The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045769	Enterobacter cancerogenus strain MiY-F chromosome, complete genome	4893729	479821	489066	4893729		Enterobacteria_phage(50.0%)	9	NA	NA
WP_102890520.1|479821_480886_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	1.1e-100
WP_153688142.1|480901_481768_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	1.1e-109
WP_153688143.1|481780_482671_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	34.3	2.4e-27
WP_088208149.1|482681_483230_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.7	9.1e-54
WP_088208150.1|483360_484767_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	3.1e-37
WP_102890521.1|485020_486187_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.2	2.7e-111
WP_102890522.1|486240_487245_-	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	32.7	4.1e-36
WP_137849316.1|487435_488416_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_153688144.1|488454_489066_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	7.1e-15
>prophage 2
NZ_CP045769	Enterobacter cancerogenus strain MiY-F chromosome, complete genome	4893729	1351100	1359657	4893729		Escherichia_phage(66.67%)	10	NA	NA
WP_006175038.1|1351100_1352315_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	30.0	4.3e-48
WP_088207371.1|1352425_1352752_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	52.9	5.4e-22
WP_006175036.1|1352905_1353244_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_153688443.1|1353243_1353804_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_088207897.1|1353821_1354532_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_058608885.1|1354637_1354943_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_153688444.1|1355079_1357518_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.8	1.8e-218
WP_006175031.1|1357528_1358146_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	6.1e-75
WP_153688445.1|1358147_1359002_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.2	2.6e-23
WP_088207373.1|1359042_1359657_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	1.2e-30
>prophage 3
NZ_CP045769	Enterobacter cancerogenus strain MiY-F chromosome, complete genome	4893729	1520406	1558425	4893729	terminase,head,lysis	Cronobacter_phage(31.58%)	45	NA	NA
WP_153688506.1|1520406_1521186_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.1e-12
WP_153688507.1|1521182_1522625_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	34.5	2.6e-55
WP_006174869.1|1522689_1523400_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_088207453.1|1523694_1524159_-	endopeptidase	NA	S5MM68	Bacillus_phage	33.8	2.8e-11
WP_102891047.1|1524233_1524989_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A285PWH2	Cedratvirus	30.0	1.8e-07
WP_006174866.1|1524988_1525540_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_153688508.1|1525874_1526195_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.4	1.8e-22
WP_153688509.1|1526194_1526434_-	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	70.5	2.0e-26
WP_153688510.1|1526546_1526909_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	71.7	5.6e-44
WP_153688511.1|1526905_1527847_+	glycosyltransferase	NA	U5P087	Shigella_phage	91.4	9.5e-160
WP_153688512.1|1527843_1529316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133306405.1|1529414_1529765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153688513.1|1529755_1531861_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	61.4	2.4e-38
WP_153688514.1|1531918_1534396_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	92.6	0.0e+00
WP_153689580.1|1534382_1534748_-	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	93.3	2.2e-64
WP_153688515.1|1534761_1535232_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	93.6	7.0e-79
WP_153688516.1|1535231_1535729_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	88.5	3.1e-85
WP_153688517.1|1535728_1538050_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	50.6	5.1e-146
WP_033817211.1|1538138_1538498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153688518.1|1538588_1539329_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	51.8	1.2e-61
WP_153688519.1|1539379_1540135_-	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	52.2	3.2e-57
WP_153688520.1|1540193_1540577_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	56.7	4.9e-38
WP_153688521.1|1540573_1540942_-	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	75.0	1.1e-44
WP_032668718.1|1540944_1541301_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	56.4	2.7e-27
WP_013097716.1|1541452_1541623_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	48.2	3.8e-11
WP_153688522.1|1541622_1542024_-	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	87.7	3.6e-60
WP_153688523.1|1542082_1542376_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	88.7	1.6e-41
WP_153688524.1|1542385_1543462_-	hypothetical protein	NA	A0A1V0E5P6	Salmonella_phage	86.9	2.4e-183
WP_153688525.1|1543479_1543929_-	hypothetical protein	NA	H6WRT3	Salmonella_phage	85.9	5.5e-65
