The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP033247	Clostridium butyricum strain CFSA3987 chromosome, complete genome	3864433	491156	544023	3864433	coat,tRNA,protease	Clostridium_phage(27.27%)	52	NA	NA
WP_002582329.1|491156_492176_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.6	2.5e-65
WP_043853365.1|492184_493189_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002582327.1|493303_494530_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.2	2.0e-21
WP_003412645.1|494665_494983_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002582325.1|495062_495422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043853364.1|495543_496686_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002582323.1|496755_497880_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_035764142.1|498027_499044_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_080630488.1|499015_499792_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003429682.1|499971_501006_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_002582319.1|501165_502287_-	glycosyltransferase family 4 protein	NA	A0A2K9VGK0	Pontimonas_phage	40.3	5.0e-06
WP_002582318.1|502395_503394_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_002582317.1|503539_504403_+	sporulation peptidase YabG	NA	NA	NA	NA	NA
WP_002582316.1|504691_504934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002582315.1|505310_506873_+	DUF3794 domain-containing protein	NA	NA	NA	NA	NA
WP_043853363.1|507002_507818_+	cyanophycinase	NA	NA	NA	NA	NA
WP_043853362.1|507820_510430_+	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_002582312.1|510518_511361_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002582311.1|511436_512120_+	stage II sporulation protein R	NA	NA	NA	NA	NA
WP_043853361.1|512134_513124_+	DUF814 domain-containing protein	NA	NA	NA	NA	NA
WP_002582309.1|513171_513582_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003412658.1|513784_514096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002582307.1|514278_515886_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.4	2.5e-152
WP_002582306.1|516168_517704_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_002582305.1|517739_518852_-	galactosyldiacylglycerol synthase	NA	NA	NA	NA	NA
WP_002582304.1|519053_519263_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002582303.1|519665_520253_+	thymidine kinase	NA	A0A249XXF6	Clostridium_phage	57.4	9.4e-57
WP_035764129.1|520274_522032_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002582301.1|522266_523349_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_002582300.1|523463_524051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002582299.1|524069_525119_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	38.0	1.2e-46
WP_002582298.1|525139_525589_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_002582297.1|525727_526357_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002582296.1|526375_526870_+	cytidine deaminase	NA	A0A2H5BMD7	Streptomyces_phage	39.8	2.0e-15
WP_002582295.1|526966_528115_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.7	9.8e-26
WP_002582294.1|528350_529532_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_002582293.1|530390_530750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002582292.1|530768_531449_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_002582291.1|531480_531696_+	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_002582290.1|531747_532227_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_002582289.1|532229_532769_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_002582288.1|532779_534294_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_002582287.1|534469_535318_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_002582286.1|535334_536726_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_002582285.1|536740_537142_+	ATP synthase F1 subunit epsilon	NA	NA	NA	NA	NA
WP_043853360.1|537398_538040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003429670.1|538062_539325_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002582282.1|539579_540650_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	35.4	1.2e-33
WP_002582281.1|541139_541901_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002582280.1|542057_542312_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	57.3	1.1e-17
WP_002582279.1|542391_543426_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_003429668.1|543498_544023_-|protease	spore protease YyaC	protease	A0A0A8WIQ6	Clostridium_phage	37.7	3.9e-22
>prophage 2
NZ_CP033247	Clostridium butyricum strain CFSA3987 chromosome, complete genome	3864433	859119	923089	3864433	coat,transposase,tRNA,integrase	Bacillus_phage(42.86%)	56	883801:883832	923752:923783
