The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045845	Kluyvera intermedia strain N2-1 chromosome, complete genome	4692744	1103958	1114921	4692744	integrase,capsid	Enterobacteria_phage(75.0%)	11	1104540:1104562	1114933:1114955
WP_153742334.1|1103958_1104201_-	DinI-like family protein	NA	Q6UAW0	Klebsiella_phage	84.8	1.1e-32
1104540:1104562	attL	TTAAACGTGTACCAATTATGGAA	NA	NA	NA	NA
WP_126440632.1|1104971_1107305_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.4	0.0e+00
WP_062779907.1|1107319_1107640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062779906.1|1107636_1107864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073971259.1|1107860_1108412_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	73.1	2.9e-36
WP_062779902.1|1108408_1108675_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	69.3	5.4e-28
WP_126440638.1|1109225_1110029_+|capsid	capsid protein	capsid	Q7M2A2	Enterobacteria_phage	25.6	1.4e-10
WP_062779951.1|1110025_1110268_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	8.4e-20
WP_126440640.1|1110283_1110859_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	50.8	7.3e-38
WP_153742335.1|1111351_1113694_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_062779211.1|1113727_1114921_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.5	8.5e-105
1114933:1114955	attR	TTCCATAATTGGTACACGTTTAA	NA	NA	NA	NA
>prophage 2
NZ_CP045845	Kluyvera intermedia strain N2-1 chromosome, complete genome	4692744	1445552	1453918	4692744		Morganella_phage(33.33%)	8	NA	NA
WP_153742462.1|1445552_1447826_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.9	6.5e-146
WP_153742463.1|1447889_1448744_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.3	4.0e-56
WP_062772542.1|1449964_1450177_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.6	4.9e-24
WP_073971077.1|1450385_1450565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062772539.1|1451065_1451284_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	63.2	4.6e-17
WP_073971075.1|1451566_1451779_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_153742464.1|1451937_1452933_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	27.3	1.5e-30
WP_062772536.1|1452997_1453918_-	ribonuclease BN	NA	S4VYV9	Pandoravirus	24.7	1.6e-07
>prophage 3
NZ_CP045845	Kluyvera intermedia strain N2-1 chromosome, complete genome	4692744	1576481	1585042	4692744	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_153742521.1|1576481_1577429_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.8	7.1e-22
WP_153742522.1|1577412_1578150_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_073971239.1|1578124_1578238_-	protein YohO	NA	NA	NA	NA	NA
WP_153742523.1|1578297_1579017_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	69.8	4.3e-72
WP_153742524.1|1579215_1580901_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	87.2	4.6e-266
WP_062779483.1|1580897_1581617_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_062779497.1|1581726_1582200_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	84.0	1.0e-69
WP_153742525.1|1582266_1582788_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	26.6	1.9e-08
WP_153742526.1|1583008_1585042_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	28.3	1.4e-54
>prophage 4
NZ_CP045845	Kluyvera intermedia strain N2-1 chromosome, complete genome	4692744	1608188	1616245	4692744	tRNA	Planktothrix_phage(33.33%)	7	NA	NA
WP_153742537.1|1608188_1609055_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.0	2.5e-13
WP_062778698.1|1609210_1609984_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	4.6e-27
WP_153744023.1|1610223_1611423_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_062778694.1|1611419_1612319_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.0	3.4e-13
WP_153742538.1|1612561_1613923_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.9	3.4e-203
WP_062778688.1|1614086_1614809_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.6	1.6e-29
WP_153742539.1|1614805_1616245_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	2.7e-28
>prophage 5
NZ_CP045845	Kluyvera intermedia strain N2-1 chromosome, complete genome	4692744	1783766	1794606	4692744	integrase,tail	Enterobacteria_phage(40.0%)	12	1781982:1781996	1791027:1791041
1781982:1781996	attL	GAGCAGACCGTCGCA	NA	NA	NA	NA
WP_153742630.1|1783766_1784777_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	81.0	3.5e-160
WP_153742631.1|1784776_1785004_-	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	89.3	2.7e-36
WP_153742632.1|1785395_1785734_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	73.2	3.3e-46
WP_153742633.1|1785730_1786486_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	84.9	5.9e-128
WP_153742634.1|1786487_1787198_+	peptidase P60	NA	K7PGR2	Enterobacteria_phage	94.9	1.8e-142
WP_153742635.1|1787229_1787625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153742636.1|1787668_1788274_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	75.1	7.9e-75
WP_153742637.1|1788326_1791863_+	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	93.5	0.0e+00
1791027:1791041	attR	GAGCAGACCGTCGCA	NA	NA	NA	NA
WP_153742638.1|1791856_1792159_+	hypothetical protein	NA	G8C7R5	Escherichia_phage	98.0	3.3e-50
WP_153742639.1|1792155_1792797_+	hypothetical protein	NA	G8C7R6	Escherichia_phage	93.9	9.7e-116
