The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045766	Salmonella bongori CFSAN000510 strain SGSC 3100 chromosome, complete genome	4459434	1618598	1655542	4459434	integrase,head,holin,tail,tRNA,lysis,capsid,plate,terminase,portal	Salmonella_phage(56.1%)	46	1618479:1618527	1649175:1649223
1618479:1618527	attL	ATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_000218395.1|1618598_1619636_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	97.1	1.1e-198
WP_001217271.1|1619635_1620214_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	63.0	3.5e-64
WP_000135597.1|1620344_1620608_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.7	3.3e-38
WP_000459332.1|1620638_1621148_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	6.2e-89
WP_000920168.1|1621155_1621383_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	2.1e-36
WP_000085639.1|1621369_1621570_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	98.5	2.3e-31
WP_001246236.1|1621639_1621867_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	98.7	2.6e-31
WP_000752604.1|1621866_1622091_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	100.0	6.5e-35
WP_153655389.1|1622112_1622706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000503833.1|1622731_1624951_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	94.6	0.0e+00
WP_000373435.1|1625068_1625509_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	94.2	2.6e-67
WP_000381894.1|1625591_1626323_+	hypothetical protein	NA	Q37850	Escherichia_phage	93.8	5.1e-129
WP_000033213.1|1626433_1626982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338485.1|1627361_1628366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517958.1|1628443_1629490_-|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	99.4	4.4e-190
WP_000156054.1|1629489_1631259_-|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	99.8	0.0e+00
WP_001085936.1|1631424_1632279_+|capsid	capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	98.6	8.9e-157
WP_001248604.1|1632354_1633422_+|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	89.5	2.3e-178
WP_000203474.1|1633425_1634175_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	88.0	1.8e-113
WP_000214255.1|1634268_1634775_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
WP_015703020.1|1634774_1634978_+|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	98.5	4.0e-31
WP_000134659.1|1634981_1635278_+|holin	holin	holin	S4TP56	Salmonella_phage	100.0	4.4e-47
WP_001144116.1|1635264_1635762_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
WP_000866102.1|1635758_1636172_+|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	100.0	2.6e-45
WP_001394645.1|1636143_1636317_+	hypothetical protein	NA	S4TNY4	Salmonella_phage	98.2	2.8e-25
WP_001169076.1|1636279_1636747_+|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	99.4	2.5e-84
WP_001293103.1|1636739_1637189_+	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	99.3	2.5e-73
WP_001094753.1|1637257_1637899_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	98.1	3.5e-113
WP_000127150.1|1637895_1638243_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	98.3	2.1e-56
WP_000246675.1|1638249_1639158_+|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	99.0	1.3e-158
WP_001000071.1|1639150_1639681_+|tail	phage tail protein I	tail	Q6K1H3	Salmonella_virus	98.3	7.8e-103
WP_000104701.1|1639691_1641668_+|tail	tail protein	tail	S4TP62	Salmonella_phage	98.6	0.0e+00
WP_000122994.1|1641680_1642229_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	99.5	1.7e-100
WP_001279032.1|1642363_1643551_+|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.5	5.8e-223
WP_001207675.1|1643566_1644085_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_001029727.1|1644147_1644483_+|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_085984508.1|1644479_1644635_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_000069527.1|1644627_1647069_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	94.1	0.0e+00
WP_000978861.1|1647083_1647569_+|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	100.0	1.0e-85
WP_000627825.1|1647565_1648735_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	97.4	1.9e-210
WP_000468307.1|1648801_1649020_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	98.6	9.5e-39
WP_000237774.1|1649378_1649885_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
1649175:1649223	attR	ATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_001519776.1|1650029_1651877_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918858.1|1652026_1653772_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	4.7e-72
WP_001144069.1|1654075_1654291_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264346.1|1654528_1655542_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	4.5e-107
>prophage 2
NZ_CP045766	Salmonella bongori CFSAN000510 strain SGSC 3100 chromosome, complete genome	4459434	2582396	2590986	4459434	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_000569161.1|2582396_2583344_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.5	6.2e-10
WP_000824740.1|2583327_2584059_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001234243.1|2584039_2584147_-	protein YohO	NA	NA	NA	NA	NA
WP_001240383.1|2584206_2584947_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	88.1	1.3e-100
WP_000272843.1|2585169_2586855_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	89.3	4.6e-274
WP_000598645.1|2586851_2587571_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950424.1|2587617_2588088_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	91.7	1.1e-76
WP_000703144.1|2588226_2588685_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	69.9	7.1e-52
WP_000195328.1|2588952_2590986_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.8e-55
>prophage 3
NZ_CP045766	Salmonella bongori CFSAN000510 strain SGSC 3100 chromosome, complete genome	4459434	3702704	3726716	4459434	integrase,holin	Salmonella_phage(50.0%)	35	3697663:3697722	3726805:3726882
3697663:3697722	attL	TAACCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTC	NA	NA	NA	NA
WP_141024939.1|3702704_3703208_-	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	45.6	1.7e-19
WP_015702803.1|3703654_3704767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480907.1|3704768_3705026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111091.1|3705110_3705461_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	74.8	8.1e-48
WP_000819054.1|3705563_3705869_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	53.1	6.2e-20
WP_001222152.1|3705957_3706368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109263.1|3706767_3707298_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	96.6	9.9e-90
WP_001050816.1|3707559_3708102_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000372743.1|3708098_3708713_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.6	2.7e-107
WP_000226306.1|3708712_3708994_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_001294877.1|3708980_3709370_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.8	1.4e-40
WP_141024936.1|3709607_3710309_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	66.0	5.0e-81
WP_141024934.1|3710379_3710808_-	pertussis toxin	NA	NA	NA	NA	NA
WP_000509712.1|3711737_3711917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151608.1|3711927_3712428_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000211402.1|3712569_3713142_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	71.1	3.5e-40