WP_153688526.1|1543941_1545207_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	91.7	4.4e-221
WP_153688527.1|1545209_1546133_-|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	91.9	3.2e-160
WP_153688528.1|1546116_1547442_-	DUF1073 domain-containing protein	NA	Q5G8Y4	Enterobacteria_phage	76.6	4.5e-200
WP_153688529.1|1547457_1548936_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	87.0	5.9e-257
WP_153688530.1|1548922_1549495_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	72.1	3.8e-71
WP_153688531.1|1549524_1550049_+	hypothetical protein	NA	S4TR57	Salmonella_phage	60.0	4.8e-52
WP_153688532.1|1550097_1550301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069595878.1|1551634_1552186_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	71.8	1.4e-73
WP_153688533.1|1552506_1552971_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	65.6	5.0e-45
WP_153688534.1|1552967_1553462_-	glycoside hydrolase family protein	NA	M9P0E5	Enterobacteria_phage	96.3	3.5e-89
WP_001752682.1|1553439_1553664_-|lysis	lysis S family protein	lysis	M9NZI9	Enterobacteria_phage	91.9	6.8e-32
WP_153688535.1|1555313_1555592_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_153688536.1|1555809_1556643_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	77.6	5.3e-122
WP_153688537.1|1556639_1557002_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	77.1	1.7e-45
WP_153688538.1|1557209_1557812_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	80.5	2.4e-92
WP_153688539.1|1558200_1558425_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	58.4	1.2e-17
>prophage 4
NZ_CP045769	Enterobacter cancerogenus strain MiY-F chromosome, complete genome	4893729	1562925	1579104	4893729	tRNA	Enterobacteria_phage(53.85%)	16	NA	NA
WP_153688544.1|1562925_1563612_-	phage replication protein	NA	M9NYX7	Enterobacteria_phage	62.6	2.9e-81
WP_167519804.1|1563608_1564526_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	70.7	4.3e-109
WP_153688545.1|1564610_1565162_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	45.4	2.9e-31
WP_153688546.1|1565164_1565392_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	74.7	2.3e-27
WP_054803286.1|1565497_1565884_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	78.2	3.1e-48
WP_153689582.1|1566003_1567422_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_167519805.1|1567945_1568110_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	81.2	2.6e-17
WP_153688547.1|1568250_1571388_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	65.1	0.0e+00
WP_153688548.1|1571397_1572483_+	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	64.5	4.6e-126
WP_153688549.1|1572521_1572764_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	94.9	4.6e-34
WP_153688550.1|1572828_1573044_+	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	57.7	3.7e-19
WP_153688551.1|1573043_1574264_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	52.4	1.2e-117
WP_153689583.1|1574330_1575311_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_003857805.1|1575413_1575713_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_006174864.1|1575717_1578105_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_042319620.1|1578120_1579104_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	3.8e-34
>prophage 5
NZ_CP045769	Enterobacter cancerogenus strain MiY-F chromosome, complete genome	4893729	1969077	2013064	4893729	terminase,bacteriocin,tail,holin,capsid,head,portal,integrase	Cronobacter_phage(68.42%)	54	1967311:1967325	1999526:1999540
1967311:1967325	attL	ATGGGTTTTTTGTTG	NA	NA	NA	NA
WP_153688666.1|1969077_1970754_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	63.5	3.5e-205
WP_153688667.1|1970756_1971305_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.5	2.3e-65
WP_153688668.1|1971276_1972002_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	51.0	2.7e-61
WP_153688669.1|1971991_1972402_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	50.7	3.2e-27
WP_153688670.1|1972413_1974726_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	81.5	3.7e-149
WP_153688671.1|1974735_1975323_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	81.5	5.8e-91
WP_153688672.1|1975315_1976500_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	79.0	6.3e-177
WP_153688673.1|1976496_1976826_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	71.6	2.7e-37
WP_153688674.1|1976822_1979135_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	55.3	6.7e-207
WP_153688675.1|1979322_1979583_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.6	6.2e-21
WP_153688676.1|1979702_1980071_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	54.3	3.2e-23
WP_153688677.1|1980070_1980412_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	89.1	3.5e-48
WP_107703030.1|1980408_1980705_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.8	1.2e-15
WP_058657590.1|1980714_1981170_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.8	2.0e-59
WP_153688678.1|1981166_1982294_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	82.4	1.1e-173
WP_153688679.1|1982290_1982998_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	77.4	3.4e-101