WP_002581947.1|859119_859782_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002581946.1|859954_860899_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_153739133.1|860907_861669_+	RsmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_003408763.1|861673_863074_+|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_002581943.1|863235_863580_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_002581942.1|863715_863892_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002581941.1|863924_864377_+	GatB/YqeY domain-containing protein	NA	NA	NA	NA	NA
WP_002581940.1|864572_864860_+	sporulation protein YqfC	NA	NA	NA	NA	NA
WP_003429248.1|864856_865987_+	sporulation protein YqfD	NA	NA	NA	NA	NA
WP_153739134.1|866017_868150_+	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_002581937.1|868146_868653_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002581936.1|868737_869439_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002581935.1|869804_870695_+	GTPase Era	NA	NA	NA	NA	NA
WP_003429242.1|870698_871448_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002581933.1|871454_872087_+	DUF4342 domain-containing protein	NA	NA	NA	NA	NA
WP_002581932.1|872271_872910_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053359037.1|873017_875645_+	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	40.3	4.6e-87
WP_053359036.1|875865_876912_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_003429235.1|877268_878294_+	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
WP_002581928.1|878503_880279_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	33.8	3.4e-57
WP_002581927.1|880315_881425_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.8	4.1e-37
WP_024040180.1|881533_882226_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_046057886.1|882238_883030_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_027637256.1|883092_883440_+	hypothetical protein	NA	NA	NA	NA	NA
883801:883832	attL	AACACAGAACTCGGCTTATGGCTTATCTCGCA	NA	NA	NA	NA
WP_046057887.1|885072_885258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046057888.1|885300_886956_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7Y2	Bacillus_phage	26.7	4.7e-05
WP_046057889.1|886955_887933_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_083319660.1|887925_888636_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	26.9	1.1e-06
WP_083319659.1|888474_889077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153739135.1|889180_889531_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_082076432.1|889532_889799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046057893.1|891403_891790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153739136.1|893393_893531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046057894.1|893883_894084_-	YvrJ family protein	NA	NA	NA	NA	NA
WP_046057895.1|894185_894701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141759797.1|894923_896049_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.8	7.5e-87
WP_046057897.1|896274_896517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046057898.1|896599_897172_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_153739137.1|897334_898237_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_046057922.1|901202_901991_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_046057900.1|901980_903225_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_081043907.1|903200_903320_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_053359033.1|903279_903882_-	accessory gene regulator B family protein	NA	NA	NA	NA	NA
WP_082076430.1|905522_906467_-	DMT family transporter	NA	NA	NA	NA	NA
WP_046057902.1|906830_907862_+	radical SAM protein	NA	NA	NA	NA	NA
WP_046057903.1|907858_908704_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_046057904.1|908735_909917_+	MFS transporter	NA	NA	NA	NA	NA
WP_046057905.1|909940_912646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052707852.1|912741_912993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053359030.1|913089_918189_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	30.0	1.6e-64
WP_046057908.1|918217_919264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046057909.1|919417_920206_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_153739138.1|920479_921196_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_046057911.1|921195_921885_+	thioesterase	NA	NA	NA	NA	NA
WP_052707853.1|921886_922135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053359028.1|922498_923089_+|transposase	transposase	transposase	NA	NA	NA	NA
923752:923783	attR	AACACAGAACTCGGCTTATGGCTTATCTCGCA	NA	NA	NA	NA
>prophage 3
NZ_CP033247	Clostridium butyricum strain CFSA3987 chromosome, complete genome	3864433	1136581	1222477	3864433	capsid,tRNA,protease,integrase,tail,terminase,portal	Clostridium_phage(21.62%)	99	1132262:1132281	1186387:1186406
1132262:1132281	attL	TGTTTTATGTCTGAAAATAT	NA	NA	NA	NA
