The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043170	Bordetella holmesii strain F590 chromosome, complete genome	3697080	1095269	1202058	3697080	tRNA,protease,transposase	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095269_1096490_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096577_1097168_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097164_1097467_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097518_1098508_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098628_1099510_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099683_1100538_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100569_1101418_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101545_1102766_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102784_1103351_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103548_1104700_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104838_1105843_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1105999_1106971_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107049_1107838_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107909_1108146_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108154_1109066_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109109_1110981_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111141_1111939_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112170_1112545_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112621_1112945_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113028_1113301_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113315_1113771_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113892_1114729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114725_1116099_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116175_1117132_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117219_1118197_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118321_1119977_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120025_1120490_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120486_1120948_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121173_1122361_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122357_1123662_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123658_1125068_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125261_1126381_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126516_1127536_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127544_1130250_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130389_1131043_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131105_1131468_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132034_1133495_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133757_1134831_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134915_1136136_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137893_1139014_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138987_1140487_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140500_1141604_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141608_1142859_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142855_1144301_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144297_1144612_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144613_1145732_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145914_1147135_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147234_1148101_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148161_1149142_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149288_1150209_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150217_1151330_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151411_1152233_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152308_1152917_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153054_1154431_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154492_1154936_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155002_1155659_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155701_1156821_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156990_1157272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157982_1158771_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158767_1159874_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_153570074.1|1160548_1161907_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	9.5e-20
WP_005012717.1|1162021_1162219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162236_1163357_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163450_1164005_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164592_1165909_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165921_1166935_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167481_1168432_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168511_1168811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170171_1171830_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171978_1173199_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173316_1174600_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174603_1175545_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175654_1176113_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176493_1177114_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177521_1179942_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180049_1180787_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180833_1182078_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182400_1182673_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183256_1183985_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184006_1184924_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184923_1185433_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185549_1186221_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186330_1187398_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187417_1189262_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189398_1190586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190886_1191672_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191695_1192815_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192919_1194257_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194366_1195308_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195363_1196545_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196703_1196994_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197040_1197709_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197705_1197993_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198369_1199155_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199187_1199922_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200837_1202058_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043170	Bordetella holmesii strain F590 chromosome, complete genome	3697080	1206845	1263251	3697080	tRNA,protease,transposase	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1206845_1207796_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207877_1208357_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209568_1210768_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210913_1211291_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211314_1213096_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213104_1213842_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214126_1215686_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215745_1216504_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216600_1217257_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217410_1218175_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218189_1218369_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218394_1219429_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219425_1219839_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219835_1220420_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220772_1222131_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222224_1222803_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222927_1224048_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224120_1225377_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225480_1226686_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226749_1227199_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227331_1227577_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227801_1228116_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233369_1235475_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235528_1237838_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239191_1240859_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240861_1241527_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241659_1245466_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245691_1246837_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246955_1247885_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247881_1248958_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248954_1249761_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249757_1250489_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250865_1252104_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252151_1252490_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252737_1253688_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254006_1254189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254254_1255475_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255568_1256789_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256848_1257112_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257233_1258733_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1258780_1259056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259153_1259351_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259366_1259726_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259798_1260821_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260833_1263251_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043170	Bordetella holmesii strain F590 chromosome, complete genome	3697080	1651622	1691996	3697080	integrase,tRNA,transposase	Leptospira_phage(28.57%)	39	1644064:1644080	1688681:1688697
1644064:1644080	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|1651622_1652742_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1653394_1654150_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1654326_1655121_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1655117_1655555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1655666_1655819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1656239_1657208_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1657364_1658372_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1658429_1658888_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1658961_1660308_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1660325_1660697_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1660696_1662166_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1662321_1663047_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1663060_1665775_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1666026_1667391_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1667430_1668489_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1668516_1669335_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1669372_1669651_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1670914_1671214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1671783_1673187_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1673199_1673850_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1673991_1675212_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1675242_1676319_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1676465_1677596_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1677782_1679408_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1679414_1680230_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1680244_1681315_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1681366_1682026_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1682665_1683828_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1683869_1684184_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1684167_1684554_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1684592_1684859_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1685251_1685941_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1686040_1686202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1686352_1686517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1686643_1686880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1687069_1687318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1687431_1688802_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1688681:1688697	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1688802_1689543_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1690043_1691996_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 5
