The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043156	Bordetella holmesii strain H250 chromosome, complete genome	3695479	1095283	1202071	3695479	transposase,protease,tRNA	Ralstonia_virus(16.67%)	95	NA	NA
WP_005011985.1|1095283_1096504_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096591_1097182_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097178_1097481_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097532_1098522_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098642_1099524_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099697_1100552_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100583_1101432_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101559_1102780_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102798_1103365_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103562_1104714_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104852_1105857_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106013_1106985_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107063_1107852_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107923_1108160_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108168_1109080_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109123_1110995_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111155_1111953_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112184_1112559_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112635_1112959_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113042_1113315_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113329_1113785_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113906_1114743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114739_1116113_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116189_1117146_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117233_1118211_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118335_1119991_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120039_1120504_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120500_1120962_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121187_1122375_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122371_1123676_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123672_1125082_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125275_1126395_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126530_1127550_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127558_1130264_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130403_1131057_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131119_1131482_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132048_1133509_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133771_1134845_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134929_1136150_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137907_1139028_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1139001_1140501_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140514_1141618_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141622_1142873_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142869_1144315_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144311_1144626_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144627_1145746_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145928_1147149_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147248_1148115_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148175_1149156_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149302_1150223_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150231_1151344_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151425_1152247_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152322_1152931_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153068_1154445_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154506_1154950_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155016_1155673_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155715_1156835_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1157004_1157286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157996_1158785_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158781_1159888_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160562_1161921_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162035_1162233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162250_1163371_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163464_1164019_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164606_1165923_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165935_1166949_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012745.1|1168524_1168824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170184_1171843_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171991_1173212_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173329_1174613_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174616_1175558_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175667_1176126_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176506_1177127_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177534_1179955_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180062_1180800_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180846_1182091_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182413_1182686_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183269_1183998_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184019_1184937_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184936_1185446_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185562_1186234_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186343_1187411_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187430_1189275_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189411_1190599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190899_1191685_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191708_1192828_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192932_1194270_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194379_1195321_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195376_1196558_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196716_1197007_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197053_1197722_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197718_1198006_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198382_1199168_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199200_1199935_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200850_1202071_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043156	Bordetella holmesii strain H250 chromosome, complete genome	3695479	1206858	1263264	3695479	transposase,protease,tRNA	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1206858_1207809_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207890_1208370_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209581_1210781_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210926_1211304_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211327_1213109_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213117_1213855_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214139_1215699_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215758_1216517_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216613_1217270_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217423_1218188_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218202_1218382_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218407_1219442_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219438_1219852_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219848_1220433_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220785_1222144_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222237_1222816_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222940_1224061_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224133_1225390_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225493_1226699_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226762_1227212_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227344_1227590_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227814_1228129_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233382_1235488_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235541_1237851_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239204_1240872_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240874_1241540_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241672_1245479_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245704_1246850_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246968_1247898_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247894_1248971_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248967_1249774_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249770_1250502_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250878_1252117_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252164_1252503_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252750_1253701_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254019_1254202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254267_1255488_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255581_1256802_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256861_1257125_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257246_1258746_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1258793_1259069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259166_1259364_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259379_1259739_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259811_1260834_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260846_1263264_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043156	Bordetella holmesii strain H250 chromosome, complete genome	3695479	1651635	1692007	3695479	transposase,integrase,tRNA	Leptospira_phage(28.57%)	39	1644077:1644093	1688694:1688710