WP_153688680.1|1982994_1983501_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	70.3	3.3e-66
WP_032657740.1|1983497_1983989_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	77.3	3.2e-58
WP_153688681.1|1984048_1984750_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.2	7.4e-85
WP_153688682.1|1984753_1985776_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	79.4	4.2e-153
WP_153688683.1|1985835_1986630_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	56.0	1.7e-72
WP_153688684.1|1986802_1988578_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	85.6	1.2e-291
WP_153688685.1|1988574_1989627_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	1.4e-159
WP_153688686.1|1989623_1989947_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	89.4	1.7e-47
WP_153688687.1|1989920_1990133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153688688.1|1990251_1992300_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.3	1.8e-304
WP_153688689.1|1992268_1992481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153688690.1|1992477_1993344_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	92.9	1.6e-145
WP_044857840.1|1993334_1993568_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_059476610.1|1993635_1994037_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	54.1	4.6e-39
WP_044857842.1|1994036_1994474_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	53.6	4.9e-26
WP_044857843.1|1994463_1994658_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_153688691.1|1994667_1995171_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	70.7	4.3e-58
WP_105570840.1|1995203_1995425_-	regulator	NA	NA	NA	NA	NA
WP_153688692.1|1995517_1996114_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	41.3	7.1e-36
WP_153688693.1|1996114_1996897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153688694.1|1996899_1997970_+	N-acetyltransferase	NA	Q6SE88	Lactobacillus_prophage	42.2	1.4e-69
WP_105620753.1|1997947_1998319_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	52.4	8.0e-30
WP_153688695.1|1998398_1999451_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.7	7.2e-108
WP_102891177.1|1999789_2000107_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	55.6	9.9e-21
1999526:1999540	attR	ATGGGTTTTTTGTTG	NA	NA	NA	NA
WP_102891178.1|2000151_2001444_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.7	2.4e-169
WP_153688696.1|2001453_2001885_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	65.7	6.2e-50
WP_088207605.1|2001904_2002468_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153688697.1|2002549_2003761_+	MFS transporter	NA	NA	NA	NA	NA
WP_042319388.1|2003750_2004563_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_153688698.1|2004599_2005832_-	MdfA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_042319381.1|2005999_2006728_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_058610371.1|2006735_2007344_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_006174267.1|2007411_2008170_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	26.8	9.1e-12
WP_153688699.1|2008742_2009948_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.5	2.4e-99
WP_058610373.1|2010183_2010810_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_042319377.1|2010810_2011929_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_042319373.1|2012036_2012420_-	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_102891184.1|2012812_2013064_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 6
NZ_CP045769	Enterobacter cancerogenus strain MiY-F chromosome, complete genome	4893729	2390248	2446610	4893729	terminase,tRNA,tail,capsid,protease,head,plate,portal,integrase	Enterobacteria_phage(54.55%)	59	2390162:2390182	2446613:2446633
2390162:2390182	attL	AAAAGCCGGGTGGCGGCTACG	NA	NA	NA	NA
WP_042320872.1|2390248_2391634_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	33.2	1.3e-43
WP_006176980.1|2391808_2392303_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_006176979.1|2392306_2393029_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_153688837.1|2393148_2393658_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_006176977.1|2393654_2394722_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_153688838.1|2394806_2395877_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_088207810.1|2395964_2397110_-	porin	NA	NA	NA	NA	NA
WP_102891317.1|2397292_2399707_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_153688839.1|2399703_2400390_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	1.7e-33
WP_042320869.1|2400360_2400984_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_006176971.1|2400973_2401783_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006176970.1|2401841_2402696_+	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_058609956.1|2402742_2403525_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_153689588.1|2403511_2404189_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	4.1e-24
