The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043173	Bordetella holmesii strain F586 chromosome, complete genome	3696928	1096760	1203549	3696928	tRNA,transposase,protease	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1096760_1097981_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1098068_1098659_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1098655_1098958_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1099009_1099999_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1100119_1101001_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1101174_1102029_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1102060_1102909_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1103036_1104257_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1104275_1104842_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1105039_1106191_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1106329_1107334_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1107490_1108462_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1108540_1109329_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1109400_1109637_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1109645_1110557_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1110600_1112472_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1112632_1113430_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1113661_1114036_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1114112_1114436_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1114519_1114792_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1114806_1115262_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1115383_1116220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1116216_1117590_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1117666_1118623_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1118710_1119688_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_032966621.1|1119812_1121468_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	2.7e-69
WP_005012657.1|1121516_1121981_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1121977_1122439_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1122664_1123852_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1123848_1125153_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1125149_1126559_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1126752_1127872_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1128007_1129027_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1129035_1131741_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1131880_1132534_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1132596_1132959_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1133525_1134986_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1135248_1136322_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1136406_1137627_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1139384_1140505_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1140478_1141978_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1141991_1143095_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1143099_1144350_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1144346_1145792_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1145788_1146103_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1146104_1147223_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1147405_1148626_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1148725_1149592_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1149652_1150633_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1150779_1151700_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1151708_1152821_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1152902_1153724_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1153799_1154408_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1154545_1155922_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1155983_1156427_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1156493_1157150_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1157192_1158312_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1158481_1158763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1159473_1160262_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1160258_1161365_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1162039_1163398_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1163512_1163710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1163727_1164848_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1164941_1165496_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1166083_1167400_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1167412_1168426_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1168972_1169923_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1170002_1170302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153567326.1|1171662_1173321_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1173469_1174690_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1174807_1176091_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1176094_1177036_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1177145_1177604_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1177984_1178605_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1179012_1181433_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1181540_1182278_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1182324_1183569_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1183891_1184164_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1184747_1185476_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1185497_1186415_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1186414_1186924_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1187040_1187712_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1187821_1188889_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1188908_1190753_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1190889_1192077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1192377_1193163_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1193186_1194306_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1194410_1195748_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1195857_1196799_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1196854_1198036_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1198194_1198485_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1198531_1199200_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1199196_1199484_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1199860_1200646_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1200678_1201413_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1202328_1203549_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043173	Bordetella holmesii strain F586 chromosome, complete genome	3696928	1208336	1264742	3696928	tRNA,transposase,protease	Ralstonia_virus(23.08%)	44	NA	NA
