The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043158	Bordetella holmesii strain H248 chromosome, complete genome	3695489	1095284	1202073	3695489	tRNA,transposase,protease	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095284_1096505_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096592_1097183_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097179_1097482_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097533_1098523_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098643_1099525_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099698_1100553_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100584_1101433_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101560_1102781_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102799_1103366_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103563_1104715_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104853_1105858_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106014_1106986_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107064_1107853_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107924_1108161_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108169_1109081_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109124_1110996_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111156_1111954_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112185_1112560_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112636_1112960_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113043_1113316_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113330_1113786_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113907_1114744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114740_1116114_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116190_1117147_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117234_1118212_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118336_1119992_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120040_1120505_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120501_1120963_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121188_1122376_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122372_1123677_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123673_1125083_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125276_1126396_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126531_1127551_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127559_1130265_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130404_1131058_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131120_1131483_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132049_1133510_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133772_1134846_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134930_1136151_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137908_1139029_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1139002_1140502_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140515_1141619_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141623_1142874_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142870_1144316_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144312_1144627_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144628_1145747_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145929_1147150_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147249_1148116_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148176_1149157_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149303_1150224_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150232_1151345_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151426_1152248_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152323_1152932_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153069_1154446_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154507_1154951_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155017_1155674_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155716_1156836_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1157005_1157287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157997_1158786_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158782_1159889_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160563_1161922_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162036_1162234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162251_1163372_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163465_1164020_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164607_1165924_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165936_1166950_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167496_1168447_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168526_1168826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170186_1171845_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171993_1173214_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173331_1174615_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174618_1175560_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175669_1176128_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176508_1177129_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177536_1179957_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180064_1180802_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180848_1182093_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182415_1182688_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183271_1184000_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184021_1184939_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184938_1185448_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185564_1186236_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186345_1187413_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187432_1189277_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189413_1190601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190901_1191687_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191710_1192830_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192934_1194272_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194381_1195323_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195378_1196560_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196718_1197009_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197055_1197724_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197720_1198008_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198384_1199170_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199202_1199937_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200852_1202073_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043158	Bordetella holmesii strain H248 chromosome, complete genome	3695489	1206860	1263266	3695489	tRNA,transposase,protease	Ralstonia_virus(23.08%)	44	NA	NA
WP_005012808.1|1206860_1207811_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207892_1208372_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209583_1210783_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210928_1211306_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211329_1213111_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213119_1213857_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214141_1215701_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215760_1216519_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216615_1217272_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217425_1218190_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218204_1218384_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218409_1219444_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219440_1219854_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219850_1220435_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220787_1222146_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222239_1222818_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222942_1224063_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224135_1225392_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225495_1226701_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226764_1227214_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227346_1227592_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227816_1228131_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233384_1235490_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235543_1237853_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239206_1240874_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240876_1241542_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241674_1245481_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245706_1246852_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246970_1247900_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247896_1248973_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248969_1249776_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249772_1250504_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250880_1252119_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252166_1252505_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252752_1253703_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254021_1254204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254269_1255490_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255583_1256804_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256863_1257127_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257248_1258748_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012868.1|1259168_1259366_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259381_1259741_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259813_1260836_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260848_1263266_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043158	Bordetella holmesii strain H248 chromosome, complete genome	3695489	1651637	1692011	3695489	tRNA,integrase,transposase	Leptospira_phage(28.57%)	39	1644079:1644095	1688696:1688712
1644079:1644095	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|1651637_1652757_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1653409_1654165_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1654341_1655136_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1655132_1655570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1655681_1655834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1656254_1657223_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1657379_1658387_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1658444_1658903_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1658976_1660323_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1660340_1660712_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1660711_1662181_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1662336_1663062_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1663075_1665790_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1666041_1667406_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1667445_1668504_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1668531_1669350_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1669387_1669666_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1670929_1671229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1671798_1673202_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1673214_1673865_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1674006_1675227_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1675257_1676334_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1676480_1677611_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1677797_1679423_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1679429_1680245_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1680259_1681330_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1681381_1682041_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1682680_1683843_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1683884_1684199_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1684182_1684569_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1684607_1684874_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1685266_1685956_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1686055_1686217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1686367_1686532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1686658_1686895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1687084_1687333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1687446_1688817_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1688696:1688712	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1688817_1689558_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1690058_1692011_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 5
