The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045749	Listeria monocytogenes strain CFSAN008100 chromosome, complete genome	3042973	468831	476673	3042973		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722610.1|468831_469791_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
WP_009918601.1|469907_470891_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	3.1e-52
WP_009918600.1|470907_471969_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_003725409.1|472010_473741_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.1	9.5e-174
WP_003722606.1|473848_474724_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_003731212.1|474725_475694_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.6	1.8e-68
WP_003725407.1|475701_476673_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
>prophage 2
NZ_CP045749	Listeria monocytogenes strain CFSAN008100 chromosome, complete genome	3042973	620995	663671	3042973	holin,tail,terminase,plate,portal,integrase	Listeria_phage(95.08%)	65	626341:626356	661623:661638
WP_003739618.1|620995_621343_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	40.7	9.9e-06
WP_031644186.1|621397_621874_-	competence protein ComK	NA	NA	NA	NA	NA
WP_009911646.1|621864_623223_-	recombinase family protein	NA	Q8LTD8	Listeria_phage	97.1	2.0e-251
WP_003770015.1|623286_624162_-	hypothetical protein	NA	A0A0B5D0D1	Listeria_phage	94.5	2.2e-150
WP_003770013.1|624183_624906_-	hypothetical protein	NA	A0A059T7P9	Listeria_phage	84.6	7.4e-88
WP_025370648.1|624921_625140_-	zinc-ribbon domain-containing protein	NA	A0A059T6E3	Listeria_phage	97.2	1.3e-32
WP_009911346.1|625162_625654_-	bacteriophage gp35-type protein	NA	A8ATX4	Listeria_phage	98.8	1.1e-90
WP_009911345.1|625684_625993_-	helix-turn-helix transcriptional regulator	NA	A8ATX5	Listeria_phage	98.0	7.8e-47
WP_003731220.1|626141_626393_+	helix-turn-helix transcriptional regulator	NA	A8ATX6	Listeria_phage	100.0	7.6e-40
626341:626356	attL	CCAAAAACGTTGCTAA	NA	NA	NA	NA
WP_003727743.1|626396_626663_+	hypothetical protein	NA	A0A059T7Q1	Listeria_phage	100.0	2.5e-41
WP_003735007.1|626886_627081_+	hypothetical protein	NA	A0A059T6E5	Listeria_phage	100.0	1.3e-26
WP_003769996.1|627092_627377_+	hypothetical protein	NA	A0A0B5D168	Listeria_phage	98.9	1.6e-46
WP_003733634.1|627416_627653_+	hypothetical protein	NA	A0A059T5E9	Listeria_phage	100.0	3.3e-37
WP_003769995.1|627649_627931_+	hypothetical protein	NA	Q9T180	Listeria_phage	96.8	1.4e-39
WP_025370647.1|628116_628359_-	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	98.8	1.5e-37
WP_046811268.1|628422_629202_+	antirepressor	NA	A0A059T6E7	Listeria_phage	96.1	3.8e-138
WP_031644191.1|629323_629860_+	hypothetical protein	NA	Q9T177	Listeria_phage	88.1	7.2e-80
WP_031644193.1|629852_630068_+	hypothetical protein	NA	Q9T176	Listeria_phage	87.3	1.8e-26
WP_031644195.1|630175_630364_+	hypothetical protein	NA	A8ATY3	Listeria_phage	98.4	1.3e-28
WP_031644196.1|630595_631555_+	hypothetical protein	NA	Q9T173	Listeria_phage	83.1	8.7e-153
WP_031644198.1|631557_632373_+	recombinase RecT	NA	Q9T172	Listeria_phage	94.8	1.7e-144
WP_031644200.1|632392_633325_+	DnaD domain-containing protein	NA	A8ATY7	Listeria_phage	89.3	2.6e-149
WP_031690742.1|633321_634035_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	97.9	7.7e-130
WP_031644274.1|634045_634990_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	98.4	4.5e-178
WP_023548471.1|635002_635683_+	hypothetical protein	NA	A8ATD7	Listeria_phage	97.8	3.3e-122
WP_031670092.1|635679_636228_+	DUF1642 domain-containing protein	NA	A0A059T7S4	Listeria_phage	75.3	3.7e-71
WP_046811267.1|636224_636746_+	hypothetical protein	NA	A0A059T7V5	Listeria_phage	47.8	2.4e-32
WP_046811266.1|636916_637597_+	pentapeptide repeat-containing protein	NA	A0A060AFJ6	Listeria_phage	94.7	1.2e-34
