The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043167	Bordetella holmesii strain F594 chromosome, complete genome	3699061	917602	994820	3699061	transposase,tRNA	Ralstonia_virus(41.67%)	57	NA	NA
WP_005012353.1|917602_918607_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005012355.1|918634_919504_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012356.1|919670_920747_+	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	1.9e-26
WP_005012357.1|920724_922485_+	putative 2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005012358.1|922516_922981_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_111118761.1|923024_923264_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_005012362.1|924381_925509_+	TIGR03364 family FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005012363.1|925550_926045_-	DUF2214 family protein	NA	NA	NA	NA	NA
WP_005012364.1|926089_926773_-	Fe2+-dependent dioxygenase	NA	A0A1D8KSK5	Synechococcus_phage	39.5	3.9e-14
WP_005018941.1|926782_928966_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005012365.1|929105_930326_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
WP_005012366.1|930456_932739_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_005012367.1|932912_935570_-	alpha-ketoglutarate dehydrogenase	NA	NA	NA	NA	NA
WP_005012368.1|935805_937851_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_005012370.1|938188_941059_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_032953942.1|941105_942329_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_005012371.1|942399_943827_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	1.6e-41
WP_005012372.1|943904_944996_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_005012373.1|945134_945656_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_076879484.1|945652_946564_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005012375.1|946657_949117_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005012376.1|949349_949514_+	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_005012379.1|951124_951463_+	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_005012380.1|951506_952829_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005012381.1|952882_955270_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_005012382.1|955435_957484_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	28.0	3.2e-75
WP_161635715.1|957549_958344_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_005018948.1|958450_959410_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_005018950.1|959397_960162_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_005012385.1|960287_961913_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_005012386.1|961962_962700_+	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_005012387.1|962791_963352_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_005012388.1|963524_964064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012390.1|964066_964399_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_005012391.1|964409_965255_+	permease	NA	NA	NA	NA	NA
WP_005012392.1|965276_966656_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_005012393.1|966704_967616_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_005012394.1|967782_968118_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|968167_969388_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012396.1|969509_969674_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_005012397.1|969731_969932_-	CsbD family protein	NA	NA	NA	NA	NA
WP_005012398.1|970236_970770_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	43.3	8.3e-12
WP_005012399.1|976392_978669_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.3	6.6e-58
WP_005012400.1|978665_979145_+	DUF1854 domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|980199_981420_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012402.1|981641_982445_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012403.1|982478_983687_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_005012405.1|983768_984197_+	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_005012406.1|984529_986086_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_032966220.1|986122_986443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005018961.1|986578_987310_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005012409.1|987368_987893_+	DedA family protein	NA	NA	NA	NA	NA
WP_005012410.1|987944_989384_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012413.1|990350_990680_+	type II toxin-antitoxin system PrlF family antitoxin	NA	NA	NA	NA	NA
WP_005012414.1|990676_991183_+	type II toxin-antitoxin system YhaV family toxin	NA	NA	NA	NA	NA
WP_101557744.1|992406_993526_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005011985.1|993599_994820_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043167	Bordetella holmesii strain F594 chromosome, complete genome	3699061	1096603	1203392	3699061	protease,transposase,tRNA	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1096603_1097824_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1097911_1098502_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1098498_1098801_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1098852_1099842_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1099962_1100844_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1101017_1101872_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1101903_1102752_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1102879_1104100_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1104118_1104685_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1104882_1106034_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1106172_1107177_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1107333_1108305_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1108383_1109172_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1109243_1109480_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1109488_1110400_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1110443_1112315_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1112475_1113273_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1113504_1113879_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1113955_1114279_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1114362_1114635_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1114649_1115105_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1115226_1116063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1116059_1117433_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1117509_1118466_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1118553_1119531_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1119655_1121311_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1121359_1121824_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1121820_1122282_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1122507_1123695_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1123691_1124996_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1124992_1126402_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1126595_1127715_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1127850_1128870_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1128878_1131584_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1131723_1132377_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1132439_1132802_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1133368_1134829_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1135091_1136165_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1136249_1137470_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1139227_1140348_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1140321_1141821_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1141834_1142938_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1142942_1144193_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1144189_1145635_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1145631_1145946_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1145947_1147066_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1147248_1148469_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1148568_1149435_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1149495_1150476_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1150622_1