NZ_CP043158	Bordetella holmesii strain H248 chromosome, complete genome	3695489	1710305	1754232	3695489	tRNA,holin,transposase,integrase	Leptospira_phage(33.33%)	37	1752800:1752814	1759276:1759290
WP_005019367.1|1710305_1713167_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1713156_1714122_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1714878_1716354_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1716358_1716634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1716970_1718090_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1717964_1718213_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1718391_1719600_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1719596_1721879_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1721889_1724271_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1724534_1726442_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1726456_1727347_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1727353_1728487_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1728486_1729308_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1729332_1730523_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1730824_1731106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1731271_1731592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1731631_1732718_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1732914_1733175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1733667_1734438_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1734434_1735445_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1735479_1736322_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1736784_1737570_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1738429_1739549_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1740615_1741620_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1741695_1742508_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1742735_1744907_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1744960_1746280_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_153567296.1|1746368_1747589_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	6.1e-183
WP_005013678.1|1747807_1748668_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1748664_1749888_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1750186_1750684_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1750722_1751505_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1751530_1751749_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1751823_1752093_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1752312_1752777_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1752800:1752814	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1752850_1753132_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1753248_1754232_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1759276:1759290	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP043158	Bordetella holmesii strain H248 chromosome, complete genome	3695489	1779508	1820899	3695489	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1779508_1780459_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1780455_1780971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1781328_1781949_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1782048_1782300_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1782387_1783866_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1783862_1787033_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1787045_1788242_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1788430_1789363_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1789431_1790163_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1790228_1790864_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1790849_1792028_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1792188_1792737_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1792817_1793177_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1793224_1794445_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1794520_1795642_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1795679_1796393_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1796403_1797624_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1797706_1798261_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1798406_1799357_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1799316_1799478_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1799518_1800445_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1800458_1801331_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1801493_1802441_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1802779_1803361_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1803938_1804889_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1804868_1805621_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1805633_1806365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1806521_1808687_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1808776_1809046_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1809134_1809341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1809339_1809858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1809876_1810656_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1810823_1811840_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1811912_1812404_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1812414_1814130_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1815293_1816244_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1817895_1819137_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1819148_1819922_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1819948_1820899_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043158	Bordetella holmesii strain H248 chromosome, complete genome	3695489	2149113	2209236	3695489	tRNA,transposase,protease	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2149113_2149602_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2149594_2150443_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2150534_2151032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2151169_2151529_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2151525_2151807_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2151806_2152289_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2152290_2153919_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2153915_2154260_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2154261_2157204_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2157649_2158621_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2158610_2159993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2160135_2161086_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2161045_2162287_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2162283_2163405_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2164896_2165364_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2165434_2166085_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2166171_2167311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2167479_2168484_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2168480_2169728_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2170080_2170947_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2170906_2172511_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2172522_2173209_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2173205_2174246_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2174361_2175033_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2175029_2176022_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2176018_2176957_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2176953_2178108_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2178116_2179568_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2179598_2180081_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2180082_2180976_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2180972_2181416_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2181428_2181803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2181945_2182344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2182470_2182758_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2182754_2183171_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2183346_2183979_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2184007_2184454_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2184740_2185892_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2186005_2187010_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2187993_2188701_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2188633_2190085_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2190090_2193249_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2193261_2193783_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2193772_2194597_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2194593_2195193_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2195301_2197158_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2197306_2198311_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2198519_2199782_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2199786_2200122_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2200118_2201048_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2201052_2201766_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2201869_2203327_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2203323_2203620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2203744_2205103_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2205203_2206004_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2206183_2207302_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2207374_2207746_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2207752_2208604_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2208624_2209236_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043158	Bordetella holmesii strain H248 chromosome, complete genome	3695489	2304359	2425872	3695489	tRNA,integrase,transposase,protease	Leptospira_phage(12.5%)	104	2335889:2335948	2357196:2357470
WP_101557807.1|2304359_2305522_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2305634_2306603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2306599_2307520_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2307616_2312095_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2312473_2316808_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2317446_2318010_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2318021_2318267_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2318422_2318932_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2318977_2319958_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2320169_2322521_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2322567_2323398_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2323394_2324084_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2324076_2325357_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2325454_2326393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2326374_2328081_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2328158_2329262_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2329314_2330064_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2330070_2331585_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005014513.1|2331597_2331885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2331905_2332793_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2332943_2333450_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2333446_2334403_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2334590_2335937_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2335889:2335948	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2335904_2336135_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2336164_2336728_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2336882_2337653_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2337649_2338660_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2338974_2339421_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2339476_2339671_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2339672_2340014_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2340023_2341886_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2341925_2342432_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2342435_2342759_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2342760_2343165_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2343201_2344413_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2344434_2344983_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2345207_2345699_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2345913_2347944_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2348018_2349221_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2349763_2350699_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2351732_2352014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2352100_2352274_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2352385_2352730_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2352801_2353470_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2354885_2355929_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2355925_2356027_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2356118_2357238_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2357488_2358142_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2357196:2357470	