WP_046811265.1|637800_638001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020830692.1|637997_638399_+	hypothetical protein	NA	A0A059T6C9	Listeria_phage	76.7	1.9e-53
WP_020830693.1|638395_638674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046811264.1|638673_639153_+	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	94.4	5.4e-79
WP_039382681.1|639184_639490_+	hypothetical protein	NA	A8ATZ8	Listeria_phage	83.2	1.9e-37
WP_003759675.1|639486_639627_+	BH0509 family protein	NA	A8ATZ9	Listeria_phage	87.0	4.7e-15
WP_031644573.1|639592_639997_+	endodeoxyribonuclease	NA	A8AU00	Listeria_phage	98.5	2.7e-71
WP_031644575.1|640125_640290_+	hypothetical protein	NA	A8ASQ0	Listeria_phage	94.4	7.4e-20
WP_003735131.1|640308_640743_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	99.3	4.3e-75
WP_009911405.1|641137_641437_+	phage protein	NA	A0A2H4JBC0	uncultured_Caudovirales_phage	40.7	3.8e-14
WP_010990212.1|641463_641727_+	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	78.2	1.7e-34
WP_010990213.1|641784_642327_+|terminase	terminase small subunit	terminase	A8ASJ1	Listeria_phage	98.9	5.4e-91
WP_010990214.1|642295_643627_+|terminase	PBSX family phage terminase large subunit	terminase	A8ASJ2	Listeria_phage	98.6	1.1e-259
WP_014601086.1|643639_645130_+|portal	phage portal protein	portal	Q9T1C0	Listeria_phage	99.6	3.3e-284
WP_039393322.1|645135_646275_+	hypothetical protein	NA	A0A0B5D147	Listeria_phage	96.8	4.9e-203
WP_014601084.1|646353_646944_+	scaffold protein	NA	Q9T1B8	Listeria_phage	91.5	7.7e-75
WP_046811263.1|646943_647945_+	hypothetical protein	NA	A0A059T6D4	Listeria_phage	99.4	8.2e-186
WP_010989952.1|647963_648359_+	hypothetical protein	NA	A0A059T5E3	Listeria_phage	97.7	4.8e-65
WP_031645712.1|648358_648721_+	hypothetical protein	NA	A0A0B5D151	Listeria_phage	91.7	1.8e-58
WP_031645711.1|648720_649059_+	hypothetical protein	NA	A0A059T7W4	Listeria_phage	97.3	7.0e-57
WP_031645710.1|649058_649466_+	hypothetical protein	NA	A0A0B5CU21	Listeria_phage	98.5	1.5e-66
WP_012582409.1|649468_649906_+	hypothetical protein	NA	A0A0B5CYN3	Listeria_phage	98.6	4.2e-78
WP_045552940.1|649835_650168_+	Ig-like virion protein	NA	Q9T1B0	Listeria_phage	70.9	1.5e-30
WP_003769943.1|650220_650643_+	hypothetical protein	NA	Q9T1A9	Listeria_phage	97.9	5.9e-69
WP_003735024.1|650648_651248_+	hypothetical protein	NA	A0A0B5CTW0	Listeria_phage	72.0	1.9e-76
WP_046811262.1|651258_656622_+	tape measure protein	NA	Q9T1A7	Listeria_phage	97.3	0.0e+00
WP_031645707.1|656623_657442_+|tail	phage tail family protein	tail	Q9T1A6	Listeria_phage	93.4	3.8e-149
WP_046811261.1|657450_658476_+	phage minor structural protein	NA	Q9T1A5	Listeria_phage	88.6	1.5e-182
WP_046811260.1|658476_659505_+	hypothetical protein	NA	Q9T1A4	Listeria_phage	98.5	3.3e-190
WP_046811259.1|659504_660578_+|plate	phage baseplate upper protein	plate	Q9T1A3	Listeria_phage	95.8	9.1e-191
WP_003727798.1|660589_660907_+	hypothetical protein	NA	Q9T1A2	Listeria_phage	92.4	1.3e-49
WP_003722524.1|660911_661070_+	hypothetical protein	NA	Q9T1A1	Listeria_phage	100.0	6.0e-19
WP_003722523.1|661097_661463_+	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_003722522.1|661475_661757_+|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
661623:661638	attR	TTAGCAACGTTTTTGG	NA	NA	NA	NA
WP_031644606.1|661756_662608_+	peptidase M15	NA	A0A059T7Y8	Listeria_phage	93.3	1.4e-138
WP_023548524.1|662872_663040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003725136.1|663437_663671_+	hypothetical protein	NA	A8ATC5	Listeria_phage	92.2	1.2e-34
>prophage 3
NZ_CP045749	Listeria monocytogenes strain CFSAN008100 chromosome, complete genome	3042973	1190576	1198862	3042973		Synechococcus_phage(33.33%)	8	NA	NA
WP_003729814.1|1190576_1191869_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
WP_003726214.1|1191949_1192663_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	2.0e-40
