The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043154	Bordetella holmesii strain H318 chromosome, complete genome	3699174	631718	692836	3699174	transposase,tRNA	Ralstonia_virus(36.36%)	51	NA	NA
WP_005012861.1|631718_632939_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005018655.1|635948_636683_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.6e-40
WP_005011985.1|636850_638071_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005020417.1|638445_639432_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005020418.1|639435_642159_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	6.6e-20
WP_005018662.1|642159_643287_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005018665.1|643299_644712_+	TolC family protein	NA	NA	NA	NA	NA
WP_005018670.1|644886_645543_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032974099.1|645563_646610_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	39.4	8.0e-59
WP_005018676.1|646606_648196_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_005018678.1|648131_648641_-	GtrA family protein	NA	NA	NA	NA	NA
WP_017685335.1|648566_649460_+	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_005018681.1|649449_650346_-	alpha/beta fold hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	33.1	6.5e-09
WP_005020419.1|650392_651025_-	LysE family translocator	NA	NA	NA	NA	NA
WP_005018686.1|651049_651934_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005018689.1|652061_653543_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005018691.1|653615_653960_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_005018693.1|654045_654510_+	universal stress protein	NA	NA	NA	NA	NA
WP_005018697.1|655673_657788_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.1	6.0e-61
WP_005018699.1|657820_658618_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005013747.1|658829_659780_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005018702.1|659812_660259_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_005018704.1|660307_660997_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_005018707.1|661084_661579_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_005018709.1|661610_662927_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_005018710.1|662943_663864_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_005018713.1|663898_664360_-	protein TolR	NA	NA	NA	NA	NA
WP_005018715.1|664359_665034_-	protein TolQ	NA	NA	NA	NA	NA
WP_005018717.1|665036_665459_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005018720.1|665512_667243_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	28.6	1.2e-11
WP_005018723.1|667308_667878_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005018726.1|667858_668545_+	response regulator	NA	NA	NA	NA	NA
WP_005018729.1|668564_670070_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005018732.1|670298_670748_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_005018735.1|670753_672274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|672327_673548_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005018738.1|673644_674574_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005018740.1|674732_675638_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005011985.1|675837_677058_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005018744.1|677113_678619_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_005018747.1|678640_679096_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_005018750.1|679452_680025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005018752.1|680024_680336_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_005018754.1|680649_681411_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_005018757.1|681379_682174_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_005018762.1|682352_682688_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_005018764.1|682704_683262_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_005018766.1|683323_684436_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_005018783.1|684576_685053_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011899.1|691394_691589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|691716_692836_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
>prophage 2
NZ_CP043154	Bordetella holmesii strain H318 chromosome, complete genome	3699174	918898	972005	3699174	protease,transposase,tRNA	Ralstonia_virus(21.43%)	52	NA	NA
WP_005012353.1|918898_919903_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005012355.1|919930_920800_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012356.1|920966_922043_+	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	1.9e-26
WP_005012357.1|922020_923781_+	putative 2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005012358.1|923812_924277_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_111118761.1|924320_924560_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_005012362.1|925677_926805_+	TIGR03364 family FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005012363.1|926846_927341_-	DUF2214 family protein	NA	NA	NA	NA	NA
WP_005012364.1|927385_928069_-	Fe2+-dependent dioxygenase	NA	A0A1D8KSK5	Synechococcus_phage	39.5	3.9e-14
WP_005018941.1|928078_930262_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005012365.1|930401_931622_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
WP_005015207.1|931743_932016_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005015204.1|932019_932835_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_005015201.1|932928_933771_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_005015199.1|933956_935717_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	52.4	2.2e-170
WP_005019853.1|935835_937173_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005015196.1|937169_938222_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005015195.1|938237_939716_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005015194.1|939728_940430_-	response regulator	NA	W8CYM9	Bacillus_phage	36.6	2.8e-31
WP_005015193.1|940663_941872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015192.1|941987_943808_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.9	8.7e-77
WP_005015191.1|943804_944872_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.5	2.1e-06
WP_005015190.1|944795_945131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005019851.1|945162_945930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015187.1|945933_946506_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005015184.1|946589_947135_-	crossover junction endodeoxyribonuclease RuvC	NA	A0A088FT24	Mycobacterium_phage	30.8	3.5e-05
WP_005019849.1|947134_948724_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	4.3e-64
WP_005015182.1|948789_949029_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_005015181.1|949069_950095_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005015180.1|950238_951189_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015179.1|951287_952439_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_005015178.1|952598_952982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015177.1|952990_954334_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005015176.1|954491_955121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557744.1|955164_956284_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015175.1|956314_956929_+	magnesium transporting ATPase P-type 1	NA	NA	NA	NA	NA
WP_005015173.1|956915_958034_+	porin	NA	NA	NA	NA	NA
WP_005019846.1|958106_958964_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_005015171.1|958985_959825_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
WP_005015170.1|959946_961416_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_005015169.1|961428_962526_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005015168.1|962537_962960_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_005015167.1|962989_963193_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_005015166.1|963540_964293_+	membrane protein	NA	NA	NA	NA	NA
WP_005019837.1|964292_964784_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_032974102.1|964855_966229_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	4.0e-50