WP_005012808.1|1208336_1209287_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1209368_1209848_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1211059_1212259_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1212404_1212782_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1212805_1214587_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1214595_1215333_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1215617_1217177_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1217236_1217995_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1218091_1218748_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1218901_1219666_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1219680_1219860_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1219885_1220920_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1220916_1221330_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1221326_1221911_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1222263_1223622_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1223715_1224294_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1224418_1225539_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1225611_1226868_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1226971_1228177_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1228240_1228690_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1228822_1229068_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1229292_1229607_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1234860_1236966_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1237019_1239329_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1240682_1242350_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1242352_1243018_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1243150_1246957_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1247182_1248328_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1248446_1249376_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1249372_1250449_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1250445_1251252_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1251248_1251980_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1252356_1253595_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1253642_1253981_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1254228_1255179_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1255497_1255680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153567328.1|1255745_1256966_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.6e-183
WP_005012861.1|1257059_1258280_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1258339_1258603_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1258724_1260224_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012868.1|1260644_1260842_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1260857_1261217_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1261289_1262312_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1262324_1264742_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043173	Bordetella holmesii strain F586 chromosome, complete genome	3696928	1367368	1395043	3696928	transposase	Ralstonia_virus(50.0%)	26	NA	NA
WP_005013747.1|1367368_1368319_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814010.1|1368345_1369119_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_003814009.1|1369130_1370372_+	MFS transporter	NA	NA	NA	NA	NA
WP_005012808.1|1372023_1372974_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814007.1|1374137_1375853_+	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005013744.1|1375863_1376355_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_005013742.1|1376427_1377444_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003814004.1|1377611_1378391_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013740.1|1378409_1378928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005019401.1|1378926_1379133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013738.1|1379221_1379491_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005013736.1|1379580_1381746_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005019399.1|1381902_1382634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013735.1|1382646_1383399_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005012808.1|1383378_1384329_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_026087954.1|1384906_1385488_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005013732.1|1385826_1386774_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013731.1|1386936_1387809_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013730.1|1387822_1388749_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013729.1|1388789_1388951_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013727.1|1388910_1389861_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013726.1|1390006_1390561_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005011985.1|1390643_1391864_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013724.1|1391874_1392588_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013723.1|1392625_1393747_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005011985.1|1393822_1395043_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 4
NZ_CP043173	Bordetella holmesii strain F586 chromosome, complete genome	3696928	1407808	1456636	3696928	integrase,transposase,holin	Leptospira_phage(30.0%)	44	1421106:1421165	1448706:1448784
WP_005012067.1|1407808_1408759_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013707.1|1408868_1410923_-	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013706.1|1411042_1411897_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.4e-29
WP_005013705.1|1411893_1412520_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013704.1|1412516_1414271_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_005013703.1|1414816_1417528_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_005013702.1|1417540_1419205_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_005013701.1|1419220_1420996_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
1421106:1421165	attL	CTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTTTCTG	NA	NA	NA	NA
WP_153566129.1|1421117_1421291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013700.1|1421409_1421622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013699.1|1421794_1422775_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013698.1|1422791_1423586_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_157933265.1|1423619_1424087_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013696.1|1424703_1425357_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005013695.1|1425438_1426374_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013694.1|1426635_1426782_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_005013693.1|1426872_1427274_+	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_005013692.1|1427349_1428234_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019382.1|1428326_1429031_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013691.1|1429069_1431151_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013690.1|1431283_1432195_-	phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
WP_005013689.1|1432259_1432691_-	TonB family protein	NA	NA	NA	NA	NA
WP_005013688.1|1432793_1433792_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_005013686.1|1434035_1435019_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005013685.1|1435135_1435417_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013684.1|1435490_1435955_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005019379.1|1436174_1436444_-	YunC family protein	NA	NA	NA	NA	NA
WP_005013682.1|1436518_1436737_+	SlyX family protein	NA	NA	NA	NA	NA
WP_005013681.1|1436762_1437545_+	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013680.1|1437583_1438081_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013679.1|1438379_1439603_+	MFS transporter	NA	NA	NA	NA	NA
WP_005013678.1|1439599_1440460_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1440678_1441899_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013677.1|1441987_1443307_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005013676.1|1443360_1445532_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013675.1|1445759_1446572_-	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005012353.1|1446647_1447652_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_101557815.1|1448717_1449838_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