WP_153739170.1|1136581_1137784_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_153739171.1|1137744_1138413_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_153739172.1|1138436_1139315_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_153739173.1|1139354_1140830_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_002581007.1|1140925_1141894_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_002581006.1|1142116_1143406_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_153739174.1|1143715_1147519_+	mannanase	NA	NA	NA	NA	NA
WP_035762816.1|1148064_1149132_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002581003.1|1149293_1149851_+	DUF3867 domain-containing protein	NA	NA	NA	NA	NA
WP_002581002.1|1149932_1150907_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002581001.1|1151177_1152116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002581000.1|1152322_1153780_+	threonine synthase	NA	NA	NA	NA	NA
WP_003424997.1|1153794_1154691_+	homoserine kinase	NA	NA	NA	NA	NA
WP_002580998.1|1154690_1155128_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_035762811.1|1155203_1156253_-|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	67.5	1.7e-141
WP_035762809.1|1156370_1156868_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1L2BY64	Clostridium_phage	48.1	2.7e-36
WP_035762807.1|1157054_1157750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153739175.1|1157766_1157907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035762803.1|1159368_1159938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035762802.1|1160005_1161070_-	DUF4236 domain-containing protein	NA	Q332B9	Clostridium_botulinum_C_phage	44.9	8.9e-05
WP_035762801.1|1161171_1161516_-	helix-turn-helix transcriptional regulator	NA	A0A1L2BY72	Clostridium_phage	63.2	8.0e-32
WP_035762800.1|1161667_1161865_+	helix-turn-helix domain-containing protein	NA	A0A0B5D0D3	Listeria_phage	52.5	7.1e-09
WP_035762799.1|1162002_1162233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035762798.1|1162233_1162890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035762796.1|1162956_1163391_+	helix-turn-helix transcriptional regulator	NA	A0A1L2BY71	Clostridium_phage	47.5	1.2e-27
WP_035762794.1|1163403_1163580_+	transcriptional regulator	NA	Q8SBM7	Clostridium_phage	66.7	1.1e-13
WP_035762792.1|1163806_1164562_+	ParA family protein	NA	H7BUL8	unidentified_phage	32.2	1.8e-28
WP_035762790.1|1164546_1165617_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_141912273.1|1165661_1166603_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	45.4	7.5e-40
WP_035762787.1|1166621_1166777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035762785.1|1166790_1166979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035762784.1|1167087_1167276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080646809.1|1167293_1167425_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_153739176.1|1167576_1168278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153739177.1|1168417_1168729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035762772.1|1168849_1169164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153739178.1|1169275_1169515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153739179.1|1169550_1169967_+	hypothetical protein	NA	A0A141DZP9	Streptococcus_phage	40.4	1.4e-09
WP_002580972.1|1170004_1170238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002580971.1|1170357_1170687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035762766.1|1170860_1171259_+	hypothetical protein	NA	M9Q1J7	Clostridium_phage	38.0	6.2e-12
WP_002580969.1|1171290_1171515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002580968.1|1171511_1172081_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLG4	Bacillus_phage	52.5	4.4e-43
WP_035762763.1|1172287_1172707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035762761.1|1172886_1173468_+	hypothetical protein	NA	A0A2K9V441	Faecalibacterium_phage	31.9	6.7e-15
WP_153739180.1|1173439_1175266_+|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	52.2	8.5e-173
WP_035762755.1|1175310_1175544_+	hypothetical protein	NA	A0A0C5AEE0	Bacteriophage	47.4	3.9e-14
WP_035762753.1|1175554_1177105_+|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	58.5	1.2e-167
WP_057089070.1|1177064_1178276_+|protease	Clp protease ClpP	protease	A0A0C5AEN1	Bacteriophage	32.7	5.9e-37
WP_035762750.1|1178275_1178629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035762748.1|1178651_1179698_+|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	41.7	2.0e-78
WP_035762746.1|1179707_1179938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035762744.1|1179924_1180239_+	hypothetical protein	NA	A0A0E3Y618	Fusobacterium_phage	33.7	5.8e-05
WP_035762742.1|1180238_1180817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035762739.1|1180818_1181337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035762736.1|1181349_1182786_+	hypothetical protein	NA	H7BVZ4	unidentified_phage	36.0	5.4e-74
WP_153739181.1|1182786_1183317_+|tail	phage tail protein	tail	A0A0C5AJ56	Bacteriophage	34.7	1.8e-19