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2358257_2359478_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2359528_2361958_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2362123_2363422_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2363526_2364180_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2364182_2365493_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2365720_2366260_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2366738_2367005_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2367043_2367409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2367290_2368301_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2368297_2369068_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2369153_2369813_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2369780_2370272_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2370381_2370585_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2370902_2371223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2371206_2371542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2371596_2371809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2371884_2372223_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2372219_2372555_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2372617_2374189_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2374982_2375294_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2375486_2376607_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2376734_2376929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2383011_2384173_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2384558_2386022_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2386154_2387705_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2387701_2387851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014703.1|2390252_2391110_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2391162_2391660_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2391780_2393196_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2393205_2394390_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2394386_2395985_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2397167_2397413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2397823_2398009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2398164_2399076_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2399197_2400040_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014726.1|2401925_2403437_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2403589_2404321_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2404427_2405729_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2405736_2406645_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2406641_2407235_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2407278_2407692_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2407688_2408159_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2408165_2408771_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2410572_2412357_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2412353_2413739_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2413724_2414687_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2414756_2415386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2415423_2416632_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2416753_2417323_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2417454_2419008_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2419311_2420532_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2420939_2421842_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2421838_2422708_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2422704_2423556_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2423552_2424377_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2424651_2425872_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043158	Bordetella holmesii strain H248 chromosome, complete genome	3695489	2625217	2672844	3695489	tRNA,transposase,protease	Bacillus_phage(25.0%)	47	NA	NA
WP_005015146.1|2625217_2625970_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005015148.1|2626012_2626732_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005015150.1|2626774_2627830_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_101557744.1|2628839_2629959_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015154.1|2630519_2631098_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_005012861.1|2631240_2632461_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005015155.1|2632765_2633743_+	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_005015156.1|2633891_2634722_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015157.1|2634835_2635651_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015162.1|2635673_2636528_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015163.1|2636526_2636910_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005015164.1|2637016_2638390_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
WP_005019837.1|2638461_2638953_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_005015166.1|2638952_2639705_-	membrane protein	NA	NA	NA	NA	NA
WP_005015167.1|2640052_2640256_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_005015168.1|2640285_2640708_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_005015169.1|2640719_2641817_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005015170.1|2641829_2643299_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_005015171.1|2643420_2644260_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
WP_005019846.1|2644281_2645139_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_005015173.1|2645211_2646330_-	porin	NA	NA	NA	NA	NA
WP_005015175.1|2646316_2646931_-	magnesium transporting ATPase P-type 1	NA	NA	NA	NA	NA
WP_101557744.1|2646960_2648081_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015176.1|2648124_2648754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015177.1|2648911_2650255_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005015178.1|2650263_2650647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015179.1|2650806_2651958_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_005015180.1|2652056_2653007_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015181.1|2653150_2654176_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005015182.1|2654216_2654456_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_005019849.1|2654521_2656111_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	4.3e-64
WP_005015184.1|2656110_2656656_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A088FT24	Mycobacterium_phage	30.8	3.5e-05
WP_005015187.1|2656739_2657312_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005019851.1|2657315_2658083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015190.1|2658114_2658450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015191.1|2658373_2659441_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.5	2.1e-06
WP_005015192.1|2659437_2661258_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.9	8.7e-77
WP_005015193.1|2661373_2662582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015194.1|2662815_2663517_+	response regulator	NA	W8CYM9	Bacillus_phage	36.6	2.8e-31
WP_005015195.1|2663529_2665008_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005015196.1|2665023_2666076_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005019853.1|2666072_2667410_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005015199.1|2667528_2669289_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	52.4	2.2e-170
WP_005015201.1|2669474_2670317_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_005015204.1|2670410_2671226_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_005015207.1|2671229_2671502_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005012365.1|2671623_2672844_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
>prophage 10
NZ_CP043158	Bordetella holmesii strain H248 chromosome, complete genome	3695489	2935330	3011012	3695489	tRNA,integrase,transposase	Leptospira_phage(14.29%)	56	2938185:2938244	2986772:2987342
WP_005019978.1|2935330_2936110_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2936132_2937080_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2937081_2937282_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2937616_2938736_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2938185:2938244	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2939057_2939774_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2939770_2940664_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2940827_2942048_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2942200_2943283_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2944962_2945946_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2946008_2947421_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2947538_2948381_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2948659_2949268_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2949283_2949904_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2949969_2950677_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2950681_2951404_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2951390_2951681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2951756_2952977_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2953701_2954553_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2954604_2955858_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2956034_2956823_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2956942_2957857_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2957989_2959882_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2960067_2961447_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2961891_2962188_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2965988_2966591_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2966724_2967183_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2967184_2967784_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2967792_2968602_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2968636_2969491_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2969610_2970198_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2970194_2971574_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2972078_2972225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2979896_2981237_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2981250_2982102_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2982113_2983379_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2983440_2985345_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2987320_2988175_-	hypothetical protein	NA	NA	NA	NA	NA
2986772:2987342	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2988167_2988962_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2989177_2990128_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2990730_2991528_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2991567_2992221_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2992201_2993266_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2993429_2995655_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2995900_2997745_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2997861_2998734_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2998780_3000481_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3000543_3001743_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3001753_3002632_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3002738_3003776_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3003856_3004261_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3004272_3005730_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3006372_3006969_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3007129_3007588_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3008365_3009337_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3009458_3009878_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_101557744.1|3009891_3011012_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