151543_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1151551_1152664_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1152745_1153567_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1153642_1154251_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1154388_1155765_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1155826_1156270_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1156336_1156993_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1157035_1158155_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1158324_1158606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1159316_1160105_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1160101_1161208_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1161882_1163241_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1163355_1163553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1163570_1164691_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1164784_1165339_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1165926_1167243_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1167255_1168269_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1168815_1169766_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1169845_1170145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1171505_1173164_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1173312_1174533_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1174650_1175934_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1175937_1176879_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1176988_1177447_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1177827_1178448_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1178855_1181276_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1181383_1182121_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1182167_1183412_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1183734_1184007_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1184590_1185319_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1185340_1186258_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1186257_1186767_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1186883_1187555_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1187664_1188732_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1188751_1190596_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1190732_1191920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1192220_1193006_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1193029_1194149_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1194253_1195591_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1195700_1196642_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1196697_1197879_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1198037_1198328_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1198374_1199043_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1199039_1199327_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1199703_1200489_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1200521_1201256_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1202171_1203392_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 3
NZ_CP043167	Bordetella holmesii strain F594 chromosome, complete genome	3699061	1208179	1264585	3699061	protease,transposase,tRNA	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1208179_1209130_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1209211_1209691_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1210902_1212102_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1212247_1212625_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1212648_1214430_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1214438_1215176_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1215460_1217020_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1217079_1217838_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1217934_1218591_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1218744_1219509_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1219523_1219703_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1219728_1220763_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1220759_1221173_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1221169_1221754_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1222106_1223465_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1223558_1224137_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1224261_1225382_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1225454_1226711_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1226814_1228020_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1228083_1228533_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1228665_1228911_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1229135_1229450_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1234703_1236809_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1236862_1239172_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1240525_1242193_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1242195_1242861_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1242993_1246800_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1247025_1248171_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1248289_1249219_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1249215_1250292_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1250288_1251095_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1251091_1251823_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1252199_1253438_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1253485_1253824_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1254071_1255022_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1255340_1255523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1255588_1256809_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1256902_1258123_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1258182_1258446_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1258567_1260067_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1260114_1260390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1260487_1260685_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1260700_1261060_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1261132_1262155_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1262167_1264585_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP043167	Bordetella holmesii strain F594 chromosome, complete genome	3699061	1652956	1693309	3699061	transposase,integrase,tRNA	Leptospira_phage(28.57%)	39	1645398:1645414	1690015:1690031
1645398:1645414	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|1652956_1654076_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654728_1655484_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655660_1656455_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656451_1656889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1657000_1657153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657573_1658542_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658698_1659706_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659763_1660222_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1660295_1661642_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661659_1662031_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1662030_1663500_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663655_1664381_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664394_1667109_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667360_1668725_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668764_1669823_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669850_1670669_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670706_1670985_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1672248_1672548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1673117_1674521_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674533_1675184_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675325_1676546_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676576_1677653_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677799_1678930_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1679116_1680742_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680748_1681564_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681578_1682649_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682700_1683360_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683999_1685162_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1685203_1685518_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685501_1685888_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685926_1686193_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686585_1687275_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687374_1687536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687686_1687851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687977_1688214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688403_1688652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688765_1690136_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1690015:1690031	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1690136_1690877_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691356_1693309_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 6