WP_153742640.1|1792761_1793124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153742641.1|1793250_1794606_+|tail	phage tail protein	tail	K7PHF0	Enterobacteria_phage	54.1	8.7e-114
>prophage 6
NZ_CP045845	Kluyvera intermedia strain N2-1 chromosome, complete genome	4692744	2360460	2368454	4692744		Escherichia_phage(66.67%)	9	NA	NA
WP_153742938.1|2360460_2361480_-	Zn-dependent oxidoreductase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	41.3	7.4e-09
WP_062773390.1|2361740_2362067_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	51.0	5.1e-20
WP_062773387.1|2362218_2362560_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_153742939.1|2362593_2363304_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_062773382.1|2363407_2363662_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_153742940.1|2363869_2366305_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.1	1.3e-216
WP_153742941.1|2366315_2366933_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.6	4.4e-73
WP_062776930.1|2366934_2367792_+	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	31.5	1.2e-20
WP_062776928.1|2367839_2368454_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	34.7	2.4e-26
>prophage 7
NZ_CP045845	Kluyvera intermedia strain N2-1 chromosome, complete genome	4692744	2643426	2704530	4692744	tRNA,terminase,portal,holin,integrase,tail,protease	Enterobacteria_phage(35.14%)	73	2667000:2667014	2711195:2711209
WP_153743071.1|2643426_2643927_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_153743072.1|2644139_2645483_+	MFS transporter	NA	NA	NA	NA	NA
WP_062774762.1|2645490_2647527_+	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_062774763.1|2647709_2648156_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_062774765.1|2648139_2648931_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_153743073.1|2649030_2650212_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_126441006.1|2650284_2650977_-	CTP synthase	NA	NA	NA	NA	NA
WP_062774771.1|2651131_2651476_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_062774772.1|2651508_2651814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153743074.1|2651874_2652123_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_153743075.1|2652445_2653465_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_126440770.1|2653512_2653617_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_062774777.1|2653716_2655192_-	GGDEF domain-containing protein	NA	A0A2K8I9Y5	Pseudomonas_phage	43.9	1.3e-09
WP_062774779.1|2655387_2655648_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_153743076.1|2655861_2656188_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_062774783.1|2656219_2656576_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_062774785.1|2656577_2656760_+	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_062774787.1|2657011_2657647_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_062774789.1|2657844_2658255_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_062774790.1|2658612_2659215_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153743077.1|2659294_2660449_+	MFS transporter	NA	NA	NA	NA	NA
WP_062774794.1|2660750_2660975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153743078.1|2661233_2662220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153743079.1|2662261_2662816_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153743080.1|2663017_2663437_+	VOC family protein	NA	NA	NA	NA	NA
WP_153743081.1|2663850_2664903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153743082.1|2665115_2666390_-|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	48.2	6.3e-98
WP_153743083.1|2666461_2667100_-	hypothetical protein	NA	A0A1X7QGJ8	Escherichia_phage	32.3	5.3e-13
2667000:2667014	attL	TTTCCAGTGAAGCGA	NA	NA	NA	NA
WP_153743084.1|2667096_2667369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153743085.1|2667614_2670788_-	DUF1983 domain-containing protein	NA	O64335	Escherichia_phage	85.1	0.0e+00
WP_153743086.1|2670840_2671419_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	74.0	1.4e-73
WP_153743087.1|2671464_2671791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153743088.1|2671863_2672601_-	peptidase P60	NA	K7P7M8	Enterobacteria_phage	90.8	4.0e-137
WP_153743089.1|2672602_2673361_-|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	95.6	9.4e-142
WP_153743090.1|2673357_2673705_-|tail	phage tail protein	tail	K7P7G7	Enterobacteria_phage	50.4	4.7e-24
WP_153743091.1|2673725_2676800_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	45.4	9.2e-220
WP_153743092.1|2676783_2677116_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	60.4	8.2e-26
WP_153743093.1|2677112_2677523_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	41.8	2.0e-13
WP_153743094.1|2677577_2678321_-|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	67.8	2.1e-90
WP_153743095.1|2678331_2678733_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	80.5	2.3e-59
WP_153743096.1|2678729_2679308_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	87.5	9.5e-86
WP_153743097.1|2679316_2679592_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	59.3	4.0e-26
WP_153743098.1|2679584_2679911_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	62.0	2.9e-31
WP_153743099.1|2680003_2682004_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	85.2	0.0e+00