WP_057089066.1|1183374_1183713_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_153739182.1|1183878_1186077_+	hypothetical protein	NA	A0A218KCH0	Bacillus_phage	46.1	2.0e-43
WP_052501796.1|1186069_1186282_+	hypothetical protein	NA	A0A2K9V2S8	Faecalibacterium_phage	43.8	7.6e-09
WP_153739183.1|1186269_1187199_+	hypothetical protein	NA	H7BVZ1	unidentified_phage	30.7	2.0e-29
1186387:1186406	attR	ATATTTTCAGACATAAAACA	NA	NA	NA	NA
WP_057089061.1|1187198_1187441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153739184.1|1187440_1187992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057089056.1|1187997_1188315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057089054.1|1188304_1189459_+	hypothetical protein	NA	A0A059WFM2	Vibrio_phage	31.6	1.7e-49
WP_057089052.1|1189458_1190112_+|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	39.8	5.2e-24
WP_153739185.1|1190115_1191501_+|tail	phage tail protein	tail	A0A1V0DZY8	Clostridioides_phage	51.0	1.2e-38
WP_043852938.1|1191517_1191811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153739186.1|1191826_1192012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057089049.1|1192102_1192312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153739187.1|1192359_1193115_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A2H4J7L8	uncultured_Caudovirales_phage	82.1	2.6e-120
WP_035762714.1|1193224_1193500_+	hypothetical protein	NA	A0A2H4J1Q4	uncultured_Caudovirales_phage	48.3	1.2e-17
WP_057089047.1|1193516_1193807_+	hypothetical protein	NA	A0A0A8WF70	Clostridium_phage	45.2	3.1e-13
WP_153739188.1|1193855_1195493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153739189.1|1195986_1198167_+	PspC family transcriptional regulator	NA	NA	NA	NA	NA
WP_153739190.1|1198802_1199759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002580933.1|1199846_1200644_+	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_002580932.1|1200912_1202007_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_002580931.1|1202022_1202883_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002580930.1|1203122_1204271_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	28.1	6.6e-30
WP_002580929.1|1204270_1205428_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_002580928.1|1205462_1206101_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_003407320.1|1206452_1207586_+	ATP phosphoribosyltransferase regulatory subunit	NA	A0A1V0SLE3	Klosneuvirus	25.8	1.1e-16
WP_002580926.1|1207630_1208260_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003425009.1|1208440_1209739_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_002580924.1|1209725_1210763_+	histidinol-phosphate aminotransferase family protein	NA	A0A142C026	Faustovirus	24.1	9.8e-17
WP_002580923.1|1210785_1211373_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_002580922.1|1211400_1212021_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_002580921.1|1212017_1212734_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_002580920.1|1212783_1213545_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_002580919.1|1213573_1213903_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_003414845.1|1213936_1214263_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_153739191.1|1214460_1215636_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0F7LAY0	uncultured_marine_virus	25.2	1.0e-25
WP_002580916.1|1216042_1216237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002580915.1|1216332_1217148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002580914.1|1217234_1218518_+	trigger factor	NA	NA	NA	NA	NA
WP_002580913.1|1218678_1219284_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.7	2.2e-53
WP_003415254.1|1219326_1220616_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.4	3.4e-144
WP_035761361.1|1220803_1222477_+|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	23.8	3.0e-07
>prophage 4
NZ_CP033247	Clostridium butyricum strain CFSA3987 chromosome, complete genome	3864433	1611815	1660247	3864433	coat,transposase,integrase	uncultured_Caudovirales_phage(20.0%)	49	1618239:1618254	1638065:1638080
WP_153739248.1|1611815_1612829_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153739249.1|1613784_1613982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153739250.1|1614026_1614560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003426296.1|1614802_1615072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003426299.1|1615159_1615303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003426302.1|1615365_1615635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003426306.1|1615951_1618576_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
1618239:1618254	attL	TTGATGATGTTGAAAT	NA	NA	NA	NA
WP_003426309.1|1619590_1619827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003426312.1|1620714_1621401_+	recombinase family protein	NA	NA	NA	NA	NA