NZ_CP043167	Bordetella holmesii strain F594 chromosome, complete genome	3699061	1711603	1755530	3699061	transposase,holin,integrase,tRNA	Leptospira_phage(33.33%)	37	1754098:1754112	1760574:1760588
WP_005019367.1|1711603_1714465_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714454_1715420_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1716176_1717652_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717656_1717932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1718268_1719388_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1719262_1719511_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719689_1720898_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720894_1723177_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1723187_1725569_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725832_1727740_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727754_1728645_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728651_1729785_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729784_1730606_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730630_1731821_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1732122_1732404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732569_1732890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732929_1734016_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1734212_1734473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734965_1735736_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735732_1736743_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_050597667.1|1736801_1737620_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.2e-54
WP_005013673.1|1738082_1738868_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739727_1740847_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741913_1742918_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742993_1743806_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1744033_1746205_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1746258_1747578_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747666_1748887_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1749105_1749966_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749962_1751186_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751484_1751982_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1752020_1752803_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752828_1753047_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1753121_1753391_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753610_1754075_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1754098:1754112	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1754148_1754430_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754546_1755530_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760574:1760588	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 7
NZ_CP043167	Bordetella holmesii strain F594 chromosome, complete genome	3699061	1780806	1822197	3699061	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780806_1781757_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781753_1782269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782626_1783247_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783346_1783598_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783685_1785164_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1785160_1788331_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788343_1789540_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789728_1790661_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790729_1791461_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791526_1792162_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1792147_1793326_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793486_1794035_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1794115_1794475_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794522_1795743_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795818_1796940_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796977_1797691_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797701_1798922_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1799004_1799559_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799704_1800655_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800614_1800776_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800816_1801743_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801756_1802629_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802791_1803739_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1804077_1804659_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1805236_1806187_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1806166_1806919_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806931_1807663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807819_1809985_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1810074_1810344_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810432_1810639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810637_1811156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1811174_1811954_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1812121_1813138_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1813210_1813702_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813712_1815428_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816591_1817542_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1819193_1820435_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820446_1821220_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1821246_1822197_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP043167	Bordetella holmesii strain F594 chromosome, complete genome	3699061	2150411	2210534	3699061	protease,transposase,tRNA	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150411_2150900_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150892_2151741_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151832_2152330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152467_2152827_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152823_2153105_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2153104_2153587_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153588_2155217_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2155213_2155558_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155559_2158502_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158947_2159919_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159908_2161291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161433_2162384_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162343_2163585_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163581_2164703_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2166194_2166662_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166732_2167383_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167469_2168609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168777_2169782_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169778_2171026_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171378_2172245_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2172204_2173