1644077:1644093	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|1651635_1652755_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1653407_1654163_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1654339_1655134_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1655130_1655568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1655679_1655832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1656252_1657221_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1657377_1658385_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1658442_1658901_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1658974_1660321_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1660338_1660710_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1660709_1662179_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1662334_1663060_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1663073_1665788_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1666039_1667404_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1667443_1668502_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1668529_1669348_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1669385_1669664_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1670927_1671227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1671796_1673200_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1673212_1673863_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1674004_1675225_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1675255_1676332_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1676478_1677609_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1677795_1679421_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1679427_1680243_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1680257_1681328_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1681379_1682039_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1682678_1683841_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1683882_1684197_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1684180_1684567_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1684605_1684872_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1685264_1685954_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1686053_1686215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1686365_1686530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1686656_1686893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1687082_1687331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1687444_1688815_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1688694:1688710	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1688815_1689556_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1690054_1692007_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 5
NZ_CP043156	Bordetella holmesii strain H250 chromosome, complete genome	3695479	1710301	1754227	3695479	transposase,integrase,holin,tRNA	Leptospira_phage(36.36%)	36	1752795:1752809	1759271:1759285
WP_005019367.1|1710301_1713163_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1713152_1714118_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1714874_1716350_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1716354_1716630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1716966_1718086_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1717960_1718209_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1718387_1719596_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1719592_1721875_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1721885_1724267_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1724530_1726438_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1726452_1727343_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1727349_1728483_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1728482_1729304_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1729328_1730519_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1730820_1731102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1731267_1731588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1731627_1732714_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1732910_1733171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1733663_1734434_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_005013672.1|1735474_1736317_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1736779_1737565_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1738424_1739544_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1740610_1741615_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1741690_1742503_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1742730_1744902_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1744955_1746275_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_153567296.1|1746363_1747584_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	6.1e-183
WP_005013678.1|1747802_1748663_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1748659_1749883_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1750181_1750679_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1750717_1751500_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1751525_1751744_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1751818_1752088_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1752307_1752772_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1752795:1752809	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1752845_1753127_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1753243_1754227_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1759271:1759285	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP043156	Bordetella holmesii strain H250 chromosome, complete genome	3695479	1779503	1820894	3695479	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1779503_1780454_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1780450_1780966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1781323_1781944_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1782043_1782295_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1782382_1783861_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1783857_1787028_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1787040_1788237_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1788425_1789358_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1789426_1790158_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1790223_1790859_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1790844_1792023_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1792183_1792732_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1792812_1793172_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1793219_1794440_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1794515_1795637_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1795674_1796388_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1796398_1797619_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1797701_1798256_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1798401_1799352_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1799311_1799473_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1799513_1800440_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1800453_1801326_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1801488_1802436_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1802774_1803356_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1803933_1804884_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1804863_1805616_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1805628_1806360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1806516_1808682_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1808771_1809041_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1809129_1809336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1809334_1809853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1809871_1810651_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1810818_1811835_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1811907_1812399_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1812409_1814125_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1815288_1816239_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1817890_1819132_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1819143_1819917_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1819943_1820894_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043156	Bordetella holmesii strain H250 chromosome, complete genome	3695479	2304353	2425866	3695479	transposase,protease,integrase,tRNA	Leptospira_phage(12.5%)	104	2335883:2335942	2357190:2357464
WP_101557807.1|2304353_2305516_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2305628_2306597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2306593_2307514_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2307610_2312089_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2312467_2316802_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2317440_2318004_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2318015_2318261_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2318416_2318926_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2318971_2319952_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2320163_2322515_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2322561_2323392_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2323388_2324078_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2324070_2325351_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2325448_2326387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2326368_2328075_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2328152_2329256_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2329308_2330058_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2330064_2331579_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005014513.1|2331591_2331879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2331899_2332787_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2332937_2333444_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2333440_2334397_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2334584_2335931_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2335883:2335942	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2335898_2336129_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2336158_2336722_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2336876_2337647_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2337643_2338654_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2338968_2339415_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2339470_2339665_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2339666_2340008_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2340017_2341880_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2341919_2342426_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2342429_2342753_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2342754_2343159_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2343195_2344407_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2344428_2344977_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2345201_2345693_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2345907_2347938_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2348012_2349215_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2349757_2350693_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2351726_2352008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2352094_2352268_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2352379_2352724_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2352795_2353464_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2354879_2355923_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2355919_2356021_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2356112_2357232_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2357482_2358136_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2357190:2357464	