WP_153688840.1|2404576_2405965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137271705.1|2406414_2407269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006176963.1|2407423_2408338_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_153688841.1|2408334_2408793_+	NfeD family protein	NA	NA	NA	NA	NA
WP_153688842.1|2408812_2410960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153688843.1|2410929_2411652_+	DUF3142 domain-containing protein	NA	NA	NA	NA	NA
WP_088207819.1|2411630_2412041_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_045346979.1|2412127_2413150_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	50.2	4.9e-93
WP_153688844.1|2413219_2413519_-	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	59.6	6.5e-30
WP_045347041.1|2413767_2414103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153688846.1|2414317_2414599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153688847.1|2414679_2414847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153688848.1|2414839_2415826_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	46.3	4.4e-67
WP_153689589.1|2416035_2418201_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	41.1	1.2e-133
WP_153688849.1|2418243_2419155_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_153688850.1|2419160_2420609_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_153688851.1|2421065_2422124_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	70.2	1.5e-142
WP_153688852.1|2422123_2423854_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	75.3	5.3e-265
WP_153688853.1|2424013_2424850_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	68.3	1.4e-101
WP_153688854.1|2424873_2425923_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	52.4	4.4e-105
WP_153688855.1|2425967_2426825_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	60.3	8.3e-70
WP_153688856.1|2426923_2427448_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	53.5	3.1e-43
WP_153688857.1|2427447_2427648_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	75.4	3.7e-21
WP_153688858.1|2427638_2427941_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_153688859.1|2427924_2428470_+	glycoside hydrolase family protein	NA	Q1I0Z1	Pasteurella_virus	41.7	1.2e-29
WP_153688860.1|2428466_2428904_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	34.1	5.6e-06
WP_153688861.1|2429114_2429585_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	66.0	4.2e-60
WP_153688862.1|2429577_2430216_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	52.7	6.6e-56
WP_153688863.1|2430212_2430794_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	68.4	2.9e-74
WP_153688864.1|2430790_2431159_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	63.5	6.3e-35
WP_153688865.1|2431145_2432042_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	62.1	1.2e-95
WP_153688866.1|2432034_2432562_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	73.6	3.8e-73
WP_153688867.1|2432573_2434625_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	80.5	1.7e-89
WP_153688868.1|2434636_2435041_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	47.8	1.3e-25
WP_047364082.1|2435112_2435601_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	73.5	5.4e-66
WP_153688869.1|2435615_2438582_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	54.1	5.1e-268
WP_032424037.1|2438568_2438724_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	2.7e-11
WP_153688870.1|2438729_2439047_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	54.1	3.8e-20
WP_006117904.1|2439095_2439611_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	65.9	2.7e-60
WP_153688871.1|2439611_2440793_-|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	76.2	2.5e-173
WP_153688872.1|2440946_2442083_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	74.9	1.1e-159
WP_074172047.1|2442122_2442371_+	hypothetical protein	NA	Q858U4	Yersinia_virus	50.0	4.0e-09
WP_153688873.1|2442586_2445085_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.4	1.3e-110
WP_153688874.1|2445135_2445930_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_058609274.1|2446130_2446610_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
2446613:2446633	attR	AAAAGCCGGGTGGCGGCTACG	NA	NA	NA	NA
>prophage 7
NZ_CP045769	Enterobacter cancerogenus strain MiY-F chromosome, complete genome	4893729	3452317	3466462	4893729	capsid,integrase	Enterobacteria_phage(88.89%)	18	3452136:3452157	3462976:3462997
3452136:3452157	attL	ACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_032643709.1|3452317_3453493_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.2	2.1e-209
WP_136719733.1|3453610_3454339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153689144.1|3454339_3455824_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_050871009.1|3456027_3456591_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.7	1.0e-60
WP_023304273.1|3456619_3456838_-	phage transcriptional activator	NA	Q7M294	Enterobacteria_phage	66.2	1.5e-15
WP_153689145.1|3456841_3457585_-|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_167519821.1|3458131_3458398_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	76.1	6.2e-32