809_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173820_2174507_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174503_2175544_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175659_2176331_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2176327_2177320_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177316_2178255_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2178251_2179406_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179414_2180866_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180896_2181379_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181380_2182274_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2182270_2182714_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182726_2183101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2183243_2183642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183768_2184056_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2184052_2184469_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184644_2185277_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185305_2185752_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2186038_2187190_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187303_2188308_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189291_2189999_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189931_2191383_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191388_2194547_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194559_2195081_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2195070_2195895_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195891_2196491_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196599_2198456_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198604_2199609_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199817_2201080_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2201084_2201420_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201416_2202346_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202350_2203064_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2203167_2204625_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204621_2204918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2205042_2206401_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206501_2207302_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207481_2208600_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208672_2209044_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2209050_2209902_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209922_2210534_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 9
NZ_CP043167	Bordetella holmesii strain F594 chromosome, complete genome	3699061	2305657	2427168	3699061	protease,transposase,integrase,tRNA	Leptospira_phage(15.15%)	106	2337187:2337246	2358494:2358768
WP_101557807.1|2305657_2306820_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306932_2307901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307897_2308818_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308914_2313393_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313771_2318106_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318744_2319308_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319319_2319565_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319720_2320230_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320275_2321256_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321467_2323819_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323865_2324696_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324692_2325382_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325374_2326655_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326752_2327691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327672_2329379_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329456_2330560_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330612_2331362_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331368_2332883_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005014513.1|2332895_2333183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2333203_2334091_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2334241_2334748_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334744_2335701_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335888_2337235_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2337187:2337246	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2337202_2337433_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337462_2338026_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2338180_2338951_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338947_2339958_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2340272_2340719_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340774_2340969_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340970_2341312_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341321_2343184_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2343223_2343730_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343733_2344057_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2344058_2344463_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344499_2345711_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345732_2346281_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346505_2346997_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2347211_2349242_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349316_2350519_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2351061_2351997_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2353030_2353312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353398_2353572_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353683_2354028_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2354099_2354768_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2356183_2357227_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2357223_2357325_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357416_2358536_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358786_2359440_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358494:2358768	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359555_2360776_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360826_2363256_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363421_2364720_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364824_2365478_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365480_2366791_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2367018_2367558_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2368036_2368303_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368341_2368707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368588_2369599_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369595_2370366_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370451_2371111_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2371078_2371570_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371679_2371883_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2372200_2372521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372504_2372840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372894_2373107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2373182_2373521_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_017685558.1|2373508_2373853_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373915_2375487_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376280_2376592_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376784_2377905_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2378032_2378227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384309_2385471_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385856_2387320_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387452_2389003_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388999_2389149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389314_2390435_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391548_2392406_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392458_2392956_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153568005.1|2393076_2394492_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394501_2395686_