1448706:1448784	attR	CTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTTTCTGATGAGCCTGCACGAATTGC	NA	NA	NA	NA
WP_005013673.1|1450697_1451483_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_005013672.1|1451945_1452788_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_025341421.1|1452822_1453833_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|1453829_1454600_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_005013671.1|1455092_1455353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1455548_1456636_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
>prophage 5
NZ_CP043173	Bordetella holmesii strain F586 chromosome, complete genome	3696928	1470054	1514740	3696928	integrase,tRNA,transposase	Leptospira_phage(22.22%)	47	1480017:1480076	1519524:1520094
WP_161992024.1|1470054_1470303_-|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_101557770.1|1470176_1471297_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013659.1|1471633_1471909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005019369.1|1471913_1473389_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013657.1|1474145_1475111_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005013656.1|1475100_1477962_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013655.1|1477964_1478480_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_005013654.1|1478540_1479752_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.4	2.2e-36
1480017:1480076	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_005019364.1|1480931_1481672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013652.1|1481764_1482235_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013651.1|1482253_1482958_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_005013650.1|1482970_1483513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013649.1|1483534_1484002_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005013648.1|1484111_1484744_+	DedA family protein	NA	NA	NA	NA	NA
WP_005013647.1|1484764_1485223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013645.1|1485264_1485714_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
WP_005013644.1|1486586_1487258_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
WP_005013643.1|1487254_1487896_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
WP_005013642.1|1487906_1488794_-	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
WP_005013641.1|1488962_1490126_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013640.1|1490194_1491172_-	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_005013639.1|1491291_1491714_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005013638.1|1491760_1491970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013637.1|1492017_1493793_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_005013636.1|1493821_1494091_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_005013635.1|1494153_1494552_-	PTS IIa component	NA	NA	NA	NA	NA
WP_005013634.1|1494565_1495522_-	glutathione synthase	NA	NA	NA	NA	NA
WP_076879490.1|1495687_1496236_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
WP_005013632.1|1496256_1498209_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
WP_005013631.1|1498709_1499450_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013629.1|1499450_1500821_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_005013628.1|1500934_1501183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1501372_1501609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1501735_1501900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013626.1|1502050_1502212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013625.1|1502311_1503001_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_101557809.1|1503393_1503660_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080687433.1|1503698_1504085_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157933264.1|1504068_1504383_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_101557807.1|1504424_1505586_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005013621.1|1506226_1506886_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_110097765.1|1506937_1508008_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005019353.1|1508022_1508838_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_005019351.1|1508844_1510470_-	membrane protein	NA	NA	NA	NA	NA
WP_005013618.1|1510656_1511787_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005013617.1|1511933_1513010_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013747.1|1513789_1514740_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
1519524:1520094	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCACCATGGTTACGCCGGCCCAACAGAGCTCGGCCAGGCGCTCGGCGTGGTGGCCCAAGGCGGCATGTGGATGGGTCGATCTCTGGTAGGCCGCCTGTTACGCACGGCCCGAAATCGCGCCGGCACACCCGCGGATTGGGGCCACGCTCTGTTGACCGCACGGGAAGACACCGTCGCGCGCCACGCCTCTGCCGGTCAATCCAACGCGCAGATCGCCGAACAGCTCGGCATTACCGAACGCACCGTCAAAGCGCATCTGTCCGCGGTCTTTGAGAAAGTCGGCGTGGCAGATCGCCTGCAGTTAGCGCTATTGGTCCATGGCGTCACACCCGCCAAAACCGGCCATTGACTCAACGGCACCGCACCTCAATCGCCTGCCGGATCCATCAACGGCGGGCCTGCTCGTACAAGGGCAAAACCCGCTCTGACGCCTGCTTCAGATCCGCGATGCGTGTGCTGGCCGAGGGATGCGTGGAGAGAAACTCCGGCGAGGCCTGTCCAGTCTGGGCCGCTG	NA	NA	NA	NA
>prophage 6
NZ_CP043173	Bordetella holmesii strain F586 chromosome, complete genome	3696928	1530929	1582529	3696928	transposase,tRNA	Leptospira_phage(20.0%)	52	NA	NA
WP_025341429.1|1530929_1531937_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005013598.1|1532093_1533062_+	homoserine kinase	NA	NA	NA	NA	NA
WP_153566127.1|1533482_1533635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013597.1|1533746_1534184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013596.1|1534180_1534975_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013595.1|1535151_1535907_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_101557770.1|1536558_1537679_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013592.1|1537722_1538346_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_005013591.1|1538342_1539704_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013590.1|1539703_1540459_-	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013589.1|1540523_1540928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1541152_1541692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013587.1|1541913_1543122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1543171_1544122_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013586.1|1544344_1544605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013585.1|1544866_1545274_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_032966147.1|1545270_1547610_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.2	2.6e-150
