The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043160	Bordetella holmesii strain H108 chromosome, complete genome	3696773	1095303	1202092	3696773	transposase,protease,tRNA	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095303_1096524_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096611_1097202_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097198_1097501_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097552_1098542_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098662_1099544_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099717_1100572_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100603_1101452_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101579_1102800_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102818_1103385_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103582_1104734_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104872_1105877_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106033_1107005_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107083_1107872_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107943_1108180_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108188_1109100_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109143_1111015_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111175_1111973_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112204_1112579_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112655_1112979_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113062_1113335_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113349_1113805_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113926_1114763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114759_1116133_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116209_1117166_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117253_1118231_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118355_1120011_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120059_1120524_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120520_1120982_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121207_1122395_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122391_1123696_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123692_1125102_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125295_1126415_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126550_1127570_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127578_1130284_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130423_1131077_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131139_1131502_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132068_1133529_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133791_1134865_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134949_1136170_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137927_1139048_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1139021_1140521_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140534_1141638_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141642_1142893_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142889_1144335_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144331_1144646_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144647_1145766_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145948_1147169_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147268_1148135_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148195_1149176_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149322_1150243_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150251_1151364_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151445_1152267_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152342_1152951_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153088_1154465_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154526_1154970_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155036_1155693_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155735_1156855_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1157024_1157306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1158016_1158805_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158801_1159908_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160582_1161941_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162055_1162253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162270_1163391_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163484_1164039_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164626_1165943_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165955_1166969_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167515_1168466_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168545_1168845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170205_1171864_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1172012_1173233_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173350_1174634_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174637_1175579_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175688_1176147_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176527_1177148_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177555_1179976_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180083_1180821_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180867_1182112_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182434_1182707_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183290_1184019_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184040_1184958_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184957_1185467_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185583_1186255_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186364_1187432_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187451_1189296_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189432_1190620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190920_1191706_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191729_1192849_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192953_1194291_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194400_1195342_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195397_1196579_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196737_1197028_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197074_1197743_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197739_1198027_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198403_1199189_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199221_1199956_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200871_1202092_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043160	Bordetella holmesii strain H108 chromosome, complete genome	3696773	1206879	1263220	3696773	transposase,protease,tRNA	Ralstonia_virus(23.08%)	44	NA	NA
WP_005012808.1|1206879_1207830_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207911_1208391_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209602_1210802_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210947_1211325_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211348_1213130_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213138_1213876_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214160_1215720_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215779_1216538_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216634_1217291_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217444_1218209_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218223_1218403_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218428_1219463_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219459_1219873_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219869_1220454_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220806_1222165_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222258_1222837_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222961_1224082_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019101.1|1225449_1226655_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226718_1227168_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227300_1227546_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227770_1228085_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233338_1235444_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235497_1237807_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239160_1240828_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240830_1241496_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241628_1245435_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245660_1246806_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246924_1247854_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247850_1248927_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248923_1249730_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249726_1250458_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250834_1252073_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252120_1252459_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252706_1253657_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1253975_1254158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254223_1255444_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255537_1256758_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256817_1257081_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257202_1258702_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1258749_1259025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259122_1259320_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259335_1259695_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259767_1260790_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260802_1263220_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043160	Bordetella holmesii strain H108 chromosome, complete genome	3696773	1651591	1691959	3696773	integrase,transposase,tRNA	Leptospira_phage(28.57%)	39	1644033:1644049	1688650:1688666