WP_153689146.1|3458394_3458946_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	64.9	2.0e-29
WP_153689147.1|3458938_3459238_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	70.1	3.1e-32
WP_017694616.1|3459230_3459680_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	70.8	9.7e-46
WP_032620946.1|3459784_3460012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153689148.1|3460008_3460329_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_153689149.1|3460343_3462677_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.4	0.0e+00
WP_088208985.1|3463243_3463804_+	hypothetical protein	NA	NA	NA	NA	NA
3462976:3462997	attR	ACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_153689150.1|3463855_3464692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088208983.1|3464705_3464897_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_006177695.1|3465022_3465364_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_153689151.1|3465424_3466462_+	hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	43.0	2.2e-69
>prophage 8
NZ_CP045769	Enterobacter cancerogenus strain MiY-F chromosome, complete genome	4893729	4299125	4338386	4893729	terminase,tRNA,tail,capsid,head,lysis,plate,portal,integrase	Erwinia_phage(54.35%)	49	4301235:4301289	4332135:4332189
WP_101736949.1|4299125_4299974_-	benzoate transporter	NA	M1HZA4	Paramecium_bursaria_Chlorella_virus	34.0	1.3e-27
WP_102890174.1|4300444_4301017_-	serine acetyltransferase	NA	NA	NA	NA	NA
4301235:4301289	attL	GCTAAAATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_153689350.1|4301363_4302398_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.0	1.3e-199
WP_167519826.1|4302397_4302970_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	97.4	3.5e-101
WP_001630878.1|4303100_4303364_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_153689351.1|4303394_4303904_+	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	7.3e-90
WP_153689352.1|4303911_4304112_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	97.0	1.3e-31
WP_047674717.1|4304075_4304414_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	93.8	1.2e-53
WP_015960493.1|4304481_4304709_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	98.7	4.4e-31
WP_153689353.1|4304708_4304930_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	94.5	3.0e-32
WP_153689354.1|4304930_4305209_+	DUF5405 family protein	NA	A0A0M4R2Q0	Salmonella_phage	90.2	1.8e-42
WP_153689355.1|4305212_4306043_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	96.7	5.1e-157
WP_153689356.1|4306039_4308259_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	96.7	0.0e+00
WP_153689357.1|4308378_4308582_+	Tum protein	NA	A0A218M4I0	Erwinia_phage	79.2	2.8e-16
WP_153689358.1|4308682_4309729_+	DNA (cytosine-5-)-methyltransferase	NA	A0A0R6PG08	Moraxella_phage	59.0	3.5e-115
WP_153689359.1|4309707_4310427_-	hypothetical protein	NA	A0A0R6PKK0	Moraxella_phage	26.5	1.2e-16
WP_153689613.1|4310437_4311586_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	45.6	8.2e-81
WP_032665715.1|4311921_4312968_-|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	95.1	1.2e-190
WP_153689360.1|4312969_4314739_-	oxidoreductase	NA	A0A218M4M1	Erwinia_phage	99.3	0.0e+00
WP_153689361.1|4314904_4315759_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	99.3	1.2e-158
WP_153689362.1|4315834_4316902_+|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	98.0	3.5e-195
WP_153689363.1|4316906_4317656_+|terminase	terminase	terminase	A0A218M4L0	Erwinia_phage	95.9	7.6e-112
WP_153689364.1|4317749_4318259_+|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	98.2	2.5e-90
WP_153689365.1|4318258_4318462_+|tail	phage tail protein	tail	A0A218M4L8	Erwinia_phage	94.0	2.2e-29
WP_153689366.1|4318452_4318674_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	97.3	1.4e-34
WP_153689367.1|4318657_4319170_+	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	97.1	5.1e-91
WP_153689368.1|4319166_4319598_+	lysA protein	NA	A0A218M4L6	Erwinia_phage	89.5	3.9e-68
WP_153689614.1|4319597_4320008_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	94.1	2.5e-64
WP_001384078.1|4319979_4320153_+	hypothetical protein	NA	O80311	Escherichia_phage	98.2	6.2e-25
WP_153689369.1|4320115_4320583_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	99.4	1.6e-83
WP_153689370.1|4321093_4321729_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	99.1	1.1e-111
WP_000127178.1|4321725_4322073_+|plate	baseplate assembly protein	plate	A0A218M4K8	Erwinia_phage	99.1	5.5e-57
WP_087856839.1|4322079_4322988_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	98.7	2.2e-158
WP_153689371.1|4322980_4323589_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	98.5	6.6e-114
WP_153689372.1|4323585_4324614_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	76.9	1.7e-141
WP_153689373.1|4324613_4325210_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	83.8	1.2e-91
WP_153689374.1|4325341_4326520_+|tail	phage tail protein	tail	Q37844	Escherichia_phage	97.2	1.1e-216
WP_001207674.1|4326535_4327054_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	6.5e-94
