The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043168	Bordetella holmesii strain F593 chromosome, complete genome	3696516	1095248	1202037	3696516	transposase,protease,tRNA	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095248_1096469_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096556_1097147_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097143_1097446_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097497_1098487_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098607_1099489_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099662_1100517_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100548_1101397_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101524_1102745_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102763_1103330_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103527_1104679_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104817_1105822_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1105978_1106950_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107028_1107817_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107888_1108125_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108133_1109045_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109088_1110960_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111120_1111918_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112149_1112524_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112600_1112924_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113007_1113280_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113294_1113750_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113871_1114708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114704_1116078_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116154_1117111_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117198_1118176_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118300_1119956_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120004_1120469_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120465_1120927_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121152_1122340_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122336_1123641_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123637_1125047_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125240_1126360_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126495_1127515_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127523_1130229_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130368_1131022_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131084_1131447_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132013_1133474_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133736_1134810_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134894_1136115_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137872_1138993_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138966_1140466_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140479_1141583_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141587_1142838_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142834_1144280_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144276_1144591_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144592_1145711_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145893_1147114_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147213_1148080_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148140_1149121_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149267_1150188_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150196_1151309_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151390_1152212_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152287_1152896_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153033_1154410_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154471_1154915_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1154981_1155638_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155680_1156800_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156969_1157251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157961_1158750_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158746_1159853_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160527_1161886_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162000_1162198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162215_1163336_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163429_1163984_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164571_1165888_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165900_1166914_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167460_1168411_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168490_1168790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170150_1171809_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171957_1173178_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173295_1174579_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174582_1175524_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175633_1176092_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176472_1177093_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177500_1179921_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180028_1180766_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180812_1182057_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182379_1182652_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183235_1183964_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1183985_1184903_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184902_1185412_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185528_1186200_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186309_1187377_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187396_1189241_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189377_1190565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190865_1191651_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191674_1192794_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192898_1194236_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194345_1195287_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195342_1196524_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196682_1196973_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197019_1197688_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197684_1197972_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198348_1199134_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199166_1199901_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153567912.1|1200816_1202037_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	2.1e-183
>prophage 2
NZ_CP043168	Bordetella holmesii strain F593 chromosome, complete genome	3696516	1206824	1263230	3696516	transposase,protease,tRNA	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1206824_1207775_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207856_1208336_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209547_1210747_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210892_1211270_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211293_1213075_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213083_1213821_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214105_1215665_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215724_1216483_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216579_1217236_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217389_1218154_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218168_1218348_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218373_1219408_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219404_1219818_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219814_1220399_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220751_1222110_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222203_1222782_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222906_1224027_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224099_1225356_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225459_1226665_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226728_1227178_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227310_1227556_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227780_1228095_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233348_1235454_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235507_1237817_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239170_1240838_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240840_1241506_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241638_1245445_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245670_1246816_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246934_1247864_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247860_1248937_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248933_1249740_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249736_1250468_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250844_1252083_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252130_1252469_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252716_1253667_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1253985_1254168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254233_1255454_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255547_1256768_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256827_1257091_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257212_1258712_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1258759_1259035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259132_1259330_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259345_1259705_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259777_1260800_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260812_1263230_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043168	Bordetella holmesii strain F593 chromosome, complete genome	3696516	1651601	1693010	3696516	transposase,integrase,tRNA	Leptospira_phage(28.57%)	40	1644043:1644059	1689709:1689725
1644043:1644059	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|1651601_1652721_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1653373_1654129_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1654305_1655100_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1655096_1655534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1655645_1655798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1656218_1657187_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1657343_1658351_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1658408_1658867_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1658940_1660287_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1660304_1660676_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1660675_1662145_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1662300_1663026_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1663039_1665754_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1666005_1667370_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1667409_1668468_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1668495_1669314_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1669351_1669630_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1670893_1671193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1671762_1673166_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1673178_1673829_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1673970_1675191_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1675221_1676298_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1676444_1677575_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1677761_1679387_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1679393_1680209_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_153567907.1|1680223_1681294_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1681345_1682005_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1682644_1683807_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1683848_1684163_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1684146_1684533_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1684571_1684838_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1685230_1685920_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005012067.1|1685916_1686867_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013626.1|1687068_1687230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687380_1687545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687671_1687908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688097_1688346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688459_1689830_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689709:1689725	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689830_1690571_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691057_1693010_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 5