WP_005013583.1|1547615_1548740_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013582.1|1548787_1548919_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013581.1|1548933_1549629_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013580.1|1549872_1550406_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013579.1|1550441_1551989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013578.1|1551993_1553217_-	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013577.1|1553203_1553983_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005019317.1|1554013_1554952_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013573.1|1555070_1555793_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005013572.1|1555934_1556633_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013571.1|1556929_1557811_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013570.1|1557832_1558993_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013569.1|1559003_1559609_-	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|1559867_1561088_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013568.1|1561143_1563441_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005013567.1|1563580_1564501_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013566.1|1564507_1565059_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013565.1|1565104_1566166_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013564.1|1566506_1567202_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013563.1|1567173_1568697_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_017685641.1|1568932_1570558_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013561.1|1571031_1571250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013559.1|1571401_1572301_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013558.1|1572417_1573710_-	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013556.1|1573800_1574175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013555.1|1574184_1574682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1574711_1574843_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013552.1|1575101_1575437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1576058_1577558_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013550.1|1577664_1577910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013549.1|1577970_1578342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080601033.1|1578346_1579090_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_101557831.1|1579090_1580211_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_101557920.1|1580378_1581460_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_025341421.1|1581518_1582529_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
>prophage 7
NZ_CP043173	Bordetella holmesii strain F586 chromosome, complete genome	3696928	2150588	2210711	3696928	transposase,tRNA,protease	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150588_2151077_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2151069_2151918_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2152009_2152507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152644_2153004_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2153000_2153282_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2153281_2153764_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153765_2155394_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2155390_2155735_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155736_2158679_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2159124_2160096_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2160085_2161468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161610_2162561_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162520_2163762_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163758_2164880_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2166371_2166839_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166909_2167560_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167646_2168786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168954_2169959_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169955_2171203_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171555_2172422_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2172381_2173986_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173997_2174684_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174680_2175721_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175836_2176508_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2176504_2177497_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177493_2178432_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2178428_2179583_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179591_2181043_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2181073_2181556_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181557_2182451_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2182447_2182891_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182903_2183278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2183420_2183819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183945_2184233_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2184229_2184646_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184821_2185454_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185482_2185929_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2186215_2187367_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187480_2188485_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189468_2190176_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2190108_2191560_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191565_2194724_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194736_2195258_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2195247_2196072_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2196068_2196668_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196776_2198633_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198781_2199786_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199994_2201257_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2201261_2201597_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201593_2202523_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202527_2203241_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2203344_2204802_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204798_2205095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2205219_2206578_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206678_2207479_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207658_2208777_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208849_2209221_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2209227_2210079_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2210099_2210711_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043173	Bordetella holmesii strain F586 chromosome, complete genome	3696928	2305834	2427345	3696928	integrase,tRNA,transposase,protease	Leptospira_phage(15.15%)	106	2337364:2337423	2358671:2358945
WP_101557807.1|2305834_2306997_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2307109_2308078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2308074_2308995_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2309091_2313570_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313948_2318283_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318921_2319485_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319496_2319742_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319897_2320407_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320452_2321433_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321644_2323996_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2324042_2324873_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324869_2325559_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325551_2326832_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326929_2327868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327849_2329556_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329633_2330737_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330789_2331539_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331545_2333060_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005014513.1|2333072_2333360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2333380_2334268_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2334418_2334925_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334921_2335878_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2336065_2337412_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2337364:2337423	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2337379_2337610_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337639_2338203_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2338357_2339128_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_153567329.1|2339124_2340135_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.6	9.7e-78