WP_153689375.1|4327116_4327452_+|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	97.3	1.5e-51
WP_000763323.1|4327484_4327604_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	100.0	1.4e-15
WP_153689376.1|4327596_4330038_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	94.1	0.0e+00
WP_063408337.1|4330050_4330536_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	96.9	1.7e-83
WP_153689377.1|4330532_4331702_+	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	99.2	6.2e-209
WP_023135249.1|4331768_4331987_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	100.0	4.3e-39
WP_058610735.1|4332344_4332851_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4332135:4332189	attR	GCTAAAATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_006178605.1|4332932_4334777_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_153689378.1|4335060_4336806_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	2.4e-76
WP_001144069.1|4336920_4337136_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_042322033.1|4337372_4338386_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.5e-110
>prophage 9
NZ_CP045769	Enterobacter cancerogenus strain MiY-F chromosome, complete genome	4893729	4806317	4885840	4893729	terminase,tRNA,tail,capsid,head,lysis,plate,portal,integrase	Salmonella_phage(44.44%)	87	4808852:4808870	4872161:4872179
WP_137273477.1|4806317_4808081_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_153689625.1|4808080_4809136_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
4808852:4808870	attL	GGCGGGGAGCTGCACGGCG	NA	NA	NA	NA
WP_153689518.1|4809110_4809653_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_006178084.1|4809654_4810098_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_088209451.1|4810122_4811454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167519843.1|4811582_4812062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141114298.1|4812122_4813298_-	cupin	NA	NA	NA	NA	NA
WP_006178080.1|4813310_4814102_-	2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase	NA	NA	NA	NA	NA
WP_153689520.1|4814083_4814827_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_153689521.1|4814835_4815600_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006178077.1|4815603_4816926_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_153689522.1|4817001_4818240_-	MFS transporter	NA	NA	NA	NA	NA
WP_088209444.1|4818583_4819654_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_058608452.1|4819650_4820622_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_088209443.1|4820783_4821926_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_006178070.1|4821926_4823222_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_153689626.1|4823284_4824604_+	amidase	NA	NA	NA	NA	NA
WP_153689523.1|4824766_4825684_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_102890341.1|4825872_4829754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153689524.1|4830471_4831095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006178063.1|4832314_4832797_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.0e-29
WP_042321720.1|4832914_4833391_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_058608440.1|4833380_4833668_+	RnfH family protein	NA	NA	NA	NA	NA
WP_006178060.1|4833762_4834101_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_161975926.1|4834082_4834217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006178059.1|4834239_4835901_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_137903889.1|4835986_4836865_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_042321711.1|4836987_4837581_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_042321706.1|4837633_4838920_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_153689525.1|4838938_4839730_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_006178054.1|4839895_4841257_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003863133.1|4841528_4841777_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_006178053.1|4841792_4842332_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_006178052.1|4842363_4843131_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_006178051.1|4843174_4843522_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_088209391.1|4843652_4844057_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_088209390.1|4844097_4845468_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_006178048.1|4845470_4845956_-	OmpA family protein	NA	NA	NA	NA	NA
WP_137273489.1|4845969_4847190_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	40.9	1.9e-06
WP_167519844.1|4847182_4847704_-	YfiR family protein	NA	NA	NA	NA	NA
WP_102890356.1|4847870_4848245_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_153689527.1|4848457_4849528_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	52.1	8.1e-91
WP_088209387.1|4849538_4850660_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_153689528.1|4850720_4851593_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_153689529.1|4851589_4852750_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_153689627.1|4852855_4852903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153689530.1|4853067_4854066_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	55.0	1.8e-100