WP_003426316.1|1621780_1623472_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_153739251.1|1624501_1625383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153739252.1|1625450_1627223_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.9	6.0e-06
WP_024041083.1|1628448_1629171_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_070779669.1|1629510_1630689_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003426331.1|1630779_1631664_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_153739253.1|1631674_1632721_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002580535.1|1632723_1633491_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.8	7.5e-14
WP_002580534.1|1633492_1634197_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_153739254.1|1634223_1634850_+	cytidylate kinase-like family protein	NA	NA	NA	NA	NA
WP_003415137.1|1635098_1635731_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_002580531.1|1635822_1636701_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	19.2	7.1e-08
WP_002580530.1|1636896_1637097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002580529.1|1637099_1637759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057087455.1|1637923_1638979_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.4	4.2e-07
1638065:1638080	attR	ATTTCAACATCATCAA	NA	NA	NA	NA
WP_043853075.1|1639250_1640057_+	hypothetical protein	NA	A0A2K9VH60	Faecalibacterium_phage	35.2	1.3e-24
WP_043853074.1|1640124_1641639_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_002580525.1|1641881_1642415_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058142093.1|1642436_1643066_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_002580523.1|1643164_1644049_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003415617.1|1644254_1644665_+	flavodoxin	NA	NA	NA	NA	NA
WP_153739255.1|1644689_1645325_+	DUF3793 family protein	NA	NA	NA	NA	NA
WP_003409120.1|1645749_1646274_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_153739256.1|1646504_1647743_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	5.6e-51
WP_002580519.1|1648027_1648273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153739257.1|1648283_1649885_-	recombinase family protein	NA	A0A1L2BY67	Clostridium_phage	41.7	6.0e-106
WP_035763765.1|1650101_1650287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153739258.1|1650406_1651846_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_153739259.1|1651859_1652597_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.0	1.1e-30
WP_043853070.1|1652921_1653782_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003426353.1|1653910_1654225_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	49.0	4.9e-20
WP_153739260.1|1654292_1655669_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	44.4	9.1e-103
WP_002580513.1|1655685_1656183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002580512.1|1656212_1656551_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002580511.1|1656646_1657879_+	redoxin family protein	NA	NA	NA	NA	NA
WP_035763777.1|1657920_1658691_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_035763780.1|1658843_1659302_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_113886331.1|1659432_1659831_-|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
WP_024039853.1|1659834_1660095_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_003406267.1|1660109_1660247_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
>prophage 5
NZ_CP033247	Clostridium butyricum strain CFSA3987 chromosome, complete genome	3864433	2689146	2699174	3864433		Prochlorococcus_phage(42.86%)	7	NA	NA
WP_002579505.1|2689146_2690655_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	46.0	1.8e-35
WP_003409633.1|2690835_2691444_-	phosphoribosylglycinamide formyltransferase	NA	R9S626	Prochlorococcus_phage	38.0	2.9e-24
WP_002579503.1|2691431_2692436_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.1	7.7e-67
WP_002579502.1|2692527_2693940_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.8	1.1e-55
WP_002579501.1|2694047_2694755_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	44.8	2.1e-47
WP_002579500.1|2694754_2695234_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.7	1.3e-27
WP_002579499.1|2695427_2699174_-	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.5	1.2e-32
>prophage 6
NZ_CP033247	Clostridium butyricum strain CFSA3987 chromosome, complete genome	3864433	2832416	2854545	3864433	head,capsid,protease,integrase,tail,terminase,transposase,portal	Clostridium_phage(36.36%)	28	2830903:2830961	2854684:2854742
2830903:2830961	attL	TTGGTGCAGATGACGGGACTTGAACCCGTACGCCTCGAAAGCACAGGCTCCTTAAACCT	NA	NA	NA	NA
WP_035761508.1|2832416_2833184_-	DUF4428 domain-containing protein	NA	X5JB37	Clostridium_phage	37.2	5.4e-36
WP_046057384.1|2833307_2834177_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A142F1B8	Bacillus_phage	33.3	8.3e-09
WP_046057385.1|2834243_2834531_-	hypothetical protein	NA	A0A0A8WF70	Clostridium_phage	40.7	1.7e-11