WP_005015163.1|966335_966719_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005015162.1|966717_967572_+	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015157.1|967594_968410_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015156.1|968523_969354_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015155.1|969502_970480_-	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_005012861.1|970784_972005_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
>prophage 3
NZ_CP043154	Bordetella holmesii strain H318 chromosome, complete genome	3699174	1165642	1275529	3699174	protease,integrase,transposase,tRNA	Leptospira_phage(12.9%)	98	1248345:1248404	1269652:1269927
WP_005014796.1|1165642_1167100_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	30.0	7.5e-39
WP_005014794.1|1167110_1167755_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_005014792.1|1167788_1168754_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_005014790.1|1168771_1169821_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_005019734.1|1169905_1171165_+	aspartate kinase	NA	NA	NA	NA	NA
WP_005014784.1|1171416_1171887_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_005014781.1|1171988_1173395_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	28.2	1.5e-20
WP_005014780.1|1173410_1175504_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	55.8	2.4e-107
WP_005014779.1|1175503_1176166_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014777.1|1176182_1178543_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
WP_005011985.1|1178688_1179909_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014769.1|1180183_1181008_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014767.1|1181004_1181856_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014766.1|1181852_1182722_-	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014765.1|1182718_1183621_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005011985.1|1184028_1185249_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014763.1|1185552_1187106_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014760.1|1187237_1187807_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014759.1|1187928_1189137_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014755.1|1189174_1189804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014754.1|1189873_1190836_+	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014753.1|1190821_1192207_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014750.1|1192203_1193988_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014748.1|1195789_1196395_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014747.1|1196401_1196872_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014744.1|1196868_1197282_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014741.1|1197325_1197919_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014740.1|1197915_1198824_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014730.1|1198831_1200133_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014728.1|1200239_1200971_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014726.1|1201123_1202635_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014723.1|1202944_1204318_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014721.1|1204520_1205363_+	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014720.1|1205484_1206396_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005014716.1|1206551_1206737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014714.1|1207147_1207393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014709.1|1208575_1210174_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014706.1|1210170_1211355_-	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014705.1|1211364_1212780_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014704.1|1212900_1213398_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|1213980_1214931_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_101557770.1|1216470_1217590_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_017685964.1|1217756_1217906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014698.1|1217902_1219453_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_005019713.1|1219585_1221049_-	ribonuclease G	NA	NA	NA	NA	NA
WP_101557807.1|1221433_1222596_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_153570000.1|1228677_1228866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014621.1|1230305_1230617_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_005014618.1|1231410_1232982_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014613.1|1233044_1233380_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014610.1|1233376_1233715_-	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014607.1|1233790_1234003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|1234057_1234393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014600.1|1234376_1234697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014599.1|1235014_1235218_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014598.1|1235327_1235819_+	DUF924 family protein	NA	NA	NA	NA	NA
WP_050427733.1|1235786_1236446_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005013542.1|1236531_1237302_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341473.1|1237298_1238309_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_135238891.1|1238190_1238556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557809.1|1238594_1238861_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005014595.1|1239339_1239879_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_005014590.1|1240106_1241417_+	trigger factor	NA	NA	NA	NA	NA
WP_005014589.1|1241419_1242073_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014587.1|1242177_1243476_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014581.1|1243641_1246071_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_032974133.1|1246121_1247342_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014574.1|1247457_1248111_-	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
1248345:1248404	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_101557770.1|1248360_1249481_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879527.1|1249572_1249674_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005014572.1|1249670_1250714_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_005014566.1|1252129_1252798_-	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014564.1|1252869_1253214_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014560.1|1253325_1253499_-	OsmC family protein	NA	NA	NA	NA	NA
WP_005014556.1|1253585_1253867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032826331.1|1254900_1255836_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014553.1|1256378_1257581_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_017685984.1|1257655_1259686_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014551.1|1259900_1260392_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_005014547.1|1260616_1261165_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014546.1|1261186_1262398_+	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014545.1|1262434_1262839_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014544.1|1262840_1263164_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014543.1|1263167_1263674_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014539.1|1263713_1265576_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014536.1|1265585_1265927_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014534.1|1265928_1266123_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_076879495.1|1266178_1266625_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_025341421.1|1266939_1267950_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_032968029.1|1267946_1268717_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_101558036.1|1268871_1269435_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_025341181.1|1269464_1269695_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_005019683.1|1269662_1271009_-	TonB-dependent receptor	NA	NA	NA	NA	NA
1269652:1269927	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCATCGCCCCGATAGGTATTGGGCGGCCCCAGTCGGCCGCTACGCAGCAAATACTTGATGTCGTTCGTTTCATCCACGCGCACCACAGCCGCCTTGAATTTCCATCCATTGGAAAATCGGTGGGTGAGGTCGGCGAACCAAGTGTTCTGGGTTTTATACGCGTGATTCCATTTGGCGCTCAGATTGGTCGAGCGTGAATACTCCGGCATCGACCCGTCT	NA	NA	NA	NA
WP_005014518.1|1271196_1272153_-	FecR family protein	NA	NA	NA	NA	NA
WP_005014516.1|1272149_1272656_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014514.1|1272806_1273694_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014513.1|1273714_1274002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014511.1|1274014_1275529_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
