The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043172	Bordetella holmesii strain F588 chromosome, complete genome	3698119	1095263	1202052	3698119	tRNA,transposase,protease	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095263_1096484_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096571_1097162_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097158_1097461_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097512_1098502_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098622_1099504_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099677_1100532_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100563_1101412_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101539_1102760_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102778_1103345_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103542_1104694_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104832_1105837_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1105993_1106965_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107043_1107832_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107903_1108140_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108148_1109060_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109103_1110975_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111135_1111933_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112164_1112539_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112615_1112939_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113022_1113295_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113309_1113765_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113886_1114723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114719_1116093_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116169_1117126_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117213_1118191_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118315_1119971_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120019_1120484_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120480_1120942_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121167_1122355_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122351_1123656_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123652_1125062_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125255_1126375_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126510_1127530_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127538_1130244_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130383_1131037_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131099_1131462_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132028_1133489_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133751_1134825_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134909_1136130_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137887_1139008_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138981_1140481_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140494_1141598_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141602_1142853_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142849_1144295_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144291_1144606_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144607_1145726_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145908_1147129_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147228_1148095_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148155_1149136_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149282_1150203_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150211_1151324_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151405_1152227_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152302_1152911_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153048_1154425_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154486_1154930_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1154996_1155653_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155695_1156815_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156984_1157266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157976_1158765_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158761_1159868_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160542_1161901_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162015_1162213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162230_1163351_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163444_1163999_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164586_1165903_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165915_1166929_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167475_1168426_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168505_1168805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170165_1171824_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171972_1173193_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173310_1174594_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174597_1175539_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175648_1176107_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176487_1177108_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177515_1179936_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180043_1180781_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180827_1182072_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182394_1182667_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183250_1183979_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184000_1184918_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184917_1185427_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185543_1186215_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186324_1187392_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187411_1189256_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189392_1190580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190880_1191666_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191689_1192809_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192913_1194251_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194360_1195302_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195357_1196539_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196697_1196988_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197034_1197703_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197699_1197987_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198363_1199149_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199181_1199916_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200831_1202052_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043172	Bordetella holmesii strain F588 chromosome, complete genome	3698119	1206839	1263245	3698119	tRNA,transposase,protease	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1206839_1207790_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207871_1208351_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209562_1210762_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210907_1211285_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211308_1213090_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213098_1213836_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214120_1215680_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215739_1216498_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216594_1217251_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217404_1218169_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218183_1218363_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218388_1219423_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219419_1219833_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219829_1220414_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220766_1222125_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222218_1222797_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222921_1224042_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224114_1225371_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225474_1226680_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226743_1227193_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227325_1227571_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227795_1228110_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233363_1235469_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235522_1237832_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239185_1240853_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240855_1241521_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241653_1245460_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245685_1246831_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246949_1247879_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247875_1248952_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248948_1249755_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249751_1250483_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250859_1252098_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252145_1252484_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252731_1253682_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254000_1254183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254248_1255469_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255562_1256783_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256842_1257106_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257227_1258727_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1258774_1259050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259147_1259345_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259360_1259720_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259792_1260815_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260827_1263245_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043172	Bordetella holmesii strain F588 chromosome, complete genome	3698119	1651616	1691990	3698119	tRNA,transposase,integrase	Leptospira_phage(28.57%)	39	1644058:1644074	1688675:1688691
1644058:1644074	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|1651616_1652736_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1653388_1654144_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1654320_1655115_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1655111_1655549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1655660_1655813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1656233_1657202_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1657358_1658366_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1658423_1658882_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1658955_1660302_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1660319_1660691_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1660690_1662160_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1662315_1663041_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1663054_1665769_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1666020_1667385_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1667424_1668483_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1668510_1669329_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1669366_1669645_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1670908_1671208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1671777_1673181_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1673193_1673844_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1673985_1675206_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1675236_1676313_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1676459_1677590_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1677776_1679402_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1679408_1680224_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1680238_1681309_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1681360_1682020_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1682659_1683822_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1683863_1684178_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1684161_1684548_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1684586_1684853_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1685245_1685935_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1686034_1686196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1686346_1686511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1686637_1686874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1687063_1687312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1687425_1688796_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1688675:1688691	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1688796_1689537_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1690037_1691990_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 5
NZ_CP043172	Bordetella holmesii strain F588 chromosome, complete genome	3698119	1710284	1754211	3698119	tRNA,holin,transposase,integrase	Leptospira_phage(33.33%)	37	1752779:1752793	1759255:1759269