WP_003722248.1|1192674_1192920_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003726212.1|1192923_1193607_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_031644866.1|1193599_1195819_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.0	1.7e-159
WP_003722245.1|1195803_1197231_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_003726210.1|1197249_1198299_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	3.2e-63
WP_003726209.1|1198295_1198862_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	8.3e-26
>prophage 4
NZ_CP045749	Listeria monocytogenes strain CFSAN008100 chromosome, complete genome	3042973	1689957	1864731	3042973	protease,holin,tail,head,terminase,plate,portal,tRNA,capsid,integrase	Listeria_phage(80.43%)	210	1818022:1818045	1863291:1863314
WP_003726415.1|1689957_1691220_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003726414.1|1691233_1692376_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_003727496.1|1692390_1693179_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003727497.1|1693192_1693951_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.1	4.4e-22
WP_003723450.1|1694181_1694739_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003723449.1|1694738_1695467_-	UMP kinase	NA	NA	NA	NA	NA
WP_003727498.1|1695759_1696134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012681273.1|1696111_1697317_+	helicase SNF2	NA	L0P6E9	Lactobacillus_phage	46.6	7.0e-91
WP_003731336.1|1697306_1698611_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	52.1	1.2e-133
WP_003726669.1|1698620_1699127_+	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.7	1.4e-56
WP_003726668.1|1699148_1699880_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	58.0	2.3e-81
WP_003726667.1|1699928_1700168_-	YneF family protein	NA	NA	NA	NA	NA
WP_009928628.1|1700388_1702383_-	transketolase	NA	NA	NA	NA	NA
WP_003727501.1|1702529_1702757_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003734518.1|1702850_1703180_-	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_009928625.1|1703335_1703950_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.1	9.3e-15
WP_003734519.1|1703980_1704505_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023550496.1|1704538_1705834_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	62.1	2.2e-146
WP_003723435.1|1705977_1707312_-	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.4	2.0e-06
WP_003719570.1|1707382_1707751_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003727505.1|1707952_1709179_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_012681271.1|1709171_1710395_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003719566.1|1710505_1710739_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_003726658.1|1710860_1711778_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003723738.1|1711904_1713581_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_023550494.1|1713813_1714512_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	31.9	8.4e-12
WP_003727507.1|1714724_1716611_+	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	32.2	3.8e-43
WP_023550490.1|1716643_1718452_-	class 1 internalin InlK	NA	NA	NA	NA	NA
WP_003726814.1|1719080_1719548_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_010958880.1|1719630_1722090_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.8	1.1e-101
WP_003727510.1|1722086_1724054_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	5.1e-123
WP_003727511.1|1724234_1724642_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_003726698.1|1724799_1725396_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003726697.1|1725437_1726310_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003724130.1|1726312_1726624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023550487.1|1726646_1727066_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003726695.1|1727168_1727948_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_003727514.1|1727968_1729378_-|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.8	7.5e-44