WP_153743100.1|2681948_2683454_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	88.0	4.9e-259
WP_062779664.1|2683450_2683666_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	80.0	3.8e-24
WP_153743101.1|2683662_2685768_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	85.3	0.0e+00
WP_153743102.1|2685767_2686256_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	90.1	7.8e-73
WP_153743103.1|2687042_2687579_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_153743104.1|2687557_2688094_-	glycoside hydrolase family protein	NA	K7PM52	Enterobacteria_phage	76.0	3.3e-77
WP_153743105.1|2688093_2688309_-|holin	holin	holin	A5LH82	Enterobacteria_phage	82.6	4.8e-27
WP_153743106.1|2688419_2688704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153743107.1|2689479_2689986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153743108.1|2689982_2691287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153743109.1|2691320_2691677_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	1.9e-52
WP_153743110.1|2691688_2692738_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	46.7	4.7e-91
WP_153743111.1|2692722_2693100_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	68.4	4.9e-43
WP_153743112.1|2693096_2693297_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	46.2	2.7e-08
WP_153743113.1|2693719_2693953_-	DinI-like family protein	NA	H6WRY5	Salmonella_phage	59.7	2.8e-20
WP_153743114.1|2694371_2695130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153743115.1|2695478_2695916_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_153743116.1|2695934_2696675_-	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	68.7	1.9e-94
WP_153743117.1|2696677_2697511_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	52.1	1.1e-61
WP_153743118.1|2697565_2698120_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	31.7	3.0e-12
WP_153743119.1|2698122_2698338_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	56.2	7.7e-17
WP_153743120.1|2698439_2698829_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	61.7	3.5e-36
WP_153743121.1|2699305_2699650_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_153743122.1|2699791_2701957_+	exonuclease	NA	H6WRX1	Salmonella_phage	44.2	2.0e-104
WP_153743123.1|2702008_2702257_+	excisionase	NA	NA	NA	NA	NA
WP_153743124.1|2702234_2703365_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	49.3	4.5e-100
WP_062774794.1|2703445_2703670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153743125.1|2703908_2704307_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	36.1	1.3e-14
WP_153743126.1|2704365_2704530_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	8.7e-21
2711195:2711209	attR	TTTCCAGTGAAGCGA	NA	NA	NA	NA
>prophage 8
NZ_CP045845	Kluyvera intermedia strain N2-1 chromosome, complete genome	4692744	3007677	3105105	4692744	tRNA,portal,integrase,lysis,capsid,head,tail,protease,plate	Salmonella_phage(58.49%)	97	3071440:3071464	3105555:3105579
WP_062778869.1|3007677_3008970_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	42.8	4.7e-93
WP_062778871.1|3009062_3010406_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.3	1.3e-80
WP_062778873.1|3010415_3011027_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_153743269.1|3011149_3015313_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.0	7.8e-89
WP_000228473.1|3015433_3015928_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_153743270.1|3016444_3017437_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.5	4.8e-61
WP_153743271.1|3017553_3019320_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	21.8	3.5e-22
WP_153743272.1|3019320_3021042_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A1V0SJ29	Klosneuvirus	29.7	2.6e-14
WP_153743273.1|3021082_3021787_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|3022071_3022290_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_153743274.1|3022435_3023839_-	DUF1996 domain-containing protein	NA	NA	NA	NA	NA
WP_153743275.1|3023996_3026273_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	1.4e-164
WP_062778891.1|3026302_3026623_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	48.1	3.1e-14
WP_153743276.1|3027013_3027241_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	6.9e-16
WP_062778897.1|3027322_3029263_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.6	4.2e-37
WP_062778900.1|3029259_3030375_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_062778903.1|3030537_3031488_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_153743277.1|3031660_3032617_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_153743278.1|3032613_3034272_-	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
WP_062778911.1|3034638_3035331_+	aquaporin Z	NA	NA	NA	NA	NA
WP_153743279.1|3035558_3036458_+	DUF340 domain-containing protein	NA	NA	NA	NA	NA
WP_062778917.1|3036606_3038259_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_153743280.1|3038269_3039238_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_153743281.1|3039680_3042404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153743282.1|3042862_3043141_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_153743283.1|3043439_3045068_+	FAD-NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_153743284.1|3045185_3045620_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_062775063.1|3045771_3047490_+	ubiquinone-dependent pyruvate dehydrogenase	NA	E5EQ70	Micromonas_sp._RCC1109_virus	22.8	8.3e-29
