The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043166	Bordetella holmesii strain F595 chromosome, complete genome	3697374	1096359	1203148	3697374	tRNA,protease,transposase	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1096359_1097580_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1097667_1098258_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1098254_1098557_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1098608_1099598_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1099718_1100600_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1100773_1101628_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1101659_1102508_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1102635_1103856_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1103874_1104441_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1104638_1105790_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1105928_1106933_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1107089_1108061_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1108139_1108928_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1108999_1109236_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1109244_1110156_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1110199_1112071_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1112231_1113029_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1113260_1113635_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1113711_1114035_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1114118_1114391_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1114405_1114861_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1114982_1115819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1115815_1117189_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1117265_1118222_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1118309_1119287_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1119411_1121067_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1121115_1121580_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1121576_1122038_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1122263_1123451_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1123447_1124752_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1124748_1126158_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1126351_1127471_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1127606_1128626_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1128634_1131340_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1131479_1132133_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1132195_1132558_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1133124_1134585_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1134847_1135921_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1136005_1137226_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1138983_1140104_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1140077_1141577_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1141590_1142694_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1142698_1143949_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1143945_1145391_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1145387_1145702_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1145703_1146822_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1147004_1148225_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1148324_1149191_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1149251_1150232_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1150378_1151299_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1151307_1152420_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1152501_1153323_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1153398_1154007_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1154144_1155521_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1155582_1156026_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1156092_1156749_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1156791_1157911_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1158080_1158362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1159072_1159861_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1159857_1160964_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1161638_1162997_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1163111_1163309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1163326_1164447_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1164540_1165095_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1165682_1166999_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1167011_1168025_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1168571_1169522_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1169601_1169901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1171261_1172920_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1173068_1174289_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1174406_1175690_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1175693_1176635_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1176744_1177203_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1177583_1178204_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1178611_1181032_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1181139_1181877_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1181923_1183168_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1183490_1183763_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1184346_1185075_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1185096_1186014_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1186013_1186523_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1186639_1187311_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1187420_1188488_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1188507_1190352_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1190488_1191676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1191976_1192762_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1192785_1193905_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1194009_1195347_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1195456_1196398_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1196453_1197635_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1197793_1198084_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1198130_1198799_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1198795_1199083_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1199459_1200245_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1200277_1201012_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1201927_1203148_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043166	Bordetella holmesii strain F595 chromosome, complete genome	3697374	1207935	1264341	3697374	tRNA,protease,transposase	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1207935_1208886_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1208967_1209447_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1210658_1211858_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1212003_1212381_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1212404_1214186_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1214194_1214932_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1215216_1216776_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1216835_1217594_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1217690_1218347_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1218500_1219265_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1219279_1219459_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1219484_1220519_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1220515_1220929_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1220925_1221510_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1221862_1223221_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1223314_1223893_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1224017_1225138_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1225210_1226467_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1226570_1227776_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1227839_1228289_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1228421_1228667_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1228891_1229206_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1234459_1236565_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1236618_1238928_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1240281_1241949_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1241951_1242617_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1242749_1246556_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1246781_1247927_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1248045_1248975_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1248971_1250048_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1250044_1250851_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1250847_1251579_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1251955_1253194_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1253241_1253580_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1253827_1254778_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1255096_1255279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1255344_1256565_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1256658_1257879_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1257938_1258202_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1258323_1259823_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1259870_1260146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1260243_1260441_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1260456_1260816_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1260888_1261911_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1261923_1264341_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043166	Bordetella holmesii strain F595 chromosome, complete genome	3697374	1653761	1694135	3697374	tRNA,integrase,transposase	Leptospira_phage(28.57%)	39	1646203:1646219	1690820:1690836
1646203:1646219	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|1653761_1654881_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1655533_1656289_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1656465_1657260_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1657256_1657694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1657805_1657958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1658378_1659347_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1659503_1660511_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1660568_1661027_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1661100_1662447_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1662464_1662836_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1662835_1664305_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1664460_1665186_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1665199_1667914_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1668165_1669530_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1669569_1670628_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1670655_1671474_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1671511_1671790_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1673053_1673353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1673922_1675326_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1675338_1675989_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1676130_1677351_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1677381_1678458_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1678604_1679735_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1679921_1681547_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1681553_1682369_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1682383_1683454_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1683505_1684165_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1684804_1685967_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1686008_1686323_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1686306_1686693_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1686731_1686998_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1687390_1688080_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1688179_1688341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1688491_1688656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1688782_1689019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153570043.1|1689208_1689457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1689570_1690941_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1690820:1690836	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1690941_1691682_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1692182_1694135_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 5