WP_003724001.1|1729391_1729931_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_023550485.1|1729951_1730854_-	tyrosine recombinase XerC	NA	A0A142K7N4	Mycobacterium_phage	29.5	1.8e-14
WP_003726401.1|1731136_1732441_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_003727517.1|1732503_1734582_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	5.4e-107
WP_003727518.1|1734854_1735715_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003727519.1|1735848_1736634_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.6	6.7e-26
WP_003726396.1|1736630_1737494_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003727520.1|1737503_1738046_-	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003726394.1|1738147_1738717_-	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003726393.1|1738751_1739318_-	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003723886.1|1739436_1740696_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003723884.1|1740880_1742164_-	trigger factor	NA	NA	NA	NA	NA
WP_003727521.1|1742278_1743217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731300.1|1743478_1744144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003727523.1|1744159_1744693_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_052750972.1|1744975_1745197_-	hypothetical protein	NA	A8ATX1	Listeria_phage	89.7	1.4e-21
WP_052750971.1|1745193_1745427_-	hypothetical protein	NA	A8ATC5	Listeria_phage	87.0	1.1e-32
WP_003731544.1|1745736_1746102_+	hypothetical protein	NA	A8ATJ4	Listeria_phage	94.2	6.4e-56
WP_023559354.1|1746115_1746319_+	hypothetical protein	NA	A8ATJ3	Listeria_phage	95.5	2.6e-30
WP_046811238.1|1746346_1746568_+	helix-turn-helix transcriptional regulator	NA	A8ATJ2	Listeria_phage	97.3	9.3e-34
WP_003731541.1|1746629_1747463_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1S7FZ94	Listeria_phage	43.8	2.5e-47
WP_031648624.1|1747465_1747720_-|holin	phage holin	holin	A8ATJ0	Listeria_phage	95.2	9.4e-38
WP_031648623.1|1747730_1747946_-	LysM peptidoglycan-binding domain-containing protein	NA	A8ATI9	Listeria_phage	93.0	1.8e-26
WP_003731538.1|1747965_1748412_-	hypothetical protein	NA	A8ATI8	Listeria_phage	95.9	1.7e-63
WP_003731537.1|1748387_1748834_-	hypothetical protein	NA	A8ATI7	Listeria_phage	97.3	9.3e-73
WP_003731536.1|1749019_1749361_-	hypothetical protein	NA	A8ATI5	Listeria_phage	93.5	1.5e-43
WP_003731535.1|1749366_1750095_-	hypothetical protein	NA	A8ATI4	Listeria_phage	93.4	2.7e-130
WP_003731534.1|1750116_1750758_-	hypothetical protein	NA	A8ATI3	Listeria_phage	99.1	4.5e-113
WP_046811237.1|1750747_1751899_-|plate	baseplate J/gp47 family protein	plate	A8ATI2	Listeria_phage	77.0	2.4e-165
WP_003731532.1|1751891_1752254_-	DUF2634 domain-containing protein	NA	A8ATI1	Listeria_phage	70.0	2.0e-41
WP_046811236.1|1752250_1752589_-	hypothetical protein	NA	A8ATI0	Listeria_phage	86.6	9.2e-49
WP_046811279.1|1752589_1753396_-	hypothetical protein	NA	A8ATH9	Listeria_phage	86.9	6.1e-131
WP_003731529.1|1753401_1753773_-	hypothetical protein	NA	A8ATH8	Listeria_phage	77.0	5.4e-50
WP_046811235.1|1753772_1754321_-	LysM peptidoglycan-binding domain-containing protein	NA	A8ATH7	Listeria_phage	84.5	7.1e-83
WP_046811234.1|1754326_1759357_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	74.6	0.0e+00
WP_031642248.1|1759358_1759571_-	hypothetical protein	NA	A8ATH5	Listeria_phage	91.4	1.9e-28
WP_049961612.1|1759533_1759890_-	hypothetical protein	NA	A8ATH4	Listeria_phage	97.5	2.3e-58
WP_049961613.1|1759942_1760341_-	hypothetical protein	NA	A8ATH3	Listeria_phage	99.2	4.0e-67
WP_046811233.1|1760357_1761353_-	DUF3383 family protein	NA	A8ATH2	Listeria_phage	99.4	3.5e-181
WP_031648613.1|1761357_1761840_-	hypothetical protein	NA	A8ATH1	Listeria_phage	96.9	1.1e-82
WP_046811232.1|1761829_1762204_-	hypothetical protein	NA	A8ATH0	Listeria_phage	95.2	8.0e-62