WP_000793789.1|3713410_3714082_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	57.1	1.5e-63
WP_000929795.1|3714470_3715073_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	1.3e-109
WP_015702798.1|3715107_3715356_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	98.8	3.6e-42
WP_001217667.1|3715472_3715706_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	7.3e-37
WP_000128278.1|3715891_3716638_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	61.8	4.5e-64
WP_000900558.1|3716710_3717625_-	antirepressor protein	NA	I6S627	Salmonella_phage	48.9	1.8e-59
WP_000409416.1|3717611_3717779_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	75.5	6.6e-16
WP_000085729.1|3717901_3718333_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	55.8	9.7e-27
WP_024134978.1|3718619_3718946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000025837.1|3719955_3720213_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	89.4	1.8e-36
WP_000788824.1|3720226_3720919_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	58.9	4.3e-77
WP_000024047.1|3720915_3721821_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.0	1.3e-174
WP_015702794.1|3721912_3722287_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	3.3e-63
WP_000145711.1|3722252_3722480_-	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_000214259.1|3722493_3722961_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	85.2	4.7e-67
WP_000097141.1|3723132_3723981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846936.1|3723977_3724784_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000196400.1|3725471_3725696_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_015702793.1|3725696_3726716_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	8.3e-93
3726805:3726882	attR	TAACCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCGG	NA	NA	NA	NA
>prophage 4
NZ_CP045766	Salmonella bongori CFSAN000510 strain SGSC 3100 chromosome, complete genome	4459434	3811394	3885764	4459434	tail,tRNA,plate,protease	Salmonella_phage(25.0%)	64	NA	NA
WP_000886701.1|3811394_3812687_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
WP_000067777.1|3812943_3814287_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.9	1.8e-79
WP_015702786.1|3814296_3814908_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000076975.1|3815050_3819022_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.8e-88
WP_000228469.1|3819156_3819651_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537395.1|3820197_3821166_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	7.2e-62
WP_001044529.1|3821280_3823047_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	2.0e-22
WP_001202240.1|3823047_3824769_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.1	1.3e-13
WP_001241653.1|3824813_3825518_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3825810_3826029_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000597933.1|3826267_3827179_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000809976.1|3827287_3828148_+	pirin family protein	NA	NA	NA	NA	NA
WP_000203410.1|3828167_3828845_+	hydrolase	NA	NA	NA	NA	NA
WP_000934068.1|3829465_3831742_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	8.1e-165
WP_000520786.1|3831772_3832093_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_000447498.1|3832416_3832638_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125868.1|3832788_3834735_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.7	3.1e-40
WP_001201757.1|3834731_3835850_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.1	1.8e-08
WP_000192850.1|3835995_3836946_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599777.1|3836942_3838601_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000490988.1|3838801_3839701_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_000458840.1|3839843_3841496_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178699.1|3841506_3842475_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815328.1|3842666_3844385_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	1.3e-29
WP_000566417.1|3844423_3845425_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136512.1|3845435_3846869_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000866899.1|3846964_3847978_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001202301.1|3847974_3848805_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.1	3.3e-07
WP_001160725.1|3848801_3849125_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000701348.1|3849726_3851499_+	DUF4116 domain-containing protein	NA	NA	NA	NA	NA
WP_001270718.1|3852259_3852775_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027180.1|3852998_3853727_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.4	8.7e-28
WP_000756594.1|3853744_3854476_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001674.1|3854482_3855199_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000895391.1|3855198_3855867_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_000737541.1|3856101_3856833_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015702782.1|3857009_3858422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000644037.1|3858507_3859995_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_015702781.1|3860004_3860325_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000399312.1|3860356_3861700_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001149768.1|3861981_3863112_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.8	7.4e-26
WP_000506267.1|3863154_3863628_-	YbjO family protein	NA	NA	NA	NA	NA
WP_000183361.1|3863700_3864546_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105458.1|3864542_3865496_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001000692.1|3865505_3866639_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	3.2e-29
WP_000126167.1|3866724_3867837_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000624815.1|3868185_3868662_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684312.1|3868758_3869661_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.6	2.6e-34
WP_001070124.1|3869719_3870442_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001259125.1|3870425_3870716_-	YbjC family protein	NA	NA	NA	NA	NA
WP_000495514.1|3870885_3871149_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	3.5e-27
WP_000681116.1|3871180_3871558_-	membrane protein	NA	NA	NA	NA	NA
WP_001024857.1|3871829_3873515_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972393.1|3873750_3873969_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	71.6	1.3e-19
WP_001102270.1|3874059_3875112_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	89.1	4.0e-175
WP_000980410.1|3875108_3875594_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	90.7	1.2e-73
WP_000763316.1|3878562_3878682_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280962.1|3878696_3878999_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_162470497.1|3880079_3880427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000584703.1|3880759_3881224_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	42.0	1.0e-18
WP_001285260.1|3881445_3882603_-	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	29.1	1.9e-29
WP_001086799.1|3883911_3884517_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	97.0	5.0e-114
WP_000268334.1|3884509_3885418_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	98.0	1.5e-157
WP_000177407.1|3885404_3885764_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	96.6	1.8e-58