1644033:1644049	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|1651591_1652711_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1653363_1654119_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1654295_1655090_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1655086_1655524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1655635_1655788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1656208_1657177_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1657333_1658341_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1658398_1658857_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1658930_1660277_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1660294_1660666_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1660665_1662135_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1662290_1663016_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1663029_1665744_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1665995_1667360_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1667399_1668458_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1668485_1669304_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1669341_1669620_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1670883_1671183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1671752_1673156_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1673168_1673819_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1673960_1675181_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1675211_1676288_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1676434_1677565_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1677751_1679377_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1679383_1680199_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1680213_1681284_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1681335_1681995_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1682634_1683797_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1683838_1684153_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1684136_1684523_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1684561_1684828_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1685220_1685910_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1686009_1686171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1686321_1686486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1686612_1686849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1687038_1687287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1687400_1688771_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1688650:1688666	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1688771_1689512_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1690006_1691959_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 5
NZ_CP043160	Bordetella holmesii strain H108 chromosome, complete genome	3696773	1710253	1754180	3696773	integrase,holin,transposase,tRNA	Leptospira_phage(33.33%)	37	1752748:1752762	1759224:1759238
WP_005019367.1|1710253_1713115_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1713104_1714070_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1714826_1716302_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1716306_1716582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1716918_1718038_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1717912_1718161_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1718339_1719548_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1719544_1721827_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1721837_1724219_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1724482_1726390_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1726404_1727295_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1727301_1728435_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1728434_1729256_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1729280_1730471_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1730772_1731054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1731219_1731540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1731579_1732666_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1732862_1733123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1733615_1734386_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1734382_1735393_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1735427_1736270_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1736732_1737518_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1738377_1739497_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1740563_1741568_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1741643_1742456_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1742683_1744855_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1744908_1746228_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1746316_1747537_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1747755_1748616_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1748612_1749836_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1750134_1750632_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1750670_1751453_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1751478_1751697_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1751771_1752041_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1752260_1752725_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1752748:1752762	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1752798_1753080_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1753196_1754180_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1759224:1759238	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP043160	Bordetella holmesii strain H108 chromosome, complete genome	3696773	1779456	1820847	3696773	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1779456_1780407_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1780403_1780919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1781276_1781897_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1781996_1782248_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1782335_1783814_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1783810_1786981_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1786993_1788190_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1788378_1789311_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1789379_1790111_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1790176_1790812_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1790797_1791976_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1792136_1792685_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1792765_1793125_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1793172_1794393_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1794468_1795590_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1795627_1796341_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1796351_1797572_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1797654_1798209_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1798354_1799305_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1799264_1799426_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1799466_1800393_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1800406_1801279_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1801441_1802389_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1802727_1803309_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1803886_1804837_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1804816_1805569_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1805581_1806313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1806469_1808635_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1808724_1808994_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1809082_1809289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1809287_1809806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1809824_1810604_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1810771_1811788_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1811860_1812352_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1812362_1814078_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1815241_1816192_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1817843_1819085_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1819096_1819870_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1819896_1820847_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043160	Bordetella holmesii strain H108 chromosome, complete genome	3696773	2149061	2209184	3696773	transposase,protease,tRNA	