WP_002581906.1|2834545_2834779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153739433.1|2834959_2835634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153739434.1|2835913_2836042_-	XkdX family protein	NA	A0A0A7S0E7	Clostridium_phage	54.8	5.2e-05
WP_153739435.1|2836034_2836370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153741808.1|2836384_2837893_-	viral A-type inclusion protein	NA	A0A1L2BYA7	Clostridium_phage	74.1	3.6e-52
WP_153739437.1|2837908_2839597_-	hypothetical protein	NA	A0A1L2BYA1	Clostridium_phage	55.7	7.1e-158
WP_153739438.1|2839596_2840301_-|tail	phage tail protein	tail	A0A1L2BYA2	Clostridium_phage	50.6	4.3e-64
WP_153739439.1|2840300_2843363_-|tail	phage tail tape measure protein	tail	A0A1L2BYA6	Clostridium_phage	43.5	1.2e-70
WP_153741809.1|2843382_2843556_-	hypothetical protein	NA	Q0H231	Geobacillus_phage	54.0	2.6e-07
WP_153739441.1|2843578_2843926_-	hypothetical protein	NA	A0A290GJX3	Caldibacillus_phage	63.4	1.2e-35
WP_046057389.1|2843937_2844507_-|tail	phage tail protein	tail	A0A0U4JWV5	Exiguobacterium_phage	62.4	3.9e-60
WP_046057390.1|2844508_2844838_-	hypothetical protein	NA	A6XMK2	Bacillus_virus	59.6	6.7e-28
WP_046057391.1|2844834_2845191_-	hypothetical protein	NA	A0A290FZT5	Caldibacillus_phage	50.0	3.8e-21
WP_046057392.1|2845183_2845504_-|head	phage head closure protein	head	A6XMK0	Bacillus_virus	45.3	1.2e-18
WP_046057393.1|2845500_2845788_-	hypothetical protein	NA	A6XMJ8	Bacillus_virus	70.0	2.1e-33
WP_052707829.1|2845799_2846084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153739442.1|2846097_2847507_-|capsid	phage major capsid protein	capsid	A6XMJ6	Bacillus_virus	64.2	1.4e-122
WP_046057395.1|2847496_2848087_-|head,protease	HK97 family phage prohead protease	head,protease	Q0H262	Geobacillus_phage	72.5	4.7e-72
WP_153739443.1|2848070_2849309_-|portal	phage portal protein	portal	A6XMJ5	Bacillus_virus	65.1	3.1e-150
WP_153739444.1|2849415_2849664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153739445.1|2849675_2851355_-|terminase	terminase large subunit	terminase	Q0H264	Geobacillus_phage	64.7	8.9e-201
WP_085951511.1|2851317_2852650_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.9	3.2e-28
WP_080646768.1|2852804_2853164_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035761600.1|2853314_2853605_+	helix-turn-helix transcriptional regulator	NA	A0A0A7S0F1	Clostridium_phage	48.9	1.6e-20
WP_035761603.1|2853642_2854545_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	27.6	5.5e-32
2854684:2854742	attR	TTGGTGCAGATGACGGGACTTGAACCCGTACGCCTCGAAAGCACAGGCTCCTTAAACCT	NA	NA	NA	NA
>prophage 1
NZ_CP033246	Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence	882416	216521	256832	882416	protease,holin,portal,head,tail,terminase,capsid	Erysipelothrix_phage(25.81%)	45	NA	NA
WP_153738813.1|216521_216944_-	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	35.6	2.9e-07
WP_153738814.1|217088_217289_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153738815.1|217368_217581_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153738816.1|217599_217944_+	hypothetical protein	NA	S5M5X1	Brevibacillus_phage	37.1	3.6e-08
WP_153738817.1|217943_219110_+	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	62.4	1.6e-132
WP_124229618.1|219131_219686_+	DUF2815 family protein	NA	S5MC21	Brevibacillus_phage	76.4	5.5e-75
WP_153738818.1|219691_221644_+	hypothetical protein	NA	S5M5X4	Brevibacillus_phage	65.7	2.3e-245
WP_153738819.1|221821_222616_+	BRO family protein	NA	A0A1Q1PVZ8	Staphylococcus_phage	51.7	2.2e-69
WP_153739007.1|222684_225099_+	hypothetical protein	NA	A0A0A7RTG3	Clostridium_phage	59.7	5.6e-289
WP_153738820.1|225444_225723_+	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	61.1	3.2e-23
WP_153738821.1|225719_227087_+	ATP-dependent helicase	NA	S5MA26	Brevibacillus_phage	63.1	2.8e-168
WP_153738822.1|227129_227609_+	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_153738823.1|227718_228510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153738824.1|228528_228837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153739008.1|229231_229624_+	HNH endonuclease	NA	M1PLL8	Streptococcus_phage	48.8	4.0e-27
WP_153738825.1|229868_231113_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	60.0	9.3e-147
WP_153738826.1|231180_231492_+	hypothetical protein	NA	A0A2K5B282	Erysipelothrix_phage	65.7	3.6e-31
WP_153738827.1|231644_231899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153738828.1|231971_232688_+	virulence-related protein	NA	A0A2K5B280	Erysipelothrix_phage	31.7	1.1e-14
WP_153738829.1|232773_233673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153738830.1|233726_234197_+|terminase	phage terminase small subunit P27 family	terminase	Q6DMU4	Streptococcus_phage	73.4	4.7e-59
WP_153738831.1|234201_235746_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	73.9	4.4e-231