WP_153743285.1|3047527_3048529_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_153743286.1|3048539_3049985_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_062775058.1|3050072_3051086_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_062775057.1|3051088_3051925_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_062775055.1|3051921_3052245_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_062775053.1|3052408_3052924_+	lipoprotein	NA	NA	NA	NA	NA
WP_153743287.1|3053233_3053962_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.2	1.3e-28
WP_062775049.1|3053979_3054711_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062775047.1|3054717_3055434_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_062775045.1|3055433_3056102_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_153743288.1|3056278_3057010_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_153743289.1|3057053_3058526_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	4.3e-26
WP_153743290.1|3058522_3059245_-	response regulator	NA	W8CYM9	Bacillus_phage	37.3	1.1e-35
WP_153743291.1|3059440_3060568_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.4	1.3e-27
WP_062775080.1|3060610_3061099_-	YbjO family protein	NA	NA	NA	NA	NA
WP_062775037.1|3061157_3062003_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_153743292.1|3061999_3062953_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_062775033.1|3062962_3064096_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	35.4	5.9e-31
WP_062775032.1|3064333_3065446_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_153743293.1|3065851_3066331_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_062775028.1|3066458_3067361_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.9	7.4e-37
WP_062775027.1|3067458_3068181_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_153743294.1|3068164_3068443_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_062775024.1|3068651_3068915_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	3.5e-27
WP_062775022.1|3068936_3069323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062775020.1|3069598_3071287_+	transporter	NA	NA	NA	NA	NA
3071440:3071464	attL	ATGGGTTTTTTGTTGCCTGAAATTC	NA	NA	NA	NA
WP_058842448.1|3071583_3071799_-	late control protein B	NA	Q53ZE7	Salmonella_virus	70.8	3.6e-22
WP_153743295.1|3071866_3072964_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.1	1.7e-176
WP_115614539.1|3072960_3073446_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	90.9	3.6e-62
WP_153743296.1|3073442_3076244_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	56.4	5.7e-253
WP_032680256.1|3076236_3076356_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	89.7	1.7e-13
WP_153743297.1|3076370_3076673_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	87.0	3.5e-39
WP_153743298.1|3076727_3077243_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	88.9	2.5e-82
WP_153743299.1|3077252_3078425_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	1.3e-203
WP_153743300.1|3078630_3079653_+	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.0	1.1e-07
WP_153743301.1|3079693_3079915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153743302.1|3079911_3081213_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	90.0	1.6e-85
WP_153743303.1|3081209_3081815_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	87.6	1.1e-105
WP_153743304.1|3081807_3082716_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	86.8	3.4e-138
WP_153743305.1|3082702_3083062_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	78.2	3.5e-46
WP_153743306.1|3083058_3083637_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	84.9	1.5e-91
WP_153743307.1|3083844_3084831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153743308.1|3084817_3085270_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	78.4	2.2e-58
WP_153743309.1|3085262_3085694_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.8	3.4e-64
WP_153743310.1|3085789_3086218_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	78.6	1.7e-52
WP_153743311.1|3086214_3086730_-	glycoside hydrolase family protein	NA	E5G6N1	Salmonella_phage	90.0	3.4e-87
WP_153743312.1|3086710_3086926_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	77.5	3.4e-25
WP_151418689.1|3086928_3087132_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
WP_153743313.1|3087131_3087596_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	83.8	4.0e-71
WP_153743314.1|3087690_3088341_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	78.2	4.9e-91
WP_153743315.1|3088344_3089409_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	88.7	5.1e-178
WP_153743316.1|3089425_3090250_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	79.1	5.8e-113
WP_153743317.1|3090392_3092159_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	95.1	0.0e+00
WP_153743318.1|3092158_3093193_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	91.8	8.7e-183
WP_153743319.1|3093286_3094204_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_153743320.1|3094181_3095369_-	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	36.6	4.7e-63