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2149061_2149550_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2149542_2150391_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2150482_2150980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2151117_2151477_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2151473_2151755_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2151754_2152237_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2152238_2153867_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2153863_2154208_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2154209_2157152_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2157597_2158569_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2158558_2159941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2160083_2161034_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2160993_2162235_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2162231_2163353_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2164844_2165312_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2165382_2166033_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2166119_2167259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2167427_2168432_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2168428_2169676_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2170028_2170895_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2170854_2172459_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2172470_2173157_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2173153_2174194_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2174309_2174981_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2174977_2175970_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2175966_2176905_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2176901_2178056_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2178064_2179516_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2179546_2180029_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2180030_2180924_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2180920_2181364_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2181376_2181751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2181893_2182292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2182418_2182706_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2182702_2183119_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2183294_2183927_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2183955_2184402_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2184688_2185840_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2185953_2186958_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2187941_2188649_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2188581_2190033_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2190038_2193197_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2193209_2193731_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2193720_2194545_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2194541_2195141_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2195249_2197106_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2197254_2198259_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2198467_2199730_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2199734_2200070_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2200066_2200996_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2201000_2201714_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2201817_2203275_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2203271_2203568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2203692_2205051_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2205151_2205952_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2206131_2207250_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2207322_2207694_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2207700_2208552_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2208572_2209184_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043160	Bordetella holmesii strain H108 chromosome, complete genome	3696773	2304307	2425818	3696773	integrase,transposase,protease,tRNA	Leptospira_phage(15.15%)	106	2335837:2335896	2357144:2357418
WP_101557807.1|2304307_2305470_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2305582_2306551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2306547_2307468_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2307564_2312043_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2312421_2316756_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2317394_2317958_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2317969_2318215_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2318370_2318880_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2318925_2319906_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2320117_2322469_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2322515_2323346_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2323342_2324032_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2324024_2325305_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2325402_2326341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2326322_2328029_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2328106_2329210_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2329262_2330012_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2330018_2331533_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005014513.1|2331545_2331833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2331853_2332741_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2332891_2333398_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2333394_2334351_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2334538_2335885_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2335837:2335896	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2335852_2336083_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2336112_2336676_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2336830_2337601_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2337597_2338608_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2338922_2339369_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2339424_2339619_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2339620_2339962_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2339971_2341834_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2341873_2342380_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2342383_2342707_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2342708_2343113_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2343149_2344361_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2344382_2344931_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2345155_2345647_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2345861_2347892_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2347966_2349169_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2349711_2350647_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2351680_2351962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2352048_2352222_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2352333_2352678_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2352749_2353418_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2354833_2355877_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2355873_2355975_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2356066_2357186_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2357436_2358090_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2357144:2357418	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2358205_2359426_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2359476_2361906_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2362071_2363370_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2363474_2364128_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2364130_2365441_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2365668_2366208_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2366686_2366953_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2366991_2367357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2367238_2368249_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2368245_2369016_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2369101_2369761_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2369728_2370220_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2370329_2370533_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2370850_2371171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2371154_2371490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2371544_2371757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2371832_2372171_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2372167_2372503_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2372565_2374137_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2374930_2375242_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2375434_2376555_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2376682_2376877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2382959_2384121_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2384506_2385970_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2386102_2387653_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2387649_2387799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2387964_2389085_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2390198_2391056_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2391108_2391606_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2391726_2393142_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2393151_2394336_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2394332_2395931_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2397113_2397359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2397769_2397955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2398110_2399022_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2399143_2399986_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2400188_2401562_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2401871_2403383_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2403535_2404267_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2404373_2405675_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2405682_2406591_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2406587_2407181_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2407224_2407638_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2407634_2408105_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2408111_2408717_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2410518_2412303_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2412299_2413685_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2413670_2414633_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2414702_2415332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2415369_2416578_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2416699_2417269_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2417400_2418954_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2419257_2420478_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2420885_2421788_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2421784_2422654_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2422650_2423502_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2423498_2424323_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2424597_2425818_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043160	Bordetella holmesii strain H108 chromosome, complete genome	3696773	2626479	2674106	3696773	transposase,protease,tRNA	Bacillus_phage(25.0%)	47	NA	NA
