The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043175	Bordetella holmesii strain F029 chromosome, complete genome	3696629	1095263	1202133	3696629	tRNA,transposase,protease	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095263_1096484_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096571_1097162_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097158_1097461_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097512_1098502_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098622_1099504_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099677_1100532_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100563_1101412_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101539_1102760_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102778_1103345_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103542_1104694_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104832_1105837_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1105993_1106965_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107043_1107832_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107903_1108140_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108148_1109060_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109103_1110975_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111135_1111933_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112164_1112539_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112615_1112939_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113022_1113295_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113309_1113765_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113886_1114723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114719_1116093_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116169_1117126_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117213_1118191_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118315_1119971_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120019_1120484_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120480_1120942_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121167_1122355_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122351_1123656_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123652_1125062_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125255_1126375_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126510_1127530_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127538_1130244_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130383_1131037_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131099_1131462_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132028_1133489_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133751_1134825_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134909_1136130_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137887_1139008_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138981_1140481_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140494_1141598_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141602_1142853_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142849_1144295_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144291_1144606_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144607_1145726_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145908_1147129_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147228_1148095_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148155_1149136_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149282_1150203_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150211_1151324_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151405_1152227_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152302_1152911_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153048_1154425_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154486_1154930_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1154996_1155653_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155695_1156815_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156984_1157266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157976_1158765_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158761_1159868_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160542_1161901_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162015_1162213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162230_1163351_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163444_1163999_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164586_1165903_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165915_1166929_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167475_1168426_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168505_1168805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170165_1171824_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171972_1173193_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173310_1174594_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174597_1175539_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175648_1176107_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_110115129.1|1176487_1177189_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177596_1180017_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180124_1180862_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180908_1182153_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182475_1182748_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183331_1184060_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184081_1184999_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184998_1185508_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185624_1186296_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186405_1187473_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187492_1189337_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189473_1190661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190961_1191747_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191770_1192890_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192994_1194332_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194441_1195383_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195438_1196620_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196778_1197069_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197115_1197784_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197780_1198068_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198444_1199230_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199262_1199997_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200912_1202133_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043175	Bordetella holmesii strain F029 chromosome, complete genome	3696629	1206920	1263326	3696629	tRNA,transposase,protease	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1206920_1207871_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207952_1208432_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209643_1210843_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210988_1211366_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211389_1213171_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213179_1213917_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214201_1215761_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215820_1216579_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216675_1217332_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217485_1218250_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218264_1218444_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218469_1219504_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219500_1219914_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219910_1220495_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220847_1222206_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222299_1222878_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1223002_1224123_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224195_1225452_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225555_1226761_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226824_1227274_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227406_1227652_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227876_1228191_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233444_1235550_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235603_1237913_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239266_1240934_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240936_1241602_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241734_1245541_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245766_1246912_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1247030_1247960_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247956_1249033_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1249029_1249836_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249832_1250564_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250940_1252179_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252226_1252565_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252812_1253763_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254081_1254264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254329_1255550_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255643_1256864_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256923_1257187_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257308_1258808_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1258855_1259131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259228_1259426_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259441_1259801_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259873_1260896_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260908_1263326_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043175	Bordetella holmesii strain F029 chromosome, complete genome	3696629	1651697	1692077	3696629	tRNA,transposase,integrase	Leptospira_phage(28.57%)	39	1644139:1644155	1688756:1688772