WP_031648611.1|1762203_1762803_-	hypothetical protein	NA	A8ATG9	Listeria_phage	98.5	3.7e-109
WP_031648610.1|1762802_1763138_-	DUF4054 domain-containing protein	NA	A8ATG8	Listeria_phage	99.1	3.6e-53
WP_039378284.1|1763149_1763536_-	hypothetical protein	NA	A8ATG7	Listeria_phage	98.4	2.1e-65
WP_046811231.1|1763558_1764464_-	DUF2184 domain-containing protein	NA	A8ATG6	Listeria_phage	97.0	9.7e-162
WP_046811230.1|1764484_1764934_-	hypothetical protein	NA	A8ATG5	Listeria_phage	98.0	1.0e-74
WP_039378288.1|1764933_1766043_-	DUF2213 domain-containing protein	NA	A8ATG4	Listeria_phage	99.5	9.4e-175
WP_046811229.1|1766258_1767668_-|head	phage head morphogenesis protein	head	A8ATG2	Listeria_phage	98.9	5.6e-265
WP_046811228.1|1767660_1769046_-	DUF1073 domain-containing protein	NA	A8ATG1	Listeria_phage	98.0	9.7e-262
WP_046811227.1|1769059_1770520_-|terminase	phage terminase large subunit	terminase	A8ATG0	Listeria_phage	95.1	1.0e-277
WP_046811226.1|1770497_1771382_-	hypothetical protein	NA	A8ATF9	Listeria_phage	92.9	2.2e-126
WP_003731509.1|1771423_1771711_-	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	55.4	9.9e-20
WP_003731508.1|1771748_1771979_-	hypothetical protein	NA	A8ATN7	Listeria_phage	98.7	3.7e-33
WP_003731507.1|1772108_1772306_-	hypothetical protein	NA	A8ATN6	Listeria_phage	100.0	5.2e-28
WP_046811225.1|1772353_1773691_-	chromosome partitioning protein ParB	NA	A8ATN5	Listeria_phage	94.8	7.2e-246
WP_046811224.1|1773763_1774240_-	hypothetical protein	NA	A0A1P8BMT7	Lactococcus_phage	30.2	5.5e-07
WP_046811222.1|1774553_1775321_-	Rha family transcriptional regulator	NA	A8ATN0	Listeria_phage	98.4	9.8e-139
WP_003731502.1|1775333_1775756_-	hypothetical protein	NA	A8ATM9	Listeria_phage	100.0	6.3e-71
WP_046811221.1|1775836_1776397_-	phage protein	NA	A8ATM8	Listeria_phage	95.7	4.5e-101
WP_046811220.1|1776408_1776663_-	DUF3850 domain-containing protein	NA	A8ATM7	Listeria_phage	82.5	5.9e-32
WP_046811219.1|1776655_1776856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046811218.1|1776852_1777185_-	hypothetical protein	NA	A8ATZ5	Listeria_phage	93.1	4.5e-08
WP_003731497.1|1777184_1777373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731496.1|1777391_1777775_-	preprotein translocase subunit YajC	NA	A8ATZ3	Listeria_phage	88.2	2.4e-53
WP_046811217.1|1777915_1778170_-	hypothetical protein	NA	A0A059T6G3	Listeria_phage	74.4	7.4e-27
WP_046811216.1|1778166_1778544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046811215.1|1778560_1779922_-	hypothetical protein	NA	A8ATM0	Listeria_phage	94.7	2.4e-249
WP_046811214.1|1779918_1780341_-	hypothetical protein	NA	A8ATL9	Listeria_phage	88.6	6.1e-50
WP_046811213.1|1780493_1780874_-	hypothetical protein	NA	A8ATL7	Listeria_phage	95.2	1.6e-65
WP_046811212.1|1780914_1781535_-	hypothetical protein	NA	A8ATL6	Listeria_phage	98.1	6.1e-107
WP_046811211.1|1781554_1781992_-	RusA family crossover junction endodeoxyribonuclease	NA	A8ATL5	Listeria_phage	91.0	8.5e-71
WP_046811210.1|1781972_1782212_-	hypothetical protein	NA	A8ATL4	Listeria_phage	98.6	3.6e-31
WP_046811277.1|1782168_1782390_-	hypothetical protein	NA	A8ATL3	Listeria_phage	85.3	1.2e-28
WP_041918379.1|1782376_1782577_-	hypothetical protein	NA	A8ATL2	Listeria_phage	89.4	4.0e-28
WP_031648583.1|1782573_1783389_-	ATP-binding protein	NA	A8ATL1	Listeria_phage	99.3	4.1e-143
WP_003731482.1|1783312_1784230_-	DUF4373 domain-containing protein	NA	A8ATL0	Listeria_phage	100.0	2.2e-169
WP_046811209.1|1784241_1784937_-	MBL fold metallo-hydrolase	NA	A8ATK9	Listeria_phage	97.4	4.3e-125
WP_046811208.1|1784936_1785668_-	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	61.4	6.0e-77
WP_046811207.1|1785671_1787615_-	AAA family ATPase	NA	A8ATK7	Listeria_phage	98.3	0.0e+00
WP_046811206.1|1787601_1787943_-	hypothetical protein	NA	A8ATK6	Listeria_phage	51.3	6.7e-23