NZ_CP043170	Bordetella holmesii strain F590 chromosome, complete genome	3697080	1710290	1754217	3697080	integrase,tRNA,holin,transposase	Leptospira_phage(33.33%)	37	1752785:1752799	1759261:1759275
WP_005019367.1|1710290_1713152_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1713141_1714107_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1714863_1716339_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1716343_1716619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1716955_1718075_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1717949_1718198_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1718376_1719585_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1719581_1721864_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1721874_1724256_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1724519_1726427_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1726441_1727332_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1727338_1728472_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1728471_1729293_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1729317_1730508_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1730809_1731091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1731256_1731577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1731616_1732703_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1732899_1733160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1733652_1734423_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1734419_1735430_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_050597667.1|1735488_1736307_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.2e-54
WP_005013673.1|1736769_1737555_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1738414_1739534_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1740600_1741605_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1741680_1742493_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1742720_1744892_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1744945_1746265_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1746353_1747574_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1747792_1748653_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1748649_1749873_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1750171_1750669_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1750707_1751490_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1751515_1751734_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1751808_1752078_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1752297_1752762_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1752785:1752799	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1752835_1753117_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1753233_1754217_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1759261:1759275	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP043170	Bordetella holmesii strain F590 chromosome, complete genome	3697080	1779493	1820884	3697080	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1779493_1780444_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1780440_1780956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1781313_1781934_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1782033_1782285_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1782372_1783851_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1783847_1787018_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1787030_1788227_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1788415_1789348_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1789416_1790148_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1790213_1790849_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1790834_1792013_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1792173_1792722_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1792802_1793162_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1793209_1794430_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1794505_1795627_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1795664_1796378_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1796388_1797609_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1797691_1798246_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1798391_1799342_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1799301_1799463_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1799503_1800430_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1800443_1801316_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1801478_1802426_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1802764_1803346_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1803923_1804874_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1804853_1805606_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1805618_1806350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1806506_1808672_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1808761_1809031_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1809119_1809326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1809324_1809843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1809861_1810641_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1810808_1811825_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1811897_1812389_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1812399_1814115_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1815278_1816229_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1817880_1819122_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1819133_1819907_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1819933_1820884_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043170	Bordetella holmesii strain F590 chromosome, complete genome	3697080	2149097	2209220	3697080	tRNA,protease,transposase	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2149097_2149586_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2149578_2150427_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2150518_2151016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2151153_2151513_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2151509_2151791_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2151790_2152273_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2152274_2153903_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2153899_2154244_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2154245_2157188_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2157633_2158605_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2158594_2159977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2160119_2161070_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2161029_2162271_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2162267_2163389_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2164880_2165348_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2165418_2166069_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2166155_2167295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2167463_2168468_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2168464_2169712_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2170064_2170931_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2170890_2172495_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2172506_2173193_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2173189_2174230_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2174345_2175017_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2175013_2176006_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2176002_2176941_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2176937_2178092_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2178100_2179552_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2179582_2180065_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2180066_2180960_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2180956_2181400_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2181412_2181787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2181929_2182328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2182454_2182742_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2182738_2183155_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2183330_2183963_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2183991_2184438_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2184724_2185876_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2185989_2186994_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2187977_2188685_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2188617_2190069_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2190074_2193233_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2193245_2193767_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2193756_2194581_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2194577_2195177_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2195285_2197142_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2197290_2198295_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2198503_2199766_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2199770_2200106_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2200102_2201032_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2201036_2201750_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2201853_2203311_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2203307_2203604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2203728_2205087_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2205187_2205988_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2206167_2207286_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2207358_2207730_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2207736_2208588_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2208608_2209220_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043170	Bordetella holmesii strain F590 chromosome, complete genome	3697080	2304343	2425854	3697080	integrase,tRNA,protease,transposase	Leptospira_phage(15.15%)	106	2335873:2335932	2357180:2357454
WP_101557807.1|2304343_2305506_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2305618_2306587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2306583_2307504_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2307600_2312079_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2312457_2316792_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2317430_2317994_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2318005_2318251_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2318406_2318916_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2318961_2319942_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2320153_2322505_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2322551_2323382_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2323378_2324068_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2324060_2325341_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2325438_2326377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2326358_2328065_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2328142_2329246_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2329298_2330048_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2330054_2331569_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005014513.1|2331581_2331869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2331889_2332777_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2332927_2333434_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2333430_2334387_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2334574_2335921_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2335873:2335932	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2335888_2336119_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2336148_2336712_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2336866_2337637_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2337633_2338644_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2338958_2339405_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2339460_2339655_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2339656_2339998_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2340007_2341870_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2341909_2342416_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2342419_2342743_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2342744_2343149_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2343185_2344397_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2344418_2344967_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2345191_2345683_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2345897_2347928_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2348002_2349205_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2349747_2350683_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2351716_2351998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2352084_2352258_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2352369_2352714_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2352785_2353454_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2354869_2355913_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2355909_2356011_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2356102_2357222_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2357472_2358126_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2357180:2357454	