WP_005015146.1|2626479_2627232_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005015148.1|2627274_2627994_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005015150.1|2628036_2629092_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_101557744.1|2630101_2631221_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015154.1|2631781_2632360_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_005012861.1|2632502_2633723_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005015155.1|2634027_2635005_+	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_005015156.1|2635153_2635984_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015157.1|2636097_2636913_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015162.1|2636935_2637790_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015163.1|2637788_2638172_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_032974102.1|2638278_2639652_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	4.0e-50
WP_005019837.1|2639723_2640215_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_005015166.1|2640214_2640967_-	membrane protein	NA	NA	NA	NA	NA
WP_005015167.1|2641314_2641518_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_005015168.1|2641547_2641970_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_005015169.1|2641981_2643079_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005015170.1|2643091_2644561_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_005015171.1|2644682_2645522_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
WP_005019846.1|2645543_2646401_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_005015173.1|2646473_2647592_-	porin	NA	NA	NA	NA	NA
WP_005015175.1|2647578_2648193_-	magnesium transporting ATPase P-type 1	NA	NA	NA	NA	NA
WP_101557744.1|2648222_2649343_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015176.1|2649386_2650016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015177.1|2650173_2651517_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005015178.1|2651525_2651909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015179.1|2652068_2653220_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_005015180.1|2653318_2654269_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015181.1|2654412_2655438_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005015182.1|2655478_2655718_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_005019849.1|2655783_2657373_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	4.3e-64
WP_005015184.1|2657372_2657918_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A088FT24	Mycobacterium_phage	30.8	3.5e-05
WP_005015187.1|2658001_2658574_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005019851.1|2658577_2659345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015190.1|2659376_2659712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015191.1|2659635_2660703_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.5	2.1e-06
WP_005015192.1|2660699_2662520_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.9	8.7e-77
WP_005015193.1|2662635_2663844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015194.1|2664077_2664779_+	response regulator	NA	W8CYM9	Bacillus_phage	36.6	2.8e-31
WP_005015195.1|2664791_2666270_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005015196.1|2666285_2667338_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005019853.1|2667334_2668672_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005015199.1|2668790_2670551_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	52.4	2.2e-170
WP_005015201.1|2670736_2671579_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_005015204.1|2671672_2672488_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_005015207.1|2672491_2672764_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005012365.1|2672885_2674106_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
>prophage 10
NZ_CP043160	Bordetella holmesii strain H108 chromosome, complete genome	3696773	2936592	3012274	3696773	integrase,transposase,tRNA	Leptospira_phage(14.29%)	56	2938819:2938878	3012275:3013472
WP_005019978.1|2936592_2937372_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937394_2938342_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938343_2938544_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
2938819:2938878	attL	TGACCTGCTCCCCGTGATTAGTACGAAATCGATGTAGAGTCCGTTCCCAAAGGAATGGCA	NA	NA	NA	NA
WP_101557770.1|2938878_2939998_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005015714.1|2940319_2941036_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2941032_2941926_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2942089_2943310_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943462_2944545_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2946224_2947208_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947270_2948683_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948800_2949643_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949921_2950530_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950545_2951166_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951231_2951939_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951943_2952666_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952652_2952943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2953018_2954239_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954963_2955815_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955866_2957120_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957296_2958085_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2958204_2959119_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959251_2961144_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961329_2962709_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2963153_2963450_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967250_2967853_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967986_2968445_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968446_2969046_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2969054_2969864_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969898_2970753_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970872_2971460_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971456_2972836_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973340_2973487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2981158_2982499_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982512_2983364_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983375_2984641_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984702_2986607_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988582_2989437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015806.1|2989429_2990224_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990439_2991390_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991992_2992790_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992829_2993483_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993463_2994528_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994691_2996917_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2997162_2999007_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2999123_2999996_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|3000042_3001743_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001805_3003005_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3003015_3003894_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3004000_3005038_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3005118_3005523_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005534_3006992_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007634_3008231_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008391_3008850_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009627_3010599_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010720_3011140_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|3011153_3012274_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
3012275:3013472	attR	TGCCATTCCTTTGGGAACGGACTCTACATCGATTTCGTACTAATCACGGGGAGCAGGTCAACCCAATTTTTATGGTTCATCGCGGAATAGCGTGGAGCCGTGCTTGATTGCCGTTACGCTTGATCCTTGATTTTTCAAGGATCAAGGCCGGGATCATGCTGGACCGCAAGACGATCGAGAGGTTGGGTGGGTGGGAAGGTTATCGGGTGGAGTGGGTCGTGTGGCCTGAAGGTGAGAGCCGGACGGTCACGATTTACCTGAAGCCTTCAGCGCGAACGATGCACTGCGAGCACTGCGGCAACCGATGTCGGCAGGTGCATGAGACGACCACGCGCCGGGTGCGGGATCTGCCGCTAATGGCGCTGCGAGTGACGCTGGTAGTGCCGCGTCGGCGGGTCTGGTGCGAGCAGTGCGGTGGACCGCATCTGGAGAGGCTGAGCTGGCTGGGCCGTTACCAGCGAGTGACCGACCGGCTGGCCGAGGCGGTCAGCCAGTTGCTTGAGTCCAGCAACATTCTGGCCGTGGCGCGCTTCTTCCAACTGGGTTGGCACACGGTCAAGGCGCTGGACAAGGCCCTGCTGCGACGGGCGATCCAAGAGCCGGACTGGAGCCAGATCCACTACCTAGCGATGGACGAGTTCGCTCTACACAAGGGCCATCGTTATGCCACGGTCGTTGTCGATCCGATCCGCCGTCAGGTGCTATGGATCGGTGATGGCCGCTCGCGCGAGACGGCCAGAGCCTTCTTCGAACAACTGCCAACTGGAGTTGCCCAGCAGATCCGGGCCGTAGCGATCGACATGACGACGGCCTATGAGCTGGAGATCCAGGCCAACTGCCCCAACGCCGAGATCGTCTACGACCTGTTCCACGTCGTGGCCAAGTACGGCCGTGAAGTGATAGACCGGGTGCGTGTAGACCAAGCGAACCAGTTGCGGCACGACAAGCCGGCCCGCCGGGTGATCAAGTCCAGTCGCTGGCTACTGCTGCGCAATCGCAAAAACCTCGATCCGTGCCAATCGGTAAAGTTGGACGAGTTGCTCCAGGCCAACCAGCCCTTGCTCACCGCTTATCTGATGCGCGATGAGCTCAAACAGCTGTGGTTCTACCAACACCCCGGCTACGCCCGCCAGGCATGGGATCACTGGCTGCAACAGGCTCAGGGCAGCGGCATCGCCGCCTTGGCTCACTTCGCGCT	NA	NA	NA	NA