WP_046811205.1|1787960_1788188_-	hypothetical protein	NA	A8ATK5	Listeria_phage	98.7	5.2e-32
WP_046811204.1|1788365_1788650_-	hypothetical protein	NA	A8ATK4	Listeria_phage	54.2	9.2e-26
WP_046811203.1|1789128_1789653_-	hypothetical protein	NA	A8ATK1	Listeria_phage	90.8	6.6e-86
WP_046811202.1|1789729_1789915_-	helix-turn-helix transcriptional regulator	NA	A8ATK0	Listeria_phage	100.0	5.8e-29
WP_046811201.1|1790073_1790502_+	helix-turn-helix transcriptional regulator	NA	A8ATJ9	Listeria_phage	99.3	2.0e-72
WP_046811200.1|1790518_1790938_+	ImmA/IrrE family metallo-endopeptidase	NA	A8ATJ8	Listeria_phage	98.6	3.4e-77
WP_046811199.1|1790984_1791377_+	hypothetical protein	NA	A8ATJ7	Listeria_phage	94.6	2.6e-55
WP_046811198.1|1791466_1792882_+	recombinase family protein	NA	A0A1L2JY12	Aeribacillus_phage	47.1	3.0e-117
WP_003723563.1|1793198_1793594_+	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003734523.1|1793673_1794813_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003726720.1|1794959_1795790_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	3.6e-46
WP_023550483.1|1795773_1797021_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	7.2e-107
WP_031644533.1|1797046_1797961_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003726717.1|1798149_1798614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003726723.1|1798652_1799114_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003727531.1|1799231_1800716_+	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_014929571.1|1800734_1802381_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003726055.1|1802411_1803125_-	trehalose operon repressor	NA	NA	NA	NA	NA
WP_003726054.1|1803742_1804591_+	YitT family protein	NA	NA	NA	NA	NA
WP_003726053.1|1804657_1804852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003726052.1|1804891_1805551_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003726051.1|1805755_1806961_+	MFS transporter	NA	NA	NA	NA	NA
WP_003726050.1|1806957_1807203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727535.1|1807240_1807717_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003726048.1|1807884_1808148_-	DUF3116 domain-containing protein	NA	NA	NA	NA	NA
WP_023550481.1|1808172_1809585_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	4.9e-51
WP_009928848.1|1809708_1809969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003726045.1|1810000_1810600_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	1.3e-29
WP_003726044.1|1810764_1811172_+	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_003726043.1|1811308_1811902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003726042.1|1811944_1813303_-	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_046811197.1|1813425_1817556_-	LapB repeat-containing protein	NA	NA	NA	NA	NA
1818022:1818045	attL	ATAAAAAAATCTCTAAAACATTCA	NA	NA	NA	NA
WP_009928186.1|1818224_1818587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726037.1|1818692_1819166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031672409.1|1819858_1820050_-	hypothetical protein	NA	A8ATC6	Listeria_phage	98.4	1.7e-28
WP_014930932.1|1820046_1820280_-	hypothetical protein	NA	A8ATX0	Listeria_phage	94.8	2.3e-35
WP_025370597.1|1820758_1821460_-	DUF3800 domain-containing protein	NA	R4IBV1	Listeria_phage	97.8	6.4e-129
WP_025370596.1|1821607_1822315_-	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	97.9	1.0e-129
WP_003723294.1|1822314_1822596_-|holin	phage holin	holin	A8ATW3	Listeria_phage	100.0	3.0e-45
WP_003733957.1|1822595_1822901_-	hypothetical protein	NA	A0A059T5E6	Listeria_phage	100.0	1.8e-43
WP_046811196.1|1822951_1824043_-	hypothetical protein	NA	A0A059T7R4	Listeria_phage	91.8	1.7e-189
WP_026749927.1|1824032_1826327_-	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	99.2	0.0e+00
WP_153648966.1|1826339_1827989_-|tail	phage tail protein	tail	A0A059T682	Listeria_phage	98.7	0.0e+00