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2358241_2359462_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2359512_2361942_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2362107_2363406_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2363510_2364164_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2364166_2365477_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2365704_2366244_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2366722_2366989_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2367027_2367393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2367274_2368285_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2368281_2369052_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2369137_2369797_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2369764_2370256_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2370365_2370569_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2370886_2371207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2371190_2371526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2371580_2371793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2371868_2372207_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2372203_2372539_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2372601_2374173_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2374966_2375278_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2375470_2376591_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2376718_2376913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2382995_2384157_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2384542_2386006_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2386138_2387689_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2387685_2387835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2388000_2389121_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2390234_2391092_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2391144_2391642_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2391762_2393178_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2393187_2394372_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2394368_2395967_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2397149_2397395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2397805_2397991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2398146_2399058_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2399179_2400022_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2400224_2401598_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2401907_2403419_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2403571_2404303_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2404409_2405711_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2405718_2406627_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2406623_2407217_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2407260_2407674_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2407670_2408141_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2408147_2408753_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2410554_2412339_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2412335_2413721_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2413706_2414669_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2414738_2415368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2415405_2416614_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2416735_2417305_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2417436_2418990_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2419293_2420514_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2420921_2421824_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2421820_2422690_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2422686_2423538_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2423534_2424359_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2424633_2425854_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043170	Bordetella holmesii strain F590 chromosome, complete genome	3697080	2626514	2674141	3697080	tRNA,protease,transposase	Bacillus_phage(25.0%)	47	NA	NA
WP_005015146.1|2626514_2627267_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005015148.1|2627309_2628029_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005015150.1|2628071_2629127_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_101557744.1|2630136_2631256_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015154.1|2631816_2632395_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_005012861.1|2632537_2633758_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005015155.1|2634062_2635040_+	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_005015156.1|2635188_2636019_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015157.1|2636132_2636948_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015162.1|2636970_2637825_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015163.1|2637823_2638207_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_032974102.1|2638313_2639687_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	4.0e-50
WP_005019837.1|2639758_2640250_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_005015166.1|2640249_2641002_-	membrane protein	NA	NA	NA	NA	NA
WP_005015167.1|2641349_2641553_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_005015168.1|2641582_2642005_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_005015169.1|2642016_2643114_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005015170.1|2643126_2644596_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_005015171.1|2644717_2645557_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
WP_005019846.1|2645578_2646436_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_005015173.1|2646508_2647627_-	porin	NA	NA	NA	NA	NA
WP_005015175.1|2647613_2648228_-	magnesium transporting ATPase P-type 1	NA	NA	NA	NA	NA
WP_101557744.1|2648257_2649378_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015176.1|2649421_2650051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015177.1|2650208_2651552_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005015178.1|2651560_2651944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015179.1|2652103_2653255_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_005015180.1|2653353_2654304_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015181.1|2654447_2655473_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005015182.1|2655513_2655753_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_005019849.1|2655818_2657408_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	4.3e-64
WP_005015184.1|2657407_2657953_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A088FT24	Mycobacterium_phage	30.8	3.5e-05
WP_005015187.1|2658036_2658609_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005019851.1|2658612_2659380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015190.1|2659411_2659747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015191.1|2659670_2660738_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.5	2.1e-06
WP_005015192.1|2660734_2662555_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.9	8.7e-77
WP_005015193.1|2662670_2663879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015194.1|2664112_2664814_+	response regulator	NA	W8CYM9	Bacillus_phage	36.6	2.8e-31
WP_005015195.1|2664826_2666305_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005015196.1|2666320_2667373_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005019853.1|2667369_2668707_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005015199.1|2668825_2670586_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	52.4	2.2e-170
WP_005015201.1|2670771_2671614_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_005015204.1|2671707_2672523_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_005015207.1|2672526_2672799_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005012365.1|2672920_2674141_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
>prophage 10
NZ_CP043170	Bordetella holmesii strain F590 chromosome, complete genome	3697080	2936627	3013687	3697080	integrase,tRNA,transposase	Ralstonia_virus(21.43%)	56	2939482:2939541	2988069:2988639
WP_005019978.1|2936627_2937407_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937429_2938377_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938378_2938579_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938913_2940033_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939482:2939541	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940354_2941071_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2941067_2941961_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2942124_2943345_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943497_2944580_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2946259_2947243_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947305_2948718_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948835_2949678_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949956_2950565_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950580_2951201_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951266_2951974_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951978_2952701_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952687_2952978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2953053_2954274_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954998_2955850_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955901_2957155_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957331_2958120_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2958239_2959154_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959286_2961179_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961364_2962744_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2963188_2963485_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967285_2967888_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2968021_2968480_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968481_2969081_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2969089_2969899_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969933_2970788_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970907_2971495_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971491_2972871_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973375_2973522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2981193_2982534_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982547_2983399_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983410_2984676_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984737_2986642_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988617_2989472_-	hypothetical protein	NA	NA	NA	NA	NA
2988069:2988639	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989464_2990259_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990474_2991425_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2992027_2992825_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992864_2993518_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993498_2994563_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994726_2996952_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2997197_2999042_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2999158_3000031_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|3000077_3001778_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001840_3003040_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3003050_3003929_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3004035_3005073_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3005153_3005558_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005569_3007027_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007669_3008266_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008426_3008885_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009662_3010634_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010755_3011175_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012466_3013687_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