WP_153738832.1|235818_236652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153738833.1|236715_238005_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	57.9	1.5e-128
WP_153738834.1|237937_238579_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JP53	Morganella_phage	46.3	7.4e-31
WP_153738835.1|238592_239870_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_153738836.1|239886_240306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153738837.1|240323_240599_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_153738838.1|240573_240930_+|head	phage head closure protein	head	A0A0A7RUH8	Clostridium_phage	48.6	2.7e-22
WP_153738839.1|240922_241315_+	hypothetical protein	NA	W8CZ44	Bacillus_phage	32.3	3.6e-12
WP_153738840.1|241311_241641_+	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	44.9	2.2e-15
WP_153738841.1|241643_242210_+|tail	phage tail protein	tail	A0A1L2BYA0	Clostridium_phage	57.1	2.5e-51
WP_153738842.1|242334_243138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153738843.1|243318_243678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153738844.1|243825_244149_+	hypothetical protein	NA	A0A1L2BYA4	Clostridium_phage	33.6	1.7e-07
WP_153738845.1|244196_244343_+	hypothetical protein	NA	A0A1L2BYA3	Clostridium_phage	52.4	2.7e-05
WP_153738846.1|244370_246653_+|tail	phage tail tape measure protein	tail	M4QNS0	Tetraselmis_viridis_virus	33.7	2.5e-28
WP_153738847.1|246652_247357_+|tail	phage tail protein	tail	A0A2H4J851	uncultured_Caudovirales_phage	29.5	9.9e-21
WP_153738848.1|247356_249261_+	hypothetical protein	NA	A0A0A7RUI9	Clostridium_phage	39.9	1.7e-46
WP_153738849.1|249273_250443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153738850.1|250453_252142_+	hypothetical protein	NA	Q0H227	Geobacillus_phage	34.7	1.7e-13
WP_153738851.1|252181_252592_+|holin	holin	holin	A0A2K5B2A2	Erysipelothrix_phage	61.8	2.0e-42
WP_153738852.1|252584_253268_+	N-acetylmuramoyl-L-alanine amidase	NA	D6QWM8	uncultured_phage	34.5	1.4e-16
WP_153738853.1|253588_255217_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	46.7	7.2e-107
WP_153738854.1|255230_256832_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	53.0	7.1e-123
>prophage 2
NZ_CP033246	Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence	882416	612425	621510	882416		Bacillus_phage(50.0%)	7	NA	NA
WP_153738919.1|612425_613271_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	7.8e-12
WP_153738920.1|613319_614114_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_113886508.1|614531_615263_-	response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	30.0	2.9e-15
WP_113886509.1|615324_617169_-	ATP-binding protein	NA	X5JAC0	Clostridium_phage	28.3	1.3e-27
WP_153738921.1|617659_619261_-	hypothetical protein	NA	W8CYF6	Bacillus_phage	24.1	2.8e-18
WP_113886511.1|619244_619949_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.6	1.9e-35
WP_113886512.1|619953_621510_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.8	1.0e-17
>prophage 3
NZ_CP033246	Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence	882416	714250	766291	882416	portal,tail,terminase,coat,transposase	uncultured_Caudovirales_phage(43.33%)	53	NA	NA
WP_002581275.1|714250_715582_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	31.2	2.8e-24
WP_153738952.1|716098_719734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153738953.1|720395_721079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153738954.1|721108_722146_-	5-methylcytosine-specific restriction endonuclease system specificity protein McrC	NA	NA	NA	NA	NA
WP_153739011.1|722142_724623_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	29.1	6.8e-24
WP_033127187.1|725319_726075_-	DNA adenine methylase	NA	A0A2H4J7L8	uncultured_Caudovirales_phage	74.9	2.0e-112
WP_153738955.1|726483_727008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003432416.1|727403_727604_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	42.2	2.8e-05
WP_153739012.1|727833_728706_-	DNA adenine methylase	NA	A0A2K9R7J9	Dishui_lake_phycodnavirus	28.3	8.0e-20
WP_153738956.1|728778_730356_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_033127184.1|730595_730775_-	hypothetical protein	NA	A0A2H4J069	uncultured_Caudovirales_phage	75.0	4.7e-12
WP_153738957.1|731234_732878_-	hypothetical protein	NA	I3VYU6	Thermoanaerobacterium_phage	33.1	1.2e-19
WP_153738958.1|732928_733252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580765.1|733267_733492_-	hypothetical protein	NA	A0A249XXC7	Clostridium_phage	50.0	6.2e-09
WP_153738959.1|733558_733696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153738960.1|733795_734005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153738961.1|734249_734501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153738962.1|735669_736287_-	DUF2313 domain-containing protein	NA	A0A0A7RTU9	Clostridium_phage	41.2	6.2e-43
WP_153738963.1|736287_738405_-	hypothetical protein	NA	A0A0A7S1G0	Clostridium_phage	56.8	1.8e-25