WP_005019367.1|1710284_1713146_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1713135_1714101_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1714857_1716333_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1716337_1716613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1716949_1718069_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1717943_1718192_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1718370_1719579_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1719575_1721858_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1721868_1724250_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1724513_1726421_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1726435_1727326_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1727332_1728466_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1728465_1729287_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1729311_1730502_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1730803_1731085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1731250_1731571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1731610_1732697_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1732893_1733154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1733646_1734417_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1734413_1735424_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1735458_1736301_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1736763_1737549_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1738408_1739528_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1740594_1741599_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1741674_1742487_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1742714_1744886_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1744939_1746259_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1746347_1747568_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1747786_1748647_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1748643_1749867_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1750165_1750663_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1750701_1751484_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1751509_1751728_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1751802_1752072_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1752291_1752756_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1752779:1752793	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1752829_1753111_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1753227_1754211_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1759255:1759269	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP043172	Bordetella holmesii strain F588 chromosome, complete genome	3698119	1779487	1820878	3698119	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1779487_1780438_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1780434_1780950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1781307_1781928_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1782027_1782279_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1782366_1783845_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1783841_1787012_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1787024_1788221_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1788409_1789342_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1789410_1790142_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1790207_1790843_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1790828_1792007_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1792167_1792716_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1792796_1793156_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1793203_1794424_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1794499_1795621_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1795658_1796372_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1796382_1797603_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1797685_1798240_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1798385_1799336_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1799295_1799457_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1799497_1800424_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1800437_1801310_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1801472_1802420_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1802758_1803340_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1803917_1804868_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1804847_1805600_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1805612_1806344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1806500_1808666_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1808755_1809025_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1809113_1809320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1809318_1809837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1809855_1810635_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1810802_1811819_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1811891_1812383_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1812393_1814109_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1815272_1816223_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1817874_1819116_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1819127_1819901_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1819927_1820878_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043172	Bordetella holmesii strain F588 chromosome, complete genome	3698119	2149092	2209215	3698119	tRNA,transposase,protease	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2149092_2149581_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2149573_2150422_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2150513_2151011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2151148_2151508_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2151504_2151786_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2151785_2152268_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2152269_2153898_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2153894_2154239_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2154240_2157183_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2157628_2158600_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2158589_2159972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2160114_2161065_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2161024_2162266_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2162262_2163384_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2164875_2165343_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2165413_2166064_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2166150_2167290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2167458_2168463_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2168459_2169707_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2170059_2170926_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2170885_2172490_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2172501_2173188_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2173184_2174225_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2174340_2175012_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2175008_2176001_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2175997_2176936_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2176932_2178087_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2178095_2179547_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2179577_2180060_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2180061_2180955_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2180951_2181395_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2181407_2181782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2181924_2182323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2182449_2182737_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2182733_2183150_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2183325_2183958_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2183986_2184433_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2184719_2185871_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2185984_2186989_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2187972_2188680_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2188612_2190064_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2190069_2193228_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2193240_2193762_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2193751_2194576_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2194572_2195172_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2195280_2197137_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2197285_2198290_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2198498_2199761_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2199765_2200101_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2200097_2201027_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2201031_2201745_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2201848_2203306_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2203302_2203599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2203723_2205082_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2205182_2205983_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2206162_2207281_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2207353_2207725_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2207731_2208583_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2208603_2209215_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043172	Bordetella holmesii strain F588 chromosome, complete genome	3698119	2304338	2425849	3698119	tRNA,transposase,protease,integrase	Leptospira_phage(15.15%)	106	2335868:2335927	2357175:2357449
WP_101557807.1|2304338_2305501_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2305613_2306582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2306578_2307499_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2307595_2312074_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2312452_2316787_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2317425_2317989_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2318000_2318246_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2318401_2318911_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2318956_2319937_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2320148_2322500_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2322546_2323377_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2323373_2324063_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2324055_2325336_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2325433_2326372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2326353_2328060_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2328137_2329241_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2329293_2330043_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2330049_2331564_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005014513.1|2331576_2331864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2331884_2332772_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2332922_2333429_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2333425_2334382_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2334569_2335916_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2335868:2335927	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2335883_2336114_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2336143_2336707_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2336861_2337632_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2337628_2338639_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_162008381.1|2338953_2339400_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2339455_2339650_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2339651_2339993_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2340002_2341865_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2341904_2342411_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2342414_2342738_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2342739_2343144_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2343180_2344392_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2344413_2344962_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2345186_2345678_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2345892_2347923_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2347997_2349200_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2349742_2350678_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2351711_2351993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2352079_2352253_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2352364_2352709_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2352780_2353449_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2354864_2355908_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2355904_2356006_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2356097_2357217_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2357467_2358121_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2357175:2357449	