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395682_2397281_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398463_2398709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2399119_2399305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399460_2400372_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400493_2401336_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401538_2402912_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2403221_2404733_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404885_2405617_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405723_2407025_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2407032_2407941_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407937_2408531_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408574_2408988_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408984_2409455_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409461_2410067_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411868_2413653_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413649_2415035_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2415020_2415983_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2416052_2416682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416719_2417928_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2418049_2418619_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418750_2420304_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420607_2421828_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2422235_2423138_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2423134_2424004_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2424000_2424852_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424848_2425673_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425947_2427168_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 10
NZ_CP043167	Bordetella holmesii strain F594 chromosome, complete genome	3699061	2472161	2535652	3699061	protease,transposase,tRNA	Ralstonia_virus(25.0%)	49	NA	NA
WP_005014858.1|2472161_2472809_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_005014859.1|2472893_2473520_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_005014860.1|2473584_2474430_+	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	35.1	2.4e-37
WP_005014861.1|2474759_2475311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014864.1|2476074_2476368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014865.1|2476582_2476912_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014866.1|2477495_2478956_+	cardiolipin synthetase	NA	NA	NA	NA	NA
WP_005014867.1|2479515_2480751_-	MFS transporter	NA	NA	NA	NA	NA
WP_005014869.1|2480877_2481351_-	RidA family protein	NA	NA	NA	NA	NA
WP_005014872.1|2481347_2482358_-	DUF4392 domain-containing protein	NA	NA	NA	NA	NA
WP_005014873.1|2482422_2483388_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_101557807.1|2484616_2485779_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005014877.1|2486048_2486966_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|2487264_2488215_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014880.1|2488320_2489607_+	phospholipase	NA	NA	NA	NA	NA
WP_005014882.1|2489700_2490300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014883.1|2490524_2491046_-	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_005014885.1|2491311_2491866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014886.1|2491885_2493247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012682.1|2495502_2496723_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005014890.1|2497539_2498646_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_005014891.1|2498792_2499302_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_005014894.1|2499325_2500306_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005014896.1|2500263_2501727_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_005019767.1|2501723_2502896_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005014898.1|2502892_2504113_+	CoA transferase	NA	NA	NA	NA	NA
WP_005014899.1|2504109_2504907_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014902.1|2505755_2510435_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	28.4	1.1e-27
WP_005014904.1|2513583_2514546_-	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005019769.1|2514542_2515061_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014908.1|2515214_2515535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557860.1|2516220_2517340_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.4	3.1e-56
WP_005014910.1|2518750_2519518_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014912.1|2519527_2520193_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_076879499.1|2520129_2520489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014913.1|2520521_2521352_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005014916.1|2521379_2521940_-	dioxygenase	NA	NA	NA	NA	NA
WP_005014918.1|2522054_2522855_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014920.1|2522849_2524439_-	mucoidy inhibitor MuiA family protein	NA	NA	NA	NA	NA
WP_005014922.1|2524551_2525310_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.7	7.4e-14
WP_005014928.1|2525306_2526236_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_005014929.1|2526261_2527251_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	43.8	1.4e-65
WP_005014930.1|2527253_2528168_-	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014931.1|2528454_2529606_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_005014932.1|2529650_2530085_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_005014933.1|2530106_2530859_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_005014935.1|2531045_2532020_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005014938.1|2532883_2534356_-	amidase	NA	NA	NA	NA	NA
WP_005012861.1|2534431_2535652_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
>prophage 11
NZ_CP043167	Bordetella holmesii strain F594 chromosome, complete genome	3699061	2567114	2633770	3699061	transposase,integrase,tRNA	Leptospira_phage(37.5%)	58	2606577:2606636	2632591:2632948
WP_005012067.1|2567114_2568065_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015017.1|2568061_2570128_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_003814042.1|2570127_2570400_-	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_017685545.1|2571094_2571184_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_005019802.1|2571183_2572968_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_005015022.1|2572991_2575157_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.9	7.8e-24
WP_005019804.1|2575167_2575767_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_003814052.1|2578530_2579226_+	two-component system response regulator KdpE	NA	NA	NA	NA	NA
WP_005015028.1|2579234_2580476_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_003814057.1|2580625_2581606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015031.1|2581804_2583061_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
WP_003814061.1|2583263_2583689_+	DUF1841 family protein	NA	NA	NA	NA	NA
WP_003814063.1|2583739_2584102_-	cytochrome c	NA	NA	NA	NA	NA
WP_003814066.1|2584630_2585518_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_005015035.1|2585539_2586757_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_003814072.1|2586953_2587328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015039.1|2587660_2590411_+	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	28.1	1.5e-19
WP_005019808.1|2590579_2591725_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	60.8	4.0e-19
WP_005015048.1|2591825_2593751_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.7	2.7e-145
WP_005015056.1|2593839_2594214_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005015058.1|2594235_2594766_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_005015059.1|2594879_2595113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015061.1|2595199_2596291_-	ferrochelatase	NA	NA	NA	NA	NA
WP_005015063.1|2596323_2597328_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_005015074.1|2597437_2598337_+	NAD kinase	NA	NA	NA	NA	NA
WP_005015076.1|2598358_2600014_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_005015081.1|2602666_2603083_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_005015089.1|2603353_2603851_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_005015090.1|2603866_2604658_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_005015091.1|2604715_2605702_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
