e-77
WP_001269716.1|4516277_4516487_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_020437572.1|4516486_4517440_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	51.5	1.0e-36
WP_153789630.1|4517439_4519791_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.2	2.4e-66
WP_001185655.1|4519887_4520016_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_020437574.1|4519975_4520293_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_020437575.1|4520344_4520869_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	3.6e-68
WP_000729853.1|4520868_4522296_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.4e-194
WP_097361551.1|4522285_4522483_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	51.0	5.6e-06
WP_000449439.1|4522479_4522935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777267.1|4523093_4523408_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	8.3e-20
WP_020437576.1|4523420_4524026_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	1.4e-60
WP_001226439.1|4524028_4524316_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_000615248.1|4524892_4525240_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP045058	Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence	270878	24835	146397	270878	protease,holin,terminase,integrase,tail,head,capsid,transposase,lysis,plate,bacteriocin,portal	Salmonella_phage(35.0%)	99	25113:25129	71708:71724
WP_097361660.1|24835_25510_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.2e-11
25113:25129	attL	AACAGCAGGTTATCATT	NA	NA	NA	NA
WP_057393574.1|26364_27261_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_139760138.1|29100_30015_+	pyocin	NA	NA	NA	NA	NA
WP_057395147.1|30011_30284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139760136.1|30876_30990_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	94.6	1.4e-09
WP_057395148.1|31025_31595_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.4	8.4e-95
WP_097361583.1|31594_32770_-|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	80.3	3.4e-50
WP_097361584.1|32756_33344_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	97.9	7.8e-112
WP_097361585.1|33346_34426_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	95.8	1.2e-198
WP_000605053.1|34418_34832_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	94.9	3.3e-72
WP_001273646.1|34836_35370_-|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	98.9	1.0e-94
WP_097361587.1|35369_36428_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.1	4.3e-201
WP_097361588.1|36424_37765_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	98.9	5.3e-249
WP_000497739.1|40932_41097_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779212.1|41100_41661_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	97.3	3.7e-103
WP_079953067.1|41657_42170_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	96.5	8.1e-89
WP_000702382.1|42141_42546_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	88.1	9.3e-64
WP_000927721.1|42542_42866_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_000601365.1|42868_43069_-	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_079781928.1|43118_44324_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.5	1.1e-221
WP_153789523.1|44338_44989_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	96.3	1.5e-116
WP_000466255.1|44966_46208_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_097361591.1|46207_46390_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	98.3	5.0e-25
WP_153789524.1|46401_46542_-	hypothetical protein	NA	Q8HAD6	Salmonella_phage	97.8	1.7e-17
WP_153789525.1|46590_48135_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.6	7.4e-311
WP_079953069.1|48131_48626_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	99.4	7.8e-89
WP_001135222.1|48756_49107_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	96.6	1.0e-63
WP_001292891.1|49167_49470_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	97.0	5.1e-51
WP_000501908.1|49546_49834_-	TonB family protein	NA	H6WZK5	Escherichia_phage	50.0	7.6e-20
WP_001050801.1|50011_50557_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	58.1	2.8e-07
WP_001527046.1|51170_51515_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_070801491.1|52436_53249_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	47.0	1.4e-63
WP_080198751.1|53540_54356_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	74.2	1.8e-106
WP_097361593.1|54352_55213_-	helix-turn-helix domain containing protein	NA	A0A1B5FPA6	Escherichia_phage	80.6	8.7e-128
WP_097361594.1|55212_56181_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	87.9	7.0e-166
WP_097361595.1|56177_57782_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	85.4	1.2e-274
WP_079953078.1|58841_59498_+	LexA family transcriptional regulator	NA	Q8W648	Enterobacteria_phage	74.3	1.8e-93
WP_000560246.1|59638_59836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361596.1|59838_60030_+	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	53.2	1.4e-09
WP_079953080.1|60103_60298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155900.1|60294_60480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079916472.1|60667_60877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079953081.1|60800_61217_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	56.4	7.2e-27
WP_097361597.1|61216_61417_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	71.7	1.9e-14
WP_079953083.1|61447_62353_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	77.6	2.9e-129
WP_070801904.1|62349_62916_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	39.4	1.8e-28
WP_079953084.1|62912_63137_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	65.8	1.2e-17
WP_079953085.1|63133_63598_+	ATPase	NA	A0A1B5FPC7	Escherichia_phage	51.7	4.4e-41
WP_000202173.1|63597_63813_+	hypothetical protein	NA	A0A248XD10	Klebsiella_phage	43.1	1.6e-06
WP_070789913.1|63963_64206_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	68.4	1.1e-22
WP_097361598.1|64231_65557_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	64.5	1.1e-164
WP_079953089.1|66048_67599_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.9	3.0e-09
WP_079953095.1|71584_71998_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	38.5	5.8e-13
71708:71724	attR	AATGATAACCTGCTGTT	NA	NA	NA	NA
WP_079953096.1|71997_72318_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	65.6	2.3e-33
WP_097361599.1|73343_74249_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	58.8	6.2e-84
WP_058644812.1|74415_75504_+	quinol oxidase	NA	NA	NA	NA	NA
WP_097361600.1|76477_77680_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.5	8.9e-78
WP_079953100.1|77619_77904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361601.1|77932_78688_-	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	41.8	3.8e-42
WP_097361602.1|81923_84125_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_023247018.1|84150_85485_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_097361603.1|85488_87222_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_097361604.1|87221_88169_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_153789526.1|88169_89894_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_097361605.1|90026_91238_+	MFS transporter	NA	NA	NA	NA	NA
WP_097361606.1|91253_92141_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_023247011.1|93846_94383_+	fimbrial protein	NA	NA	NA	NA	NA
WP_079953106.1|94508_95171_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_097361607.1|95181_97728_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_097361662.1|97858_98911_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_097361608.1|99073_99526_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_057394607.1|99665_100040_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_047643234.1|100223_100550_-	nucleoside transporter	NA	NA	NA	NA	NA
WP_077917243.1|100571_101198_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	4.1e-50
WP_097361454.1|101194_102424_-	DUF3440 domain-containing protein	NA	A0A068F1U8	Mycobacterium_phage	34.1	1.7e-60
WP_097361455.1|102417_103149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097361456.1|103138_103669_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000984349.1|104191_104662_-	DUF2919 family protein	NA	NA	NA	NA	NA
WP_097361609.1|112654_114451_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_000493286.1|115587_115917_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_057394952.1|115897_116179_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	39.1	5.9e-09
WP_097361610.1|117068_118820_+	colicin	NA	NA	NA	NA	NA
WP_057394954.1|118822_119086_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_057394955.1|119169_119316_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_097361611.1|119839_122836_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.2	0.0e+00
WP_057393714.1|122999_123572_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	86.8	8.2e-82
WP_057393711.1|123692_124145_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_153789527.1|124176_125709_-	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_079953337.1|125705_125975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057394178.1|127627_127900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057393724.1|130144_132247_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	34.6	8.1e-10
WP_057393723.1|132385_132994_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	33.9	1.2e-17
WP_057393721.1|133482_133827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097361613.1|135134_136282_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	4.3e-146
WP_153789528.1|136342_136615_-|bacteriocin	colicin-V (microcin-V bacteriocin)	bacteriocin	NA	NA	NA	NA
WP_139760163.1|136885_139000_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	2.7e-37
WP_097361615.1|138974_140216_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_097361663.1|140873_142424_-	MchC protein	NA	NA	NA	NA	NA
WP_057393929.1|145704_146397_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