WP_153743321.1|3095973_3098328_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	90.9	0.0e+00
WP_153743322.1|3098324_3099155_-	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	76.6	6.7e-125
WP_153743323.1|3099207_3099432_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	81.3	3.5e-28
WP_153743324.1|3099431_3099668_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	60.8	8.5e-17
WP_153743325.1|3099734_3100076_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	82.3	3.3e-46
WP_153743326.1|3100156_3100405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153743327.1|3100395_3100620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153743328.1|3100794_3101304_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	81.5	1.5e-71
WP_045355697.1|3101369_3101573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153743329.1|3101719_3102283_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	40.0	7.4e-35
WP_153743330.1|3102285_3103353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153743331.1|3103354_3103960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153743332.1|3104058_3105105_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	54.9	6.9e-103
3105555:3105579	attR	ATGGGTTTTTTGTTGCCTGAAATTC	NA	NA	NA	NA
>prophage 9
NZ_CP045845	Kluyvera intermedia strain N2-1 chromosome, complete genome	4692744	3381175	3395641	4692744	integrase	Salmonella_phage(35.71%)	17	3380818:3380865	3394449:3394496
3380818:3380865	attL	AAATGGTGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_153743455.1|3381175_3381538_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	89.2	1.5e-52
WP_153743456.1|3381534_3382464_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	90.8	2.8e-156
WP_153743457.1|3382450_3383929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153743458.1|3383987_3385466_+	hypothetical protein	NA	A8CG94	Salmonella_phage	27.0	5.9e-31
WP_153743459.1|3385503_3386613_-	hypothetical protein	NA	A0A2I7RFV4	Vibrio_phage	31.3	1.6e-17
WP_153743460.1|3386622_3387852_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	74.2	1.2e-50
WP_153743461.1|3388275_3388620_-	DUF551 domain-containing protein	NA	U5P092	Shigella_phage	63.6	2.0e-22
WP_153743462.1|3388616_3389045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153743463.1|3389041_3389353_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	43.3	1.4e-11
WP_153743464.1|3389342_3390716_-	AAA family ATPase	NA	E5AGF0	Erwinia_phage	63.3	1.5e-166
WP_153743465.1|3390712_3391792_-	DNA replication protein	NA	E5AGE9	Erwinia_phage	48.2	2.4e-90
WP_153743466.1|3391967_3392267_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	64.8	7.4e-26
WP_153743467.1|3392523_3392715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153743468.1|3392724_3392943_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	55.1	8.6e-16
WP_153743469.1|3393045_3393417_+	helix-turn-helix domain-containing protein	NA	B9UDM0	Salmonella_phage	78.0	1.1e-42
WP_153743470.1|3393272_3394436_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4R586	Salmonella_phage	85.5	2.7e-196
WP_062776969.1|3394774_3395641_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.2	1.1e-29
3394449:3394496	attR	AAATGGTGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 10
NZ_CP045845	Kluyvera intermedia strain N2-1 chromosome, complete genome	4692744	3495838	3500989	4692744		uncultured_Caudovirales_phage(66.67%)	8	NA	NA
WP_153743510.1|3495838_3496264_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	1.0e-49
WP_153743511.1|3496276_3497566_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	69.2	4.6e-165
WP_153743512.1|3497610_3497931_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	43.8	7.7e-21
WP_153743513.1|3498016_3498715_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.4	2.6e-90
WP_153743514.1|3498958_3499867_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.0	5.5e-72
WP_153743515.1|3500052_3500241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153743516.1|3500287_3500458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004132711.1|3500755_3500989_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	56.6	1.1e-16
>prophage 1
NZ_CP045846	Kluyvera intermedia strain N2-1 plasmid pN2-1, complete sequence	245785	71945	157689	245785	integrase,protease,transposase	Escherichia_phage(33.33%)	82	134803:134862	148112:148932
WP_042634304.1|71945_73025_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|73026_73800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|73792_74935_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|74944_76003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634303.1|76326_76908_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|76907_78065_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|78087_78543_+	Tellurite resistance protein TerB	NA	NA	NA	NA	NA
WP_000255079.1|78565_79606_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|79654_80233_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|80300_80876_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|81304_82546_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|83108_83390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|83439_83631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|83722_84094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|84436_84829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|85432_85726_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|85730_87056_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|87116_87323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|87424_87835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|87847_88663_+	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