WP_153738964.1|738405_739533_-	hypothetical protein	NA	A0A2H4J7K8	uncultured_Caudovirales_phage	35.4	3.0e-51
WP_045144373.1|739539_739977_-	DUF2634 domain-containing protein	NA	A0A2H4J4Q8	uncultured_Caudovirales_phage	43.4	2.3e-23
WP_153738965.1|739969_740314_-	hypothetical protein	NA	A0A0A8WFG6	Clostridium_phage	42.7	2.6e-14
WP_153738966.1|740303_741281_-	XkdQ	NA	A0A2H4J063	uncultured_Caudovirales_phage	47.4	6.3e-74
WP_153738967.1|741294_741777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153738968.1|742148_742988_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_153738969.1|743025_746799_-|tail	phage tail tape measure protein	tail	A0A2H4J055	uncultured_Caudovirales_phage	34.1	3.3e-86
WP_002581894.1|747002_747497_-	hypothetical protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	39.1	3.8e-19
WP_002581893.1|747529_747949_-|tail	phage tail tube protein	tail	A0A2H4J032	uncultured_Caudovirales_phage	60.3	7.9e-42
WP_002581892.1|747966_749406_-	hypothetical protein	NA	A0A0A8WI77	Clostridium_phage	46.0	1.5e-111
WP_027635367.1|749405_749639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153738970.1|749654_750476_-	hypothetical protein	NA	A0A2H4J4Q0	uncultured_Caudovirales_phage	53.8	2.5e-84
WP_153738971.1|750479_750905_-	hypothetical protein	NA	A0A2H4J736	uncultured_Caudovirales_phage	42.6	1.6e-21
WP_153738972.1|750909_751293_-	hypothetical protein	NA	A0A2H4J057	uncultured_Caudovirales_phage	52.4	1.6e-33
WP_002581887.1|751292_751613_-	hypothetical protein	NA	A0A2H4J040	uncultured_Caudovirales_phage	59.4	2.1e-26
WP_002581886.1|751615_751867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002581885.1|751923_752979_-	hypothetical protein	NA	D9ZND6	Clostridium_phage	50.0	1.3e-85
WP_002581884.1|752995_753400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002581883.1|753428_754055_-	hypothetical protein	NA	A0A0K2CP96	Brevibacillus_phage	35.8	8.9e-13
WP_046057716.1|754368_754683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002581881.1|754713_755343_-	hypothetical protein	NA	A0A0A7RUT3	Clostridium_phage	64.1	4.1e-42
WP_002581879.1|755828_757595_-	hypothetical protein	NA	A0A2H4J048	uncultured_Caudovirales_phage	45.9	4.3e-145
WP_153738973.1|757607_759158_-|portal	phage portal protein	portal	D9ZNC8	Clostridium_phage	52.1	1.5e-138
WP_002581877.1|759379_760738_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0A7S0Q5	Clostridium_phage	75.3	2.2e-202
WP_002581876.1|760730_761681_-	hypothetical protein	NA	A0A0A7RTY1	Clostridium_phage	40.5	2.3e-44
WP_002581874.1|761881_762073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002581872.1|762536_762713_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002581871.1|763326_764013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002581870.1|764221_764758_-	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	38.9	1.9e-19
WP_002581869.1|764879_765110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002581868.1|765153_765360_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002581867.1|765453_765591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002581866.1|765571_765898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002581865.1|766042_766291_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 4
NZ_CP033246	Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence	882416	772142	782352	882416		Clostridium_phage(30.0%)	16	NA	NA
WP_153738975.1|772142_772853_-	hypothetical protein	NA	A0A1Q1PVU4	Staphylococcus_phage	57.1	7.9e-34
WP_002581852.1|772863_773469_-	hypothetical protein	NA	J9QD21	Clostridium_phage	28.9	4.1e-07
WP_002581849.1|773893_774064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002581846.1|774522_774765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002581845.1|774777_775104_-	hypothetical protein	NA	A0A1Q1PVT2	Staphylococcus_phage	40.3	4.5e-08
WP_002581844.1|775195_775570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002581843.1|775668_775887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002581842.1|775883_776075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002581840.1|776269_777088_-	hypothetical protein	NA	A0A0A8WJ22	Clostridium_phage	52.2	3.4e-65
WP_153738976.1|777087_777297_-	helix-turn-helix domain-containing protein	NA	I3VYZ0	Thermoanaerobacterium_phage	54.1	1.4e-10
WP_002581838.1|777512_777917_+	helix-turn-helix transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	36.4	3.6e-07
WP_002581837.1|777930_778377_+	ImmA/IrrE family metallo-endopeptidase	NA	I3VYZ2	Thermoanaerobacterium_phage	38.5	5.9e-11
WP_002581836.1|778419_779811_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	51.2	1.4e-71
WP_002581835.1|779888_780086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153738977.1|780146_781679_+	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	39.8	1.2e-90
WP_153738978.1|781731_782352_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	40.4	6.7e-37