1644139:1644155	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|1651697_1652817_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1653469_1654225_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1654401_1655196_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1655192_1655630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1655741_1655894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1656314_1657283_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1657439_1658447_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1658504_1658963_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1659036_1660383_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1660400_1660772_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1660771_1662241_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1662396_1663122_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1663135_1665850_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1666101_1667466_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1667505_1668564_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1668591_1669410_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1669447_1669726_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1670989_1671289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1671858_1673262_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1673274_1673925_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1674066_1675287_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1675317_1676394_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1676540_1677671_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1677857_1679483_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1679489_1680305_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1680319_1681390_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1681441_1682101_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1682740_1683903_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1683944_1684259_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1684242_1684629_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1684667_1684934_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1685326_1686016_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1686115_1686277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1686427_1686592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1686718_1686955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1687144_1687393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1687506_1688877_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1688756:1688772	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1688877_1689618_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1690124_1692077_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 5
NZ_CP043175	Bordetella holmesii strain F029 chromosome, complete genome	3696629	1710371	1754298	3696629	holin,tRNA,transposase,integrase	Leptospira_phage(33.33%)	37	1752866:1752880	1759342:1759356
WP_005019367.1|1710371_1713233_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1713222_1714188_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1714944_1716420_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1716424_1716700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1717036_1718156_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1718030_1718279_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1718457_1719666_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1719662_1721945_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1721955_1724337_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1724600_1726508_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1726522_1727413_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1727419_1728553_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1728552_1729374_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1729398_1730589_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1730890_1731172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1731337_1731658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1731697_1732784_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1732980_1733241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1733733_1734504_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1734500_1735511_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1735545_1736388_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1736850_1737636_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1738495_1739615_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1740681_1741686_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1741761_1742574_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1742801_1744973_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1745026_1746346_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1746434_1747655_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1747873_1748734_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1748730_1749954_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1750252_1750750_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1750788_1751571_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1751596_1751815_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1751889_1752159_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1752378_1752843_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1752866:1752880	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1752916_1753198_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1753314_1754298_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1759342:1759356	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP043175	Bordetella holmesii strain F029 chromosome, complete genome	3696629	1779574	1820965	3696629	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1779574_1780525_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1780521_1781037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1781394_1782015_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1782114_1782366_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1782453_1783932_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1783928_1787099_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1787111_1788308_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1788496_1789429_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1789497_1790229_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1790294_1790930_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1790915_1792094_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1792254_1792803_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1792883_1793243_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1793290_1794511_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1794586_1795708_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1795745_1796459_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1796469_1797690_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1797772_1798327_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1798472_1799423_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1799382_1799544_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1799584_1800511_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1800524_1801397_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1801559_1802507_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1802845_1803427_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804004_1804955_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1804934_1805687_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1805699_1806431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1806587_1808753_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1808842_1809112_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1809200_1809407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1809405_1809924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1809942_1810722_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1810889_1811906_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1811978_1812470_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1812480_1814196_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1815359_1816310_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1817961_1819203_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1819214_1819988_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1820014_1820965_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043175	Bordetella holmesii strain F029 chromosome, complete genome	3696629	2149178	2209301	3696629	tRNA,transposase,protease	