NZ_CP043168	Bordetella holmesii strain F593 chromosome, complete genome	3696516	1711304	1755231	3696516	transposase,holin,integrase,tRNA	Leptospira_phage(33.33%)	37	1753799:1753813	1760275:1760289
WP_005019367.1|1711304_1714166_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714155_1715121_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715877_1717353_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717357_1717633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1717969_1719089_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1718963_1719212_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719390_1720599_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720595_1722878_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722888_1725270_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725533_1727441_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727455_1728346_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728352_1729486_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729485_1730307_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730331_1731522_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731823_1732105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732270_1732591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732630_1733717_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733913_1734174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734666_1735437_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735433_1736444_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_050597667.1|1736502_1737321_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.2e-54
WP_005013673.1|1737783_1738569_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739428_1740548_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741614_1742619_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742694_1743507_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743734_1745906_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1745959_1747279_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747367_1748588_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748806_1749667_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749663_1750887_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751185_1751683_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751721_1752504_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752529_1752748_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752822_1753092_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753311_1753776_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753799:1753813	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753849_1754131_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754247_1755231_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760275:1760289	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP043168	Bordetella holmesii strain F593 chromosome, complete genome	3696516	1780507	1821898	3696516	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780507_1781458_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781454_1781970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782327_1782948_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783047_1783299_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783386_1784865_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_153567909.1|1784861_1788032_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788044_1789241_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789429_1790362_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790430_1791162_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791227_1791863_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791848_1793027_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793187_1793736_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793816_1794176_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794223_1795444_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795519_1796641_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796678_1797392_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797402_1798623_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798705_1799260_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799405_1800356_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800315_1800477_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800517_1801444_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801457_1802330_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802492_1803440_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803778_1804360_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804937_1805888_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805867_1806620_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806632_1807364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807520_1809686_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809775_1810045_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810133_1810340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810338_1810857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810875_1811655_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811822_1812839_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812911_1813403_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813413_1815129_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816292_1817243_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818894_1820136_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820147_1820921_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1820947_1821898_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043168	Bordetella holmesii strain F593 chromosome, complete genome	3696516	2150112	2210235	3696516	transposase,protease,tRNA	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150112_2150601_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150593_2151442_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151533_2152031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152168_2152528_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152524_2152806_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152805_2153288_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153289_2154918_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154914_2155259_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155260_2158203_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158648_2159620_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159609_2160992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161134_2162085_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162044_2163286_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163282_2164404_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165895_2166363_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166433_2167084_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167170_2168310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168478_2169483_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169479_2170727_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171079_2171946_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171905_2173510_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173521_2174208_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174204_2175245_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175360_2176032_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2176028_2177021_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177017_2177956_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2177952_2179107_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179115_2180567_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180597_2181080_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181081_2181975_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2181971_2182415_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182427_2182802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2182944_2183343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183469_2183757_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183753_2184170_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184345_2184978_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185006_2185453_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185739_2186891_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187004_2188009_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2188992_2189700_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189632_2191084_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191089_2194248_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194260_2194782_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194771_2195596_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195592_2196192_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196300_2198157_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198305_2199310_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199518_2200781_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200785_2201121_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201117_2202047_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202051_2202765_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202868_2204326_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204322_2204619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204743_2206102_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206202_2207003_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207182_2208301_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208373_2208745_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208751_2209603_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209623_2210235_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043168	Bordetella holmesii strain F593 chromosome, complete genome	3696516	2305358	2426869	3696516	transposase,integrase,protease,tRNA	Leptospira_phage(15.15%)	106	2336888:2336947	2358195:2358469
WP_101557807.1|2305358_2306521_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306633_2307602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307598_2308519_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308615_2313094_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313472_2317807_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318445_2319009_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319020_2319266_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319421_2319931_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2319976_2320957_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321168_2323520_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323566_2324397_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324393_2325083_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325075_2326356_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326453_2327392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327373_2329080_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329157_2330261_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330313_2331063_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331069_2332584_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005014513.1|2332596_2332884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332904_2333792_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2333942_2334449_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334445_2335402_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335589_2336936_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336888:2336947	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2336903_2337134_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337163_2337727_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337881_2338652_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338648_2339659_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2339973_2340420_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340475_2340670_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340671_2341013_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341022_2342885_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2342924_2343431_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343434_2343758_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343759_2344164_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344200_2345412_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345433_2345982_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346206_2346698_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2346912_2348943_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349017_2350220_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350762_2351698_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352731_2353013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353099_2353273_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353384_2353729_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353800_2354469_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355884_2356928_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2356924_2357026_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357117_2358237_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358487_2359141_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358195:2358469	