WP_076879495.1|2340449_2340896_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340951_2341146_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2341147_2341489_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341498_2343361_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2343400_2343907_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343910_2344234_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2344235_2344640_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344676_2345888_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345909_2346458_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346682_2347174_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2347388_2349419_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349493_2350696_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2351238_2352174_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2353207_2353489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353575_2353749_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353860_2354205_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2354276_2354945_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2356360_2357404_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2357400_2357502_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357593_2358713_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358963_2359617_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358671:2358945	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359732_2360953_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2361003_2363433_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363598_2364897_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2365001_2365655_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365657_2366968_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2367195_2367735_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2368213_2368480_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368518_2368884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368765_2369776_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_032968029.1|2369772_2370543_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_050427733.1|2370628_2371288_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2371255_2371747_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371856_2372060_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2372377_2372698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372681_2373017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2373071_2373284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2373359_2373698_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2373694_2374030_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2374092_2375664_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376457_2376769_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376961_2378082_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2378209_2378404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384486_2385648_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2386033_2387497_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387629_2389180_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2389176_2389326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389491_2390612_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391725_2392583_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392635_2393133_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2393253_2394669_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394678_2395863_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395859_2397458_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398640_2398886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2399296_2399482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399637_2400549_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400670_2401513_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401715_2403089_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2403398_2404910_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2405062_2405794_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405900_2407202_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2407209_2408118_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2408114_2408708_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408751_2409165_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2409161_2409632_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409638_2410244_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2412045_2413830_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413826_2415212_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2415197_2416160_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2416229_2416859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416896_2418105_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2418226_2418796_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418927_2420481_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420784_2422005_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2422412_2423315_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2423311_2424181_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2424177_2425029_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2425025_2425850_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2426124_2427345_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043173	Bordetella holmesii strain F586 chromosome, complete genome	3696928	2626692	2674319	3696928	transposase,tRNA,protease	Bacillus_phage(25.0%)	47	NA	NA
WP_005015146.1|2626692_2627445_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005015148.1|2627487_2628207_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005015150.1|2628249_2629305_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_101557744.1|2630314_2631434_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015154.1|2631994_2632573_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_005012861.1|2632715_2633936_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005015155.1|2634240_2635218_+	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_005015156.1|2635366_2636197_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015157.1|2636310_2637126_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015162.1|2637148_2638003_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015163.1|2638001_2638385_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005015164.1|2638491_2639865_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
WP_005019837.1|2639936_2640428_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_005015166.1|2640427_2641180_-	membrane protein	NA	NA	NA	NA	NA
WP_005015167.1|2641527_2641731_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_005015168.1|2641760_2642183_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_005015169.1|2642194_2643292_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005015170.1|2643304_2644774_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_005015171.1|2644895_2645735_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