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2149178_2149667_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2149659_2150508_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2150599_2151097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2151234_2151594_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2151590_2151872_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2151871_2152354_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2152355_2153984_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2153980_2154325_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2154326_2157269_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2157714_2158686_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2158675_2160058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2160200_2161151_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2161110_2162352_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2162348_2163470_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2164961_2165429_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2165499_2166150_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2166236_2167376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2167544_2168549_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2168545_2169793_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2170145_2171012_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2170971_2172576_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2172587_2173274_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2173270_2174311_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2174426_2175098_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2175094_2176087_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2176083_2177022_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2177018_2178173_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2178181_2179633_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2179663_2180146_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2180147_2181041_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2181037_2181481_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2181493_2181868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2182010_2182409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2182535_2182823_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2182819_2183236_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2183411_2184044_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2184072_2184519_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2184805_2185957_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2186070_2187075_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2188058_2188766_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2188698_2190150_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2190155_2193314_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2193326_2193848_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2193837_2194662_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2194658_2195258_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2195366_2197223_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2197371_2198376_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2198584_2199847_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2199851_2200187_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2200183_2201113_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2201117_2201831_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2201934_2203392_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2203388_2203685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2203809_2205168_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2205268_2206069_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2206248_2207367_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2207439_2207811_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2207817_2208669_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2208689_2209301_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043175	Bordetella holmesii strain F029 chromosome, complete genome	3696629	2304424	2426984	3696629	protease,tRNA,transposase,integrase	Leptospira_phage(15.15%)	107	2335954:2336013	2357261:2357535
WP_101557807.1|2304424_2305587_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2305699_2306668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2306664_2307585_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2307681_2312160_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2312538_2316873_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2317511_2318075_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2318086_2318332_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2318487_2318997_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2319042_2320023_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2320234_2322586_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2322632_2323463_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2323459_2324149_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2324141_2325422_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2325519_2326458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2326439_2328146_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2328223_2329327_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2329379_2330129_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2330135_2331650_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005014513.1|2331662_2331950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2331970_2332858_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2333008_2333515_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2333511_2334468_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2334655_2336002_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2335954:2336013	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2335969_2336200_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2336229_2336793_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2336947_2337718_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2337714_2338725_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2339039_2339486_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2339541_2339736_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2339737_2340079_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2340088_2341951_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2341990_2342497_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2342500_2342824_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2342825_2343230_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2343266_2344478_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2344499_2345048_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2345272_2345764_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2345978_2348009_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2348083_2349286_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2349828_2350764_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2351797_2352079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2352165_2352339_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2352450_2352795_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2352866_2353535_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2354950_2355994_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2355990_2356092_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2356183_2357303_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2357553_2358207_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2357261:2357535	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2358322_2359543_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2359593_2362023_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2362188_2363487_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2363591_2364245_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2364247_2365558_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2365785_2366325_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2366803_2367070_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2367108_2367474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2367355_2368366_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2368362_2369133_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2369218_2369878_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2369845_2370337_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2370446_2370650_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2370967_2371288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2371271_2371607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2371661_2371874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2371949_2372288_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2372284_2372620_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2372682_2374254_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2375047_2375359_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2375551_2376672_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2376799_2376994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2383076_2384238_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2384623_2386087_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2386219_2387770_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2387766_2387916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2388081_2389202_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2390315_2391173_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2391225_2391723_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2391843_2393259_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2393268_2394453_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2394449_2396048_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2397230_2397476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2397886_2398072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2398227_2399139_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012067.1|2399152_2400103_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014721.1|2400309_2401152_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401354_2402728_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2403037_2404549_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404701_2405433_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405539_2406841_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406848_2407757_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407753_2408347_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408390_2408804_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408800_2409271_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409277_2409883_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411684_2413469_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413465_2414851_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414836_2415799_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415868_2416498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416535_2417744_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417865_2418435_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418566_2420120_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420423_2421644_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2422051_2422954_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422950_2423820_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423816_2424668_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424664_2425489_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425763_2426984_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043175	Bordetella holmesii strain F029 chromosome, complete genome	3696629	2626330	2673957	3696629	tRNA,transposase,protease	Bacillus_phage(25.0%)	47	NA	NA