WP_153648967.1|1827981_1832901_-|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	97.1	0.0e+00
WP_046811195.1|1833116_1833449_-	hypothetical protein	NA	A0A059T7R2	Listeria_phage	96.4	1.5e-51
WP_014929552.1|1833519_1834107_-|tail	phage tail protein	tail	A0A059T7Y4	Listeria_phage	98.5	2.9e-106
WP_046811194.1|1834127_1834511_-	hypothetical protein	NA	A0A059T681	Listeria_phage	98.4	1.1e-66
WP_012951550.1|1834507_1834909_-	hypothetical protein	NA	A0A059T5F3	Listeria_phage	100.0	2.1e-68
WP_014929549.1|1834905_1835271_-	hypothetical protein	NA	A0A059T6F2	Listeria_phage	100.0	2.9e-64
WP_014930914.1|1835254_1835554_-	hypothetical protein	NA	A0A059T7R0	Listeria_phage	100.0	5.3e-48
WP_014930913.1|1835740_1836892_-|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	100.0	6.3e-214
WP_046811193.1|1836918_1837716_-|protease	Clp protease ClpP	protease	A0A059T5F2	Listeria_phage	99.6	1.1e-143
WP_023548926.1|1837712_1838843_-|portal	phage portal protein	portal	A8AT96	Listeria_phage	93.1	1.7e-203
WP_109217207.1|1838854_1840498_-|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	98.2	0.0e+00
WP_014929542.1|1840494_1840851_-	hypothetical protein	NA	A0A059T7Y1	Listeria_phage	97.0	4.5e-46
WP_009928009.1|1840899_1841214_-	HNH endonuclease	NA	A8ATF8	Listeria_phage	99.0	3.8e-57
WP_009917711.1|1841574_1842318_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_009917712.1|1842415_1842841_-	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	100.0	8.0e-74
WP_003731655.1|1842853_1843081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731657.1|1843325_1843595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046811274.1|1843591_1844125_-	DUF3310 domain-containing protein	NA	A0A059T7T5	Listeria_phage	82.5	1.1e-80
WP_039389924.1|1844235_1844505_-	hypothetical protein	NA	W0GBM0	Listeria_phage	73.6	5.3e-15
WP_046811192.1|1844501_1844822_-	VRR-NUC domain-containing protein	NA	W0G8N0	Listeria_phage	95.3	5.8e-53
WP_046811191.1|1845114_1847388_-	DNA primase	NA	A8ATF3	Listeria_phage	94.7	0.0e+00
WP_015987323.1|1847410_1847893_-	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	100.0	4.9e-88
WP_109217206.1|1847915_1849172_-	DEAD/DEAH box helicase	NA	R4IBK4	Listeria_phage	97.0	9.5e-224
WP_023553843.1|1849235_1849925_-	AAA family ATPase	NA	R4IDY8	Listeria_phage	98.3	4.8e-129
WP_003731665.1|1849944_1850424_-	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	76.7	7.6e-57
WP_012951535.1|1850425_1850809_-	hypothetical protein	NA	A8ATE8	Listeria_phage	92.9	5.3e-61
WP_003731670.1|1851312_1851579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731671.1|1851568_1851799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731672.1|1851795_1852029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951531.1|1852047_1852677_-	hypothetical protein	NA	A0A191KBJ8	Streptococcus_virus	58.4	1.1e-66
WP_012951530.1|1852677_1853157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046811189.1|1853709_1854423_-	pentapeptide repeat-containing protein	NA	A8ATE4	Listeria_phage	89.0	1.9e-35
WP_046811284.1|1854596_1855001_-	hypothetical protein	NA	R4ICD6	Listeria_phage	66.4	1.2e-42
WP_031643753.1|1854987_1855194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023548959.1|1855355_1855544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023548961.1|1855536_1856112_-	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	42.9	1.0e-31
WP_009928035.1|1856108_1856789_-	hypothetical protein	NA	A8ATD7	Listeria_phage	96.5	1.1e-120
WP_023548963.1|1856801_1857746_-|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	99.0	2.7e-178
WP_023548965.1|1857756_1858470_-	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	98.3	5.4e-131
WP_023548967.1|1858993_1859179_-	hypothetical protein	NA	A0A059T7Z3	Listeria_phage	98.4	4.4e-29
WP_015987310.1|1859181_1859424_-	hypothetical protein	NA	A8ATD2	Listeria_phage	100.0	1.4e-43