NZ_CP043166	Bordetella holmesii strain F595 chromosome, complete genome	3697374	1712429	1756356	3697374	integrase,holin,transposase,tRNA	Leptospira_phage(33.33%)	37	1754924:1754938	1761400:1761414
WP_005019367.1|1712429_1715291_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1715280_1716246_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1717002_1718478_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1718482_1718758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1719094_1720214_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1720088_1720337_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1720515_1721724_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1721720_1724003_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1724013_1726395_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1726658_1728566_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1728580_1729471_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1729477_1730611_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1730610_1731432_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1731456_1732647_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1732948_1733230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1733395_1733716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1733755_1734842_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1735038_1735299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1735791_1736562_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1736558_1737569_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1737603_1738446_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1738908_1739694_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1740553_1741673_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1742739_1743744_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1743819_1744632_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1744859_1747031_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1747084_1748404_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1748492_1749713_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1749931_1750792_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1750788_1752012_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1752310_1752808_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1752846_1753629_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1753654_1753873_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1753947_1754217_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1754436_1754901_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1754924:1754938	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1754974_1755256_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1755372_1756356_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1761400:1761414	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP043166	Bordetella holmesii strain F595 chromosome, complete genome	3697374	1781632	1823023	3697374	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1781632_1782583_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1782579_1783095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1783452_1784073_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1784172_1784424_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1784511_1785990_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1785986_1789157_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1789169_1790366_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1790554_1791487_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1791555_1792287_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1792352_1792988_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1792973_1794152_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1794312_1794861_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1794941_1795301_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1795348_1796569_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1796644_1797766_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1797803_1798517_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1798527_1799748_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1799830_1800385_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1800530_1801481_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1801440_1801602_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1801642_1802569_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1802582_1803455_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1803617_1804565_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1804903_1805485_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1806062_1807013_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1806992_1807745_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1807757_1808489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1808645_1810811_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1810900_1811170_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1811258_1811465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1811463_1811982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1812000_1812780_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1812947_1813964_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1814036_1814528_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1814538_1816254_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1817417_1818368_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1820019_1821261_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1821272_1822046_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1822072_1823023_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043166	Bordetella holmesii strain F595 chromosome, complete genome	3697374	2150187	2210310	3697374	protease,transposase,tRNA	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150187_2150676_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150668_2151517_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151608_2152106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152243_2152603_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152599_2152881_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152880_2153363_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153364_2154993_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154989_2155334_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155335_2158278_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158723_2159695_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159684_2161067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161209_2162160_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162119_2163361_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163357_2164479_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165970_2166438_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166508_2167159_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167245_2168385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168553_2169558_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169554_2170802_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171154_2172021_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171980_2173585_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173596_2174283_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174279_2175320_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175435_2176107_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2176103_2177096_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177092_2178031_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2178027_2179182_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179190_2180642_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180672_2181155_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181156_2182050_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2182046_2182490_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182502_2182877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2183019_2183418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183544_2183832_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183828_2184245_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184420_2185053_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185081_2185528_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185814_2186966_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187079_2188084_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189067_2189775_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189707_2191159_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191164_2194323_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194335_2194857_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194846_2195671_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195667_2196267_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196375_2198232_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198380_2199385_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199593_2200856_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200860_2201196_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201192_2202122_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202126_2202840_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202943_2204401_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204397_2204694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204818_2206177_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206277_2207078_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207257_2208376_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208448_2208820_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208826_2209678_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209698_2210310_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043166	Bordetella holmesii strain F595 chromosome, complete genome	3697374	2305433	2426944	3697374	protease,tRNA,integrase,transposase	Leptospira_phage(15.15%)	105	2336963:2337022	2358270:2358544
WP_101557807.1|2305433_2306596_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306708_2307677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307673_2308594_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308690_2313169_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313547_2317882_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318520_2319084_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319095_2319341_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319496_2320006_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320051_2321032_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321243_2323595_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323641_2324472_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324468_2325158_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325150_2326431_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326528_2327467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327448_2329155_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329232_2330336_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330388_2331138_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331144_2332659_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005014513.1|2332671_2332959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332979_2333867_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2334017_2334524_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334520_2335477_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335664_2337011_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336963:2337022	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2336978_2337209_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337238_2337802_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337956_2338727_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338723_2339734_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2340048_2340495_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340550_2340745_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340746_2341088_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341097_2342960_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2342999_2343506_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343509_2343833_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343834_2344239_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344275_2345487_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345508_2346057_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346281_2346773_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2346987_2349018_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349092_2350295_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350837_2351773_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352806_2353088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353174_2353348_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353459_2353804_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353875_2354544_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355959_2357003_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2356999_2357101_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357192_2358312_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358562_2359216_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358270:2358544	