WP_005015146.1|2626330_2627083_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005015148.1|2627125_2627845_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005015150.1|2627887_2628943_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_101557744.1|2629952_2631072_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015154.1|2631632_2632211_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_005012861.1|2632353_2633574_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005015155.1|2633878_2634856_+	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_005015156.1|2635004_2635835_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015157.1|2635948_2636764_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015162.1|2636786_2637641_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015163.1|2637639_2638023_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005015164.1|2638129_2639503_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
WP_005019837.1|2639574_2640066_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_005015166.1|2640065_2640818_-	membrane protein	NA	NA	NA	NA	NA
WP_005015167.1|2641165_2641369_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_005015168.1|2641398_2641821_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_005015169.1|2641832_2642930_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005015170.1|2642942_2644412_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_005015171.1|2644533_2645373_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
WP_005019846.1|2645394_2646252_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_005015173.1|2646324_2647443_-	porin	NA	NA	NA	NA	NA
WP_005015175.1|2647429_2648044_-	magnesium transporting ATPase P-type 1	NA	NA	NA	NA	NA
WP_101557744.1|2648073_2649194_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015176.1|2649237_2649867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015177.1|2650024_2651368_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005015178.1|2651376_2651760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015179.1|2651919_2653071_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_110115124.1|2653169_2654120_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015181.1|2654263_2655289_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005015182.1|2655329_2655569_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_005019849.1|2655634_2657224_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	4.3e-64
WP_005015184.1|2657223_2657769_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A088FT24	Mycobacterium_phage	30.8	3.5e-05
WP_005015187.1|2657852_2658425_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005019851.1|2658428_2659196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015190.1|2659227_2659563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015191.1|2659486_2660554_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.5	2.1e-06
WP_005015192.1|2660550_2662371_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.9	8.7e-77
WP_005015193.1|2662486_2663695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015194.1|2663928_2664630_+	response regulator	NA	W8CYM9	Bacillus_phage	36.6	2.8e-31
WP_005015195.1|2664642_2666121_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005015196.1|2666136_2667189_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005019853.1|2667185_2668523_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005015199.1|2668641_2670402_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	52.4	2.2e-170
WP_005015201.1|2670587_2671430_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_005015204.1|2671523_2672339_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_005015207.1|2672342_2672615_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005012365.1|2672736_2673957_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
>prophage 10
NZ_CP043175	Bordetella holmesii strain F029 chromosome, complete genome	3696629	2936443	3014454	3696629	protease,tRNA,transposase,integrase	Ralstonia_virus(23.08%)	55	2938670:2938729	3012130:3013329
WP_005019978.1|2936443_2937223_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937245_2938193_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938194_2938395_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
2938670:2938729	attL	TGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGCA	NA	NA	NA	NA
WP_005015714.1|2940172_2940889_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940885_2941779_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941942_2943163_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943315_2944398_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2946077_2947061_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947123_2948536_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948653_2949496_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949774_2950383_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950398_2951019_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951084_2951792_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951796_2952519_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952505_2952796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952871_2954092_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954816_2955668_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955719_2956973_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957149_2957938_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2958057_2958972_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959104_2960997_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961182_2962562_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2963006_2963303_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967103_2967706_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967839_2968298_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968299_2968899_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968907_2969717_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969751_2970606_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970725_2971313_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971309_2972689_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973193_2973340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2981011_2982352_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982365_2983217_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983228_2984494_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984555_2986460_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988435_2989290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015806.1|2989282_2990077_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990292_2991243_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991845_2992643_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992682_2993336_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993316_2994381_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994544_2996770_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015820.1|2998976_2999849_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999895_3001596_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001658_3002858_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002868_3003747_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003853_3004891_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004971_3005376_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005387_3006845_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007487_3008084_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008244_3008703_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009480_3010452_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010573_3010993_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012284_3013505_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
3012130:3013329	attR	TGCCATTCCTTTGGGAACGGACTCTACATCGATTTCGTACTAATCACGGGGAGCAGGTCAACCCAATTTTTATGGTTCATCGCGGAATAGCGTGGAGCCGTGCTTGATTGCCGTTACGCTTGATCCTTGATTTTTCAAGGATCAAGGCCGGGATCATGCTGGACCGCAAGACGATCGAGAGGTTGGGTGGGTGGGAAGGTTATCGGGTGGAGTGGGTCGTGTGGCCTGAAGGTGAGAGCCGGACGGTCACGATTTACCTGAAGCCTTCAGCGCGAACGATGCACTGCGAGCACTGCGGCAACCGATGTCGGCAGGTGCATGAGACGACCACGCGCCGGGTGCGGGATCTGCCGCTAATGGCGCTGCGAGTGACGCTGGTAGTGCCGCGTCGGCGGGTCTGGTGCGAGCAGTGCGGTGGACCGCATCTGGAGAGGCTGAGCTGGCTGGGCCGTTACCAGCGAGTGACCGACCGGCTGGCCGAGGCGGTCAGCCAGTTGCTTGAGTCCAGCAACATTCTGGCCGTGGCGCGCTTCTTCCAACTGGGTTGGCACACGGTCAAGGCGCTGGACAAGGCCCTGCTGCGACGGGCGATCCAAGAGCCGGACTGGAGCCAGATCCACTACCTAGCGATGGACGAGTTCGCTCTACACAAGGGCCATCGTTATGCCACGGTCGTTGTCGATCCGATCCGCCGTCAGGTGCTATGGATCGGTGATGGCCGCTCGCGCGAGACGGCCAGAGCCTTCTTCGAACAACTGCCAACAGGAGTTGCCCAGCAGATCCGGGCCGTAGCGATCGACATGACGACGGCCTATGAGCTGGAGATCCAGGCCAACTGCCCCAACGCCGAGATCGTCTACGACCTGTTCCACGTCGTGGCCAAGTACGGCCGTGAAGTGATAGACCGGGTGCGTGTAGACCAAGCGAACCAGTTGCGGCACGACAAGCCGGCCCGCCGGGTGATCAAGTCCAGTCGCTGGCTACTGCTGCGCAATCGCAAAAACCTCGATCCGTGCCAATCGGTAAAGTTGGACGAGTTGCTCCAGGCCAACCAGCCCTTGCTCACCGCTTATCTGATGCGCGATGAGCTCAAACAGCTGTGGTTCTACCAACACCCCGGCTACGCCCGCCAGGCATGGGATCACTGGCTGCAACAGGCTCAGGGCAGCGGCATCGCCGCCTTGGCTCACTTCGCGCTCA	NA	NA	NA	NA
WP_005020040.1|3013566_3014454_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