WP_009929536.1|1859425_1859629_-	helix-turn-helix transcriptional regulator	NA	A0A059T5F8	Listeria_phage	100.0	3.1e-28
WP_025370565.1|1859694_1860012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046811187.1|1860472_1860796_+	helix-turn-helix transcriptional regulator	NA	Q8W5Y0	Listeria_phage	72.0	1.2e-37
WP_052750973.1|1860812_1861265_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	84.0	2.3e-71
WP_012951517.1|1861316_1861973_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_046811186.1|1862118_1863273_+|integrase	site-specific integrase	integrase	A0A059T688	Listeria_phage	97.7	2.8e-214
WP_003726034.1|1863558_1864083_-	metallophosphoesterase	NA	NA	NA	NA	NA
1863291:1863314	attR	ATAAAAAAATCTCTAAAACATTCA	NA	NA	NA	NA
WP_009928777.1|1864119_1864731_-	XTP/dITP diphosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	28.0	8.7e-05
>prophage 5
NZ_CP045749	Listeria monocytogenes strain CFSAN008100 chromosome, complete genome	3042973	1984876	1992299	3042973		Hokovirus(33.33%)	8	NA	NA
WP_023550418.1|1984876_1986433_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.2	6.0e-18
WP_009929871.1|1986561_1986966_-	PTS lactose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_009929872.1|1987026_1987335_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_023550416.1|1987347_1988172_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.2	1.3e-67
WP_003721509.1|1988183_1989674_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_026747136.1|1989882_1990896_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.2	1.8e-10
WP_003727002.1|1990910_1991894_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.8	2.0e-11
WP_003730941.1|1991915_1992299_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
>prophage 6
NZ_CP045749	Listeria monocytogenes strain CFSAN008100 chromosome, complete genome	3042973	2988546	2995073	3042973	tail	Streptococcus_pyogenes_phage(33.33%)	10	NA	NA
WP_003734720.1|2988546_2989365_-|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
WP_046811173.1|2989361_2991230_-	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	4.5e-20
WP_003740367.1|2991216_2991621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721745.1|2991662_2991965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721744.1|2992012_2992525_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003728212.1|2992537_2992927_-	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
WP_003731177.1|2993206_2993623_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	37.9	6.5e-20
WP_009927883.1|2993634_2994063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721740.1|2994279_2994615_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003728215.1|2994620_2995073_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
>prophage 1
NZ_CP045750	Listeria monocytogenes strain CFSAN008100 plasmid pCFSAN008100, complete sequence	51115	40154	48999	51115	transposase	Streptococcus_phage(33.33%)	10	NA	NA
WP_003728521.1|40154_40538_-	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	53.4	2.2e-14
WP_003731676.1|40550_41213_-	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_003728462.1|41212_41539_-	hypothetical protein	NA	A0A2K9V3N4	Faecalibacterium_phage	40.8	3.2e-06
WP_003728463.1|41669_41921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728464.1|41981_42224_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003728465.1|42217_42559_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_003728466.1|42751_44887_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	64.5	1.6e-247
WP_003728467.1|44886_45246_-	Cd(II)-sensing metalloregulatory transcriptional repressor CadC	NA	E4ZFI8	Streptococcus_phage	50.0	3.1e-26
WP_003728468.1|45525_46080_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	53.4	7.0e-38
WP_003728469.1|46083_48999_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.7	1.9e-174