WP_005019846.1|2645756_2646614_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_005015173.1|2646686_2647805_-	porin	NA	NA	NA	NA	NA
WP_005015175.1|2647791_2648406_-	magnesium transporting ATPase P-type 1	NA	NA	NA	NA	NA
WP_101557744.1|2648435_2649556_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015176.1|2649599_2650229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015177.1|2650386_2651730_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005015178.1|2651738_2652122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015179.1|2652281_2653433_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_110115124.1|2653531_2654482_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015181.1|2654625_2655651_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005015182.1|2655691_2655931_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_005019849.1|2655996_2657586_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	4.3e-64
WP_005015184.1|2657585_2658131_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A088FT24	Mycobacterium_phage	30.8	3.5e-05
WP_005015187.1|2658214_2658787_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005019851.1|2658790_2659558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015190.1|2659589_2659925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015191.1|2659848_2660916_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.5	2.1e-06
WP_005015192.1|2660912_2662733_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.9	8.7e-77
WP_005015193.1|2662848_2664057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015194.1|2664290_2664992_+	response regulator	NA	W8CYM9	Bacillus_phage	36.6	2.8e-31
WP_005015195.1|2665004_2666483_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005015196.1|2666498_2667551_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005019853.1|2667547_2668885_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005015199.1|2669003_2670764_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	52.4	2.2e-170
WP_005015201.1|2670949_2671792_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_005015204.1|2671885_2672701_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_005015207.1|2672704_2672977_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005012365.1|2673098_2674319_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
>prophage 10
NZ_CP043173	Bordetella holmesii strain F586 chromosome, complete genome	3696928	2936805	3014816	3696928	transposase,tRNA,protease,integrase	Ralstonia_virus(23.08%)	56	2939032:2939091	3012492:3013691
WP_005019978.1|2936805_2937585_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937607_2938555_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938556_2938757_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
2939032:2939091	attL	TGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGCA	NA	NA	NA	NA
WP_005015714.1|2940534_2941251_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2941247_2942141_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2942304_2943525_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943677_2944760_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2946439_2947423_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947485_2948898_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2949015_2949858_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2950136_2950745_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950760_2951381_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951446_2952154_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2952158_2952881_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952867_2953158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2953233_2954454_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2955178_2956030_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2956081_2957335_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957511_2958300_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2958419_2959334_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959466_2961359_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961544_2962924_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2963368_2963665_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967465_2968068_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2968201_2968660_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968661_2969261_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2969269_2970079_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2970113_2970968_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2971087_2971675_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971671_2973051_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973555_2973702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2981373_2982714_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982727_2983579_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983590_2984856_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984917_2986822_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988797_2989652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015806.1|2989644_2990439_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990654_2991605_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2992207_2993005_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2993044_2993698_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993678_2994743_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994906_2997132_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2997377_2999222_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2999338_3000211_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|3000257_3001958_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3002020_3003220_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3003230_3004109_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3004215_3005253_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3005333_3005738_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005749_3007207_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007849_3008446_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008606_3009065_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009842_3010814_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010935_3011355_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012646_3013867_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
3012492:3013691	attR	TGCCATTCCTTTGGGAACGGACTCTACATCGATTTCGTACTAATCACGGGGAGCAGGTCAACCCAATTTTTATGGTTCATCGCGGAATAGCGTGGAGCCGTGCTTGATTGCCGTTACGCTTGATCCTTGATTTTTCAAGGATCAAGGCCGGGATCATGCTGGACCGCAAGACGATCGAGAGGTTGGGTGGGTGGGAAGGTTATCGGGTGGAGTGGGTCGTGTGGCCTGAAGGTGAGAGCCGGACGGTCACGATTTACCTGAAGCCTTCAGCGCGAACGATGCACTGCGAGCACTGCGGCAACCGATGTCGGCAGGTGCATGAGACGACCACGCGCCGGGTGCGGGATCTGCCGCTAATGGCGCTGCGAGTGACGCTGGTAGTGCCGCGTCGGCGGGTCTGGTGCGAGCAGTGCGGTGGACCGCATCTGGAGAGGCTGAGCTGGCTGGGCCGTTACCAGCGAGTGACCGACCGGCTGGCCGAGGCGGTCAGCCAGTTGCTTGAGTCCAGCAACATTCTGGCCGTGGCGCGCTTCTTCCAACTGGGTTGGCACACGGTCAAGGCGCTGGACAAGGCCCTGCTGCGACGGGCGATCCAAGAGCCGGACTGGAGCCAGATCCACTACCTAGCGATGGACGAGTTCGCTCTACACAAGGGCCATCGTTATGCCACGGTCGTTGTCGATCCGATCCGCCGTCAGGTGCTATGGATCGGTGATGGCCGCTCGCGCGAGACGGCCAGAGCCTTCTTCGAACAACTGCCAACAGGAGTTGCCCAGCAGATCCGGGCCGTAGCGATCGACATGACGACGGCCTATGAGCTGGAGATCCAGGCCAACTGCCCCAACGCCGAGATCGTCTACGACCTGTTCCACGTCGTGGCCAAGTACGGCCGTGAAGTGATAGACCGGGTGCGTGTAGACCAAGCGAACCAGTTGCGGCACGACAAGCCGGCCCGCCGGGTGATCAAGTCCAGTCGCTGGCTACTGCTGCGCAATCGCAAAAACCTCGATCCGTGCCAATCGGTAAAGTTGGACGAGTTGCTCCAGGCCAACCAGCCCTTGCTCACCGCTTATCTGATGCGCGATGAGCTCAAACAGCTGTGGTTCTACCAACACCCCGGCTACGCCCGCCAGGCATGGGATCACTGGCTGCAACAGGCTCAGGGCAGCGGCATCGCCGCCTTGGCTCACTTCGCGCTCA	NA	NA	NA	NA
WP_005020040.1|3013928_3014816_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