WP_153689531.1|4854132_4854432_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	58.3	7.4e-26
WP_153689532.1|4854540_4854822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153689533.1|4854848_4855184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153689534.1|4855193_4855763_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	52.2	1.9e-46
WP_167519832.1|4855765_4855984_+	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	45.2	3.1e-05
WP_153689535.1|4856022_4858674_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	46.5	3.0e-243
WP_153689536.1|4858670_4858913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153689628.1|4858971_4860069_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	64.0	3.4e-124
WP_153689537.1|4860260_4861466_+|tail	phage tail protein	tail	A0A0M4S6M1	Salmonella_phage	62.5	7.4e-141
WP_153689538.1|4861481_4861997_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	57.3	1.1e-48
WP_153689630.1|4862143_4862374_+|tail	phage tail assembly protein	tail	A0A0M4RCV2	Salmonella_phage	50.0	8.8e-11
WP_153689629.1|4862406_4862553_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_153689539.1|4862530_4865269_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	30.8	1.1e-91
WP_153689540.1|4865275_4865725_+	oxidoreductase	NA	A0A1J0I2L5	Salmonella_phage	62.4	1.5e-43
WP_153689541.1|4866355_4866685_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_153689542.1|4867068_4867974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153689543.1|4867970_4868501_-|tail	phage tail protein	tail	A0A1S6KZY8	Salmonella_phage	39.4	2.0e-21
WP_153689544.1|4868510_4870238_-	hypothetical protein	NA	Q858V4	Yersinia_virus	48.2	3.0e-50
WP_167519833.1|4870239_4870782_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	45.0	6.0e-42
WP_153689546.1|4870774_4871701_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	55.1	3.5e-82
WP_153689547.1|4871697_4872066_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	53.3	9.5e-23
WP_153689548.1|4872062_4872683_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	51.4	2.4e-50
4872161:4872179	attR	CGCCGTGCAGCTCCCCGCC	NA	NA	NA	NA
WP_167519834.1|4872772_4873432_-	phage virion morphogenesis protein	NA	E5E3V8	Burkholderia_phage	26.4	7.4e-10
WP_153689550.1|4873424_4873913_-|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	35.0	7.9e-17
WP_153689631.1|4873963_4874341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153689632.1|4874412_4874877_-|lysis	lysis protein	lysis	A0A0P0ZDL0	Stx2-converting_phage	42.3	4.4e-25
WP_153689551.1|4874964_4875495_-	glycoside hydrolase family protein	NA	Q71TF3	Escherichia_phage	51.4	8.2e-44
WP_153689552.1|4875496_4875709_-|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	34.4	7.1e-07
WP_153689553.1|4875718_4876087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153689554.1|4876089_4876293_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	58.2	7.3e-17
WP_153689555.1|4876293_4876755_-|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	54.9	4.2e-36
WP_153689556.1|4876854_4877568_-|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	44.0	6.7e-41
WP_153689633.1|4877581_4878637_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	66.3	8.8e-130
WP_153689557.1|4878669_4879542_-	hypothetical protein	NA	A0A1J0I2E9	Salmonella_phage	43.3	9.4e-53
WP_153689634.1|4879678_4881403_+	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	55.8	1.2e-179
WP_153689635.1|4881468_4882500_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	54.9	9.8e-110
WP_153689558.1|4882492_4883041_+	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	51.2	1.0e-41
WP_153689559.1|4883042_4883900_+	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	48.9	3.7e-70
WP_153689560.1|4883883_4884498_+	hypothetical protein	NA	H2BDB7	Pseudomonas_virus	46.9	2.2e-48
WP_153689561.1|4884988_4885840_-	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	52.9	2.8e-41
>prophage 1
NZ_CP045770	Enterobacter cancerogenus strain MiY-F plasmid pCFSAN086183, complete sequence	98844	79059	86876	98844	integrase	Macacine_betaherpesvirus(33.33%)	8	68023:68036	89823:89836
68023:68036	attL	TGTCATTTTTCAGC	NA	NA	NA	NA
WP_153689686.1|79059_79851_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	86.8	1.4e-50
WP_153689687.1|79954_80260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102889965.1|80256_80883_-	ParA family plasmid-partitioning AAA ATPase	NA	Q2A085	Sodalis_phage	34.8	3.8e-24
WP_153689688.1|81114_82473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008502210.1|82773_83529_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	94.0	7.9e-133
WP_153689689.1|83970_85242_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	8.9e-153
WP_153689690.1|85241_85673_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.1	7.2e-30
WP_153689704.1|85904_86876_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	47.1	6.3e-74
89823:89836	attR	GCTGAAAAATGACA	NA	NA	NA	NA