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359331_2360552_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360602_2363032_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363197_2364496_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364600_2365254_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365256_2366567_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366794_2367334_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367812_2368079_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368117_2368483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368364_2369375_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369371_2370142_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370227_2370887_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370854_2371346_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371455_2371659_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371976_2372297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372280_2372616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372670_2372883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372958_2373297_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2373293_2373629_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373691_2375263_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376056_2376368_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376560_2377681_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377808_2378003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384085_2385247_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385632_2387096_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387228_2388779_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388775_2388925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389090_2390211_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391324_2392182_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392234_2392732_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392852_2394268_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394277_2395462_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395458_2397057_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398239_2398485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398895_2399081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399236_2400148_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400269_2401112_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014726.1|2402997_2404509_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404661_2405393_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405499_2406801_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406808_2407717_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407713_2408307_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408350_2408764_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408760_2409231_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409237_2409843_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411644_2413429_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413425_2414811_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414796_2415759_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415828_2416458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416495_2417704_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417825_2418395_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418526_2420080_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420383_2421604_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2422011_2422914_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422910_2423780_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423776_2424628_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424624_2425449_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425723_2426944_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043166	Bordetella holmesii strain F595 chromosome, complete genome	3697374	2626291	2673917	3697374	protease,transposase,tRNA	Bacillus_phage(25.0%)	47	NA	NA
WP_005015146.1|2626291_2627044_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005015148.1|2627086_2627806_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005015150.1|2627848_2628904_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_101557744.1|2629913_2631033_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015154.1|2631593_2632172_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_005012861.1|2632314_2633535_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005015155.1|2633839_2634817_+	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_005015156.1|2634965_2635796_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015157.1|2635909_2636725_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015162.1|2636747_2637602_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015163.1|2637600_2637984_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005015164.1|2638090_2639464_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
WP_005019837.1|2639535_2640027_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_005015166.1|2640026_2640779_-	membrane protein	NA	NA	NA	NA	NA
WP_005015167.1|2641126_2641330_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_005015168.1|2641359_2641782_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_005015169.1|2641793_2642891_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005015170.1|2642903_2644373_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_005015171.1|2644494_2645334_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
WP_005019846.1|2645355_2646213_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_005015173.1|2646285_2647404_-	porin	NA	NA	NA	NA	NA
WP_005015175.1|2647390_2648005_-	magnesium transporting ATPase P-type 1	NA	NA	NA	NA	NA
WP_101557744.1|2648034_2649155_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015176.1|2649198_2649828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015177.1|2649985_2651329_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005015178.1|2651337_2651721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015179.1|2651880_2653032_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_005015180.1|2653130_2654081_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015181.1|2654224_2655250_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005015182.1|2655290_2655530_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_005019849.1|2655595_2657185_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	4.3e-64
WP_005015184.1|2657184_2657730_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A088FT24	Mycobacterium_phage	30.8	3.5e-05
WP_005015187.1|2657813_2658386_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005019851.1|2658389_2659157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015190.1|2659188_2659524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015191.1|2659447_2660515_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.5	2.1e-06
WP_005015192.1|2660511_2662332_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.9	8.7e-77
WP_005015193.1|2662447_2663656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015194.1|2663888_2664590_+	response regulator	NA	W8CYM9	Bacillus_phage	36.6	2.8e-31
WP_005015195.1|2664602_2666081_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005015196.1|2666096_2667149_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005019853.1|2667145_2668483_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005015199.1|2668601_2670362_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	52.4	2.2e-170
WP_005015201.1|2670547_2671390_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_005015204.1|2671483_2672299_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_005015207.1|2672302_2672575_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005012365.1|2672696_2673917_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
>prophage 10
NZ_CP043166	Bordetella holmesii strain F595 chromosome, complete genome	3697374	2936403	3014145	3697374	protease,integrase,transposase,tRNA	Ralstonia_virus(23.08%)	56	2938630:2938689	2987217:2988148
WP_005019978.1|2936403_2937183_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937205_2938153_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938154_2938355_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
2938630:2938689	attL	TGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGCA	NA	NA	NA	NA
WP_005015714.1|2939863_2940580_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940576_2941470_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941633_2942854_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943006_2944089_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2945768_2946752_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2946814_2948227_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948344_2949187_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949465_2950074_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950089_2950710_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2950775_2951483_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951487_2952210_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952196_2952487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952562_2953783_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954507_2955359_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955410_2956664_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2956840_2957629_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2957748_2958663_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2958795_2960688_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2960873_2962253_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962697_2962994_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2966794_2967397_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967530_2967989_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2967990_2968590_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968598_2969408_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969442_2970297_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970416_2971004_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971000_2972380_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2972884_2973031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2980702_2982043_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982056_2982908_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2982919_2984185_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984246_2986151_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988126_2988981_-	hypothetical protein	NA	NA	NA	NA	NA
2987217:2988148	attR	TGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGCAATGAAGAAACGATTTACGGAAGAGCAAATCATCGGCGTGCTCAAGGAAGCCGATGCAGGTGCCAAGCCCGCAGAGTTGTGCCGCAAGCACGGAATCTCCGAGGCAACGTACTACAACTGGAAGGCGAAGTTCGGTGGCATGACGGTGTCGGACGCTCAGAGGCTCAAGGAGCTGGAGCAGGAGAACAACAAGCTCAAGAAGCTGTTGGCCGAGTCGATGCTGGACAAGGCGGCGCTTCAGGATCTGCTAAGCCGAAAGTAGTCAGCCCGCAGGCCAAACGCGAGGCGGTCAGGACATTAATGACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2988973_2989768_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2989983_2990934_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991536_2992334_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992373_2993027_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993007_2994072_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994235_2996461_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996706_2998551_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998667_2999540_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999586_3001287_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001349_3002549_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002559_3003438_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003544_3004582_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004662_3005067_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005078_3006536_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007178_3007775_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3007935_3008394_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009171_3010143_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010264_3010684_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3011975_3013196_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
WP_005020040.1|3013257_3014145_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