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2358236_2359457_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2359507_2361937_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2362102_2363401_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2363505_2364159_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2364161_2365472_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2365699_2366239_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2366717_2366984_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2367022_2367388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2367269_2368280_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2368276_2369047_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2369132_2369792_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2369759_2370251_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2370360_2370564_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2370881_2371202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2371185_2371521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2371575_2371788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2371863_2372202_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2372198_2372534_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2372596_2374168_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2374961_2375273_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2375465_2376586_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2376713_2376908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2382990_2384152_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2384537_2386001_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2386133_2387684_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2387680_2387830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2387995_2389116_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2390229_2391087_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2391139_2391637_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2391757_2393173_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2393182_2394367_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2394363_2395962_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2397144_2397390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2397800_2397986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2398141_2399053_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2399174_2400017_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2400219_2401593_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2401902_2403414_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2403566_2404298_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2404404_2405706_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2405713_2406622_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2406618_2407212_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2407255_2407669_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2407665_2408136_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2408142_2408748_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2410549_2412334_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2412330_2413716_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2413701_2414664_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2414733_2415363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2415400_2416609_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2416730_2417300_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2417431_2418985_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2419288_2420509_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2420916_2421819_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2421815_2422685_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2422681_2423533_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2423529_2424354_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2424628_2425849_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043172	Bordetella holmesii strain F588 chromosome, complete genome	3698119	2593651	2655613	3698119	tRNA,transposase,protease	Ralstonia_virus(33.33%)	58	NA	NA
WP_005011985.1|2593651_2594872_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015059.1|2594875_2595109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015061.1|2595195_2596287_-	ferrochelatase	NA	NA	NA	NA	NA
WP_005015063.1|2596319_2597324_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_005015074.1|2597433_2598333_+	NAD kinase	NA	NA	NA	NA	NA
WP_005015076.1|2598354_2600010_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_005015081.1|2602662_2603079_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_005015089.1|2603349_2603847_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_005015090.1|2603862_2604654_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_005015091.1|2604711_2605698_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_005015101.1|2608002_2608656_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_025341186.1|2608837_2609545_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015108.1|2609541_2612157_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_005015113.1|2612213_2613398_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_005015114.1|2613458_2614067_+	LysE family translocator	NA	NA	NA	NA	NA
WP_005015116.1|2614189_2615215_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015118.1|2615278_2615809_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_076879502.1|2615688_2616030_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015120.1|2616026_2616734_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005019828.1|2616743_2617637_-	isocitrate lyase/PEP mutase family protein	NA	NA	NA	NA	NA
WP_005015124.1|2617620_2618379_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015127.1|2618670_2621346_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_005015129.1|2621362_2622724_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_005015132.1|2622743_2623466_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_005015134.1|2623470_2624469_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_005015136.1|2624889_2625198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015138.1|2625245_2625818_+	DUF2946 family protein	NA	NA	NA	NA	NA
WP_005015140.1|2625795_2626200_-	DoxX family protein	NA	NA	NA	NA	NA
WP_005015142.1|2626318_2627236_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015144.1|2627245_2627827_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005015146.1|2627823_2628576_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005015148.1|2628618_2629338_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005015150.1|2629380_2630436_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_101557744.1|2631445_2632565_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015154.1|2633125_2633704_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_005012861.1|2633846_2635067_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005015155.1|2635371_2636349_+	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_005015156.1|2636497_2637328_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015157.1|2637441_2638257_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015162.1|2638279_2639134_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015163.1|2639132_2639516_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_032974102.1|2639622_2640996_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	4.0e-50
WP_005019837.1|2641067_2641559_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_005015166.1|2641558_2642311_-	membrane protein	NA	NA	NA	NA	NA
WP_005015167.1|2642658_2642862_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_005015168.1|2642891_2643314_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_005015169.1|2643325_2644423_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005015170.1|2644435_2645905_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_005015171.1|2646026_2646866_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
WP_005019846.1|2646887_2647745_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_005015173.1|2647817_2648936_-	porin	NA	NA	NA	NA	NA
WP_005015175.1|2648922_2649537_-	magnesium transporting ATPase P-type 1	NA	NA	NA	NA	NA
WP_101557744.1|2649566_2650687_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015176.1|2650730_2651360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015177.1|2651517_2652861_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005015178.1|2652869_2653253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015179.1|2653412_2654564_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_005015180.1|2654662_2655613_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP043172	Bordetella holmesii strain F588 chromosome, complete genome	3698119	2937934	3014994	3698119	tRNA,transposase,integrase	Ralstonia_virus(21.43%)	56	2940789:2940848	2989376:2989946
WP_005019978.1|2937934_2938714_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2938736_2939684_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2939685_2939886_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2940220_2941340_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2940789:2940848	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2941661_2942378_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2942374_2943268_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2943431_2944652_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2944804_2945887_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2947566_2948550_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2948612_2950025_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2950142_2950985_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2951263_2951872_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2951887_2952508_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2952573_2953281_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2953285_2954008_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2953994_2954285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2954360_2955581_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2956305_2957157_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2957208_2958462_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2958638_2959427_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2959546_2960461_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2960593_2962486_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2962671_2964051_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2964495_2964792_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2968592_2969195_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2969328_2969787_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2969788_2970388_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2970396_2971206_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2971240_2972095_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2972214_2972802_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2972798_2974178_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2974682_2974829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2982500_2983841_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2983854_2984706_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2984717_2985983_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2986044_2987949_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2989924_2990779_-	hypothetical protein	NA	NA	NA	NA	NA
2989376:2989946	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2990771_2991566_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2991781_2992732_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2993334_2994132_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2994171_2994825_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2994805_2995870_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2996033_2998259_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2998504_3000349_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|3000465_3001338_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|3001384_3003085_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3003147_3004347_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3004357_3005236_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3005342_3006380_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3006460_3006865_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3006876_3008334_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3008976_3009573_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3009733_3010192_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3010969_3011941_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3012062_3012482_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3013773_3014994_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