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359256_2360477_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360527_2362957_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363122_2364421_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364525_2365179_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365181_2366492_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366719_2367259_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367737_2368004_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368042_2368408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368289_2369300_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369296_2370067_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370152_2370812_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370779_2371271_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371380_2371584_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371901_2372222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372205_2372541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372595_2372808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372883_2373222_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_017685558.1|2373209_2373554_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373616_2375188_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2375981_2376293_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376485_2377606_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377733_2377928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384010_2385172_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385557_2387021_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387153_2388704_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388700_2388850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389015_2390136_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391249_2392107_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392159_2392657_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392777_2394193_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394202_2395387_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395383_2396982_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398164_2398410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398820_2399006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399161_2400073_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400194_2401037_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401239_2402613_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2402922_2404434_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404586_2405318_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405424_2406726_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406733_2407642_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407638_2408232_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408275_2408689_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408685_2409156_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409162_2409768_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411569_2413354_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413350_2414736_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414721_2415684_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415753_2416383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416420_2417629_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417750_2418320_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418451_2420005_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420308_2421529_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2421936_2422839_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422835_2423705_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423701_2424553_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424549_2425374_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425648_2426869_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043168	Bordetella holmesii strain F593 chromosome, complete genome	3696516	2626216	2673843	3696516	transposase,protease,tRNA	Bacillus_phage(25.0%)	47	NA	NA
WP_005015146.1|2626216_2626969_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005015148.1|2627011_2627731_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005015150.1|2627773_2628829_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_101557744.1|2629838_2630958_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015154.1|2631518_2632097_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_005012861.1|2632239_2633460_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005015155.1|2633764_2634742_+	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_005015156.1|2634890_2635721_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015157.1|2635834_2636650_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015162.1|2636672_2637527_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015163.1|2637525_2637909_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005015164.1|2638015_2639389_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
WP_005019837.1|2639460_2639952_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_005015166.1|2639951_2640704_-	membrane protein	NA	NA	NA	NA	NA
WP_005015167.1|2641051_2641255_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_005015168.1|2641284_2641707_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_005015169.1|2641718_2642816_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005015170.1|2642828_2644298_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_005015171.1|2644419_2645259_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
WP_005019846.1|2645280_2646138_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_005015173.1|2646210_2647329_-	porin	NA	NA	NA	NA	NA
WP_005015175.1|2647315_2647930_-	magnesium transporting ATPase P-type 1	NA	NA	NA	NA	NA
WP_101557744.1|2647959_2649080_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015176.1|2649123_2649753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015177.1|2649910_2651254_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005015178.1|2651262_2651646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015179.1|2651805_2652957_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_005015180.1|2653055_2654006_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015181.1|2654149_2655175_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005015182.1|2655215_2655455_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_005019849.1|2655520_2657110_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	4.3e-64
WP_005015184.1|2657109_2657655_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A088FT24	Mycobacterium_phage	30.8	3.5e-05
WP_005015187.1|2657738_2658311_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005019851.1|2658314_2659082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015190.1|2659113_2659449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015191.1|2659372_2660440_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.5	2.1e-06
WP_005015192.1|2660436_2662257_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.9	8.7e-77
WP_005015193.1|2662372_2663581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015194.1|2663814_2664516_+	response regulator	NA	W8CYM9	Bacillus_phage	36.6	2.8e-31
WP_005015195.1|2664528_2666007_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005015196.1|2666022_2667075_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005019853.1|2667071_2668409_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005015199.1|2668527_2670288_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	52.4	2.2e-170
WP_005015201.1|2670473_2671316_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_005015204.1|2671409_2672225_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_005015207.1|2672228_2672501_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005012365.1|2672622_2673843_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
>prophage 10
NZ_CP043168	Bordetella holmesii strain F593 chromosome, complete genome	3696516	2936329	3013389	3696516	transposase,integrase,tRNA	Ralstonia_virus(21.43%)	56	2938556:2938615	2987410:2987780
WP_005019978.1|2936329_2937109_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937131_2938079_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938080_2938281_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
2938556:2938615	attL	TGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGCA	NA	NA	NA	NA
WP_101557744.1|2938615_2939735_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015714.1|2940056_2940773_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940769_2941663_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941826_2943047_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943199_2944282_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2945961_2946945_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947007_2948420_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948537_2949380_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949658_2950267_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950282_2950903_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2950968_2951676_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951680_2952403_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952389_2952680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952755_2953976_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954700_2955552_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955603_2956857_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957033_2957822_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2957941_2958856_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2958988_2960881_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961066_2962446_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962890_2963187_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2966987_2967590_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967723_2968182_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968183_2968783_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968791_2969601_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969635_2970490_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970609_2971197_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971193_2972573_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973077_2973224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2980895_2982236_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982249_2983101_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983112_2984378_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984439_2986344_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988319_2989174_-	hypothetical protein	NA	NA	NA	NA	NA
2987410:2987780	attR	TGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGCAATGAAGAAACGATTTACGGAAGAGCAAATCATCGGCGTGCTCAAGGAAGCCGATGCAGGTGCCAAGCCCGCAGAGTTGTGCCGCAAGCACGGAATCTCCGAGGCAACGTACTACAACTGGAAGGCGAAGTTCGGTGGCATGACGGTGTCGGACGCTCAGAGGCTCAAGGAGCTGGAGCAGGAGAACAACAAGCTCAAGAAGCTGTTGGCCGAGTCGATGCTGGACAAGGCGGCGCTTCAGGATCTGCTAAGCCGAAAGTAGTCAGCCCGCAGGCCAAACGCGAGGCGGTCAGGACATTAATGACCGAGCGC	NA	NA	NA	NA
WP_005015806.1|2989166_2989961_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990176_2991127_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991729_2992527_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992566_2993220_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993200_2994265_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994428_2996654_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996899_2998744_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998860_2999733_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999779_3001480_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001542_3002742_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002752_3003631_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003737_3004775_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004855_3005260_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005271_3006729_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007371_3007968_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008128_3008587_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009364_3010336_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010457_3010877_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012168_3013389_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