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2358251_2359472_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2359522_2361952_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2362117_2363416_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2363520_2364174_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2364176_2365487_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2365714_2366254_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2366732_2366999_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2367037_2367403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2367284_2368295_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2368291_2369062_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2369147_2369807_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2369774_2370266_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2370375_2370579_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2370896_2371217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2371200_2371536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2371590_2371803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2371878_2372217_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2372213_2372549_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2372611_2374183_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2374976_2375288_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2375480_2376601_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2376728_2376923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2383005_2384167_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2384552_2386016_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2386148_2387699_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2387695_2387845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014703.1|2390246_2391104_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2391156_2391654_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2391774_2393190_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2393199_2394384_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2394380_2395979_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2397161_2397407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2397817_2398003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2398158_2399070_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2399191_2400034_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014726.1|2401919_2403431_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2403583_2404315_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2404421_2405723_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2405730_2406639_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2406635_2407229_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2407272_2407686_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2407682_2408153_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2408159_2408765_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2410566_2412351_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2412347_2413733_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2413718_2414681_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2414750_2415380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2415417_2416626_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2416747_2417317_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2417448_2419002_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2419305_2420526_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2420933_2421836_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2421832_2422702_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2422698_2423550_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2423546_2424371_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2424645_2425866_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043156	Bordetella holmesii strain H250 chromosome, complete genome	3695479	2625211	2672838	3695479	transposase,protease,tRNA	Bacillus_phage(25.0%)	47	NA	NA
WP_005015146.1|2625211_2625964_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005015148.1|2626006_2626726_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005015150.1|2626768_2627824_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_101557744.1|2628833_2629953_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015154.1|2630513_2631092_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_005012861.1|2631234_2632455_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005015155.1|2632759_2633737_+	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_005015156.1|2633885_2634716_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015157.1|2634829_2635645_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015162.1|2635667_2636522_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015163.1|2636520_2636904_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005015164.1|2637010_2638384_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
WP_005019837.1|2638455_2638947_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_005015166.1|2638946_2639699_-	membrane protein	NA	NA	NA	NA	NA
WP_005015167.1|2640046_2640250_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_005015168.1|2640279_2640702_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_005015169.1|2640713_2641811_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005015170.1|2641823_2643293_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_005015171.1|2643414_2644254_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
WP_005019846.1|2644275_2645133_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_005015173.1|2645205_2646324_-	porin	NA	NA	NA	NA	NA
WP_005015175.1|2646310_2646925_-	magnesium transporting ATPase P-type 1	NA	NA	NA	NA	NA
WP_101557744.1|2646954_2648075_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015176.1|2648118_2648748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015177.1|2648905_2650249_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005015178.1|2650257_2650641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015179.1|2650800_2651952_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_005015180.1|2652050_2653001_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015181.1|2653144_2654170_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005015182.1|2654210_2654450_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_005019849.1|2654515_2656105_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	4.3e-64
WP_005015184.1|2656104_2656650_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A088FT24	Mycobacterium_phage	30.8	3.5e-05
WP_005015187.1|2656733_2657306_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005019851.1|2657309_2658077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015190.1|2658108_2658444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015191.1|2658367_2659435_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.5	2.1e-06
WP_005015192.1|2659431_2661252_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.9	8.7e-77
WP_005015193.1|2661367_2662576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015194.1|2662809_2663511_+	response regulator	NA	W8CYM9	Bacillus_phage	36.6	2.8e-31
WP_005015195.1|2663523_2665002_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005015196.1|2665017_2666070_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005019853.1|2666066_2667404_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005015199.1|2667522_2669283_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	52.4	2.2e-170
WP_005015201.1|2669468_2670311_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_005015204.1|2670404_2671220_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_005015207.1|2671223_2671496_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005012365.1|2671617_2672838_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
>prophage 9
NZ_CP043156	Bordetella holmesii strain H250 chromosome, complete genome	3695479	2935323	3011005	3695479	transposase,integrase,tRNA	Leptospira_phage(14.29%)	56	2938178:2938237	2986765:2987335
WP_005019978.1|2935323_2936103_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2936125_2937073_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2937074_2937275_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2937609_2938729_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2938178:2938237	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2939050_2939767_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2939763_2940657_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2940820_2942041_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2942193_2943276_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2944955_2945939_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2946001_2947414_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2947531_2948374_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2948652_2949261_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2949276_2949897_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2949962_2950670_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2950674_2951397_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2951383_2951674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2951749_2952970_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2953694_2954546_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2954597_2955851_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2956027_2956816_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2956935_2957850_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2957982_2959875_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2960060_2961440_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2961884_2962181_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2965981_2966584_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2966717_2967176_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2967177_2967777_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2967785_2968595_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2968629_2969484_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2969603_2970191_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2970187_2971567_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2972071_2972218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2979889_2981230_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2981243_2982095_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2982106_2983372_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2983433_2985338_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2987313_2988168_-	hypothetical protein	NA	NA	NA	NA	NA
2986765:2987335	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2988160_2988955_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2989170_2990121_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2990723_2991521_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2991560_2992214_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2992194_2993259_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2993422_2995648_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2995893_2997738_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2997854_2998727_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2998773_3000474_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3000536_3001736_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3001746_3002625_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3002731_3003769_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3003849_3004254_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3004265_3005723_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3006365_3006962_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3007122_3007581_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3008358_3009330_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3009451_3009871_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_101557744.1|3009884_3011005_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