2606577:2606636	attL	TGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGCA	NA	NA	NA	NA
WP_101557809.1|2606630_2606897_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153570066.1|2606935_2607325_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.0	1.0e-27
WP_153570071.1|2607368_2608488_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080698364.1|2608529_2608691_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_005015101.1|2609207_2609861_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_025341186.1|2610042_2610750_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015108.1|2610746_2613362_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_005015113.1|2613418_2614603_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_005015114.1|2614663_2615272_+	LysE family translocator	NA	NA	NA	NA	NA
WP_005015116.1|2615394_2616420_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015118.1|2616483_2617014_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_076879502.1|2616893_2617235_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015120.1|2617231_2617939_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005019828.1|2617948_2618842_-	isocitrate lyase/PEP mutase family protein	NA	NA	NA	NA	NA
WP_005015124.1|2618825_2619584_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015127.1|2619875_2622551_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_005015129.1|2622567_2623929_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_005015132.1|2623948_2624671_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_005015134.1|2624675_2625674_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_005015136.1|2626094_2626403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015138.1|2626450_2627023_+	DUF2946 family protein	NA	NA	NA	NA	NA
WP_005015140.1|2627000_2627405_-	DoxX family protein	NA	NA	NA	NA	NA
WP_005015142.1|2627523_2628441_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015144.1|2628450_2629032_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005015146.1|2629028_2629781_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005015148.1|2629823_2630543_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005015150.1|2630585_2631641_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_101557744.1|2632650_2633770_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
2632591:2632948	attR	TGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGCAATGAAGAAACGATTTACGGAAGAGCAAATCATCGGCGTGCTCAAGGAAGCCGATGCAGGTGCCAAGCCCGCAGAGTTGTGCCGCAAGCACGGAATCTCCGAGGCAACGTACTACAACTGGAAGGCGAAGTTCGGTGGCATGACGGTGTCGGACGCTCAGAGGCTCAAGGAGCTGGAGCAGGAGAACAACAAGCTCAAGAAGCTGTTGGCCGAGTCGATGCTGGACAAGGCGGCGCTTCAGGATCTGCTAAGCCGAAAGTAGTCAGCCCGCAGGCCAAACGCGAGGCGGTCAGGACATT	NA	NA	NA	NA
>prophage 12
NZ_CP043167	Bordetella holmesii strain F594 chromosome, complete genome	3699061	2939141	3017152	3699061	protease,transposase,integrase,tRNA	Ralstonia_virus(23.08%)	56	2941368:2941427	3014828:3016027
WP_005019978.1|2939141_2939921_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2939943_2940891_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2940892_2941093_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
2941368:2941427	attL	TGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGCA	NA	NA	NA	NA
WP_005015714.1|2942870_2943587_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2943583_2944477_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2944640_2945861_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2946013_2947096_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2948775_2949759_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2949821_2951234_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2951351_2952194_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2952472_2953081_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2953096_2953717_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2953782_2954490_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2954494_2955217_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2955203_2955494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2955569_2956790_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2957514_2958366_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2958417_2959671_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2959847_2960636_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2960755_2961670_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2961802_2963695_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2963880_2965260_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2965704_2966001_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2969801_2970404_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2970537_2970996_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2970997_2971597_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2971605_2972415_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2972449_2973304_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2973423_2974011_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2974007_2975387_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2975891_2976038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2983709_2985050_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2985063_2985915_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2985926_2987192_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2987253_2989158_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2991133_2991988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015806.1|2991980_2992775_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2992990_2993941_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2994543_2995341_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2995380_2996034_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2996014_2997079_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2997242_2999468_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2999713_3001558_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|3001674_3002547_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|3002593_3004294_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3004356_3005556_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3005566_3006445_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3006551_3007589_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3007669_3008074_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3008085_3009543_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3010185_3010782_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3010942_3011401_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3012178_3013150_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3013271_3013691_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3014982_3016203_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
3014828:3016027	attR	TGCCATTCCTTTGGGAACGGACTCTACATCGATTTCGTACTAATCACGGGGAGCAGGTCAACCCAATTTTTATGGTTCATCGCGGAATAGCGTGGAGCCGTGCTTGATTGCCGTTACGCTTGATCCTTGATTTTTCAAGGATCAAGGCCGGGATCATGCTGGACCGCAAGACGATCGAGAGGTTGGGTGGGTGGGAAGGTTATCGGGTGGAGTGGGTCGTGTGGCCTGAAGGTGAGAGCCGGACGGTCACGATTTACCTGAAGCCTTCAGCGCGAACGATGCACTGCGAGCACTGCGGCAACCGATGTCGGCAGGTGCATGAGACGACCACGCGCCGGGTGCGGGATCTGCCGCTAATGGCGCTGCGAGTGACGCTGGTAGTGCCGCGTCGGCGGGTCTGGTGCGAGCAGTGCGGTGGACCGCATCTGGAGAGGCTGAGCTGGCTGGGCCGTTACCAGCGAGTGACCGACCGGCTGGCCGAGGCGGTCAGCCAGTTGCTTGAGTCCAGCAACATTCTGGCCGTGGCGCGCTTCTTCCAACTGGGTTGGCACACGGTCAAGGCGCTGGACAAGGCCCTGCTGCGACGGGCGATCCAAGAGCCGGACTGGAGCCAGATCCACTACCTAGCGATGGACGAGTTCGCTCTACACAAGGGCCATCGTTATGCCACGGTCGTTGTCGATCCGATCCGCCGTCAGGTGCTATGGATCGGTGATGGCCGCTCGCGCGAGACGGCCAGAGCCTTCTTCGAACAACTGCCAACAGGAGTTGCCCAGCAGATCCGGGCCGTAGCGATCGACATGACGACGGCCTATGAGCTGGAGATCCAGGCCAACTGCCCCAACGCCGAGATCGTCTACGACCTGTTCCACGTCGTGGCCAAGTACGGCCGTGAAGTGATAGACCGGGTGCGTGTAGACCAAGCGAACCAGTTGCGGCACGACAAGCCGGCCCGCCGGGTGATCAAGTCCAGTCGCTGGCTACTGCTGCGCAATCGCAAAAACCTCGATCCGTGCCAATCGGTAAAGTTGGACGAGTTGCTCCAGGCCAACCAGCCCTTGCTCACCGCTTATCTGATGCGCGATGAGCTCAAACAGCTGTGGTTCTACCAACACCCCGGCTACGCCCGCCAGGCATGGGATCACTGGCTGCAACAGGCTCAGGGCAGCGGCATCGCCGCCTTGGCTCACTTCGCGCTCA	NA	NA	NA	NA
WP_005020040.1|3016264_3017152_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