WP_001043843.1|88916_89342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572440.1|90086_90386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123872853.1|90375_90696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072971899.1|90698_92738_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.8	1.9e-24
WP_001572342.1|92734_93721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194555.1|94751_94955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287392.1|95296_95701_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000175476.1|96198_96435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572344.1|96476_96932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|96991_97657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426317.1|97714_98095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|98737_99556_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|99552_100758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|101037_102357_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000833382.1|102607_104035_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|104249_104765_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|104767_105664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|105885_106119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|106780_107011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|107347_107809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|107838_108246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|108296_108614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|108990_109341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351729.1|111205_111598_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|111735_112620_+	EamA family transporter	NA	NA	NA	NA	NA
WP_001493765.1|112651_113851_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_021536379.1|113929_114607_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000844627.1|114638_114881_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001447541.1|122111_122996_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_058100717.1|123212_124427_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|124454_124760_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_105907042.1|125121_126066_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.7	1.7e-71
WP_001067858.1|126077_126782_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_142438022.1|126672_127266_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	96.3	1.7e-34
WP_012579081.1|129288_130212_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_013188475.1|130291_131167_-	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_000434930.1|131671_132298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153744099.1|132297_134793_-	AAA family ATPase	NA	U5J9B0	Bacillus_phage	27.3	1.9e-05
134803:134862	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067858.1|134854_135559_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000845048.1|136004_137018_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001456218.1|137184_138027_+	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000050382.1|138122_138731_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001261740.1|138788_139580_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|139841_141101_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|141193_141985_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|142154_142487_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_000034420.1|143666_144458_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|144926_145172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|145209_146073_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001067858.1|146303_147008_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000018329.1|147158_147974_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067858.1|148163_148868_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001083725.1|149272_149770_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
148112:148932	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGTTGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGTGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCG	NA	NA	NA	NA
WP_001336345.1|149881_150172_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|150818_151523_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000376616.1|151747_151951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|152078_152918_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_072644484.1|153098_153263_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|154653_155358_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_063102497.1|155551_155938_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_057109146.1|156257_156650_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001067858.1|156984_157689_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