>prophage 4
NZ_CP043154	Bordetella holmesii strain H318 chromosome, complete genome	3699174	1396363	1445464	3699174	protease,transposase,tRNA	Ralstonia_virus(25.0%)	48	NA	NA
WP_005014292.1|1396363_1396975_+|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
WP_005014290.1|1396995_1397847_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014289.1|1397853_1398225_-	lipoprotein	NA	NA	NA	NA	NA
WP_005014286.1|1398297_1399416_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014285.1|1399595_1400396_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014283.1|1400496_1401855_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014281.1|1401979_1402276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014278.1|1402272_1403730_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014277.1|1403833_1404547_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014275.1|1404551_1405481_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005014274.1|1405477_1405813_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014271.1|1405817_1407080_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005012353.1|1407288_1408293_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014269.1|1408441_1410298_+	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005014267.1|1410406_1411006_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014265.1|1411002_1411827_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014263.1|1411816_1412338_+	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014260.1|1412350_1415509_-	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_032954285.1|1415514_1416966_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014256.1|1416898_1417606_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_005012353.1|1418589_1419594_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014253.1|1419707_1420859_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005014250.1|1421145_1421592_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014248.1|1421620_1422253_-	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014247.1|1422428_1422845_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_076879494.1|1422841_1423129_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014242.1|1423255_1423654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014241.1|1423796_1424171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014239.1|1424183_1424627_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014237.1|1424623_1425517_-	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014235.1|1425518_1426001_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014231.1|1426031_1427483_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014229.1|1427491_1428646_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014228.1|1428642_1429581_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014227.1|1429577_1430570_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014226.1|1430566_1431238_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014223.1|1431353_1432394_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014221.1|1432390_1433077_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014215.1|1433088_1434693_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014213.1|1434652_1435519_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014212.1|1435871_1437119_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005012353.1|1437115_1438120_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014211.1|1438288_1439428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014210.1|1439514_1440165_-	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014203.1|1440235_1440703_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014202.1|1442194_1443316_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014200.1|1443312_1444554_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_005012067.1|1444513_1445464_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP043154	Bordetella holmesii strain H318 chromosome, complete genome	3699174	1763363	1873968	3699174	holin,integrase,transposase	Ralstonia_virus(25.0%)	99	1811151:1811210	1864929:1865267
WP_005013764.1|1763363_1764314_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013763.1|1764304_1765489_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005013762.1|1765568_1766486_-	FecR family protein	NA	NA	NA	NA	NA
WP_005013761.1|1766487_1766982_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005013759.1|1767124_1768105_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.2	5.6e-14
WP_076879523.1|1768088_1768829_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_025341443.1|1770069_1770276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013757.1|1770283_1770913_-	MarC family protein	NA	NA	NA	NA	NA
WP_005013756.1|1771207_1773412_-	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_005013755.1|1773522_1774746_-	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_005013754.1|1774868_1775843_-	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_005013753.1|1775910_1777104_-	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_005013752.1|1777118_1777919_-	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_005013751.1|1777915_1779772_-	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_005013750.1|1779768_1780374_-	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_003814013.1|1780392_1781778_-	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_003814011.1|1783819_1784602_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_005013747.1|1784700_1785651_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814010.1|1785677_1786451_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_003814009.1|1786462_1787704_+	MFS transporter	NA	NA	NA	NA	NA
WP_005012808.1|1789355_1790306_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814007.1|1791469_1793185_+	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005013744.1|1793195_1793687_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_005013742.1|1793759_1794776_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003814004.1|1794943_1795723_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013740.1|1795741_1796260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005019401.1|1796258_1796465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013738.1|1796553_1796823_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005013736.1|1796912_1799078_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005019399.1|1799234_1799966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013735.1|1799978_1800731_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005012808.1|1800710_1801661_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_026087954.1|1802238_1802820_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005013732.1|1803158_1804106_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013731.1|1804268_1805141_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013730.1|1805154_1806081_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013729.1|1806121_1806283_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013727.1|1806242_1807193_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013726.1|1807338_1807893_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013725.1|1807975_1809196_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013724.1|1809206_1809920_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013723.1|1809957_1811079_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1811151:1811210	attL	TGGTTCATCGAGGAATACCGGGGAATGCAGACCGGATCTTGAGGAAGAAGTACTCCTGAT	NA	NA	NA	NA
WP_005011985.1|1811154_1812375_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013722.1|1812422_1812782_-	LysE family transporter	NA	NA	NA	NA	NA
WP_005013721.1|1812862_1813411_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013720.1|1813571_1814750_+	MFS transporter	NA	NA	NA	NA	NA
WP_005013719.1|1814735_1815371_-	chorismate lyase	NA	NA	NA	NA	NA
WP_005013718.1|1815436_1816168_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013717.1|1816236_1817169_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013715.1|1817357_1818554_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013714.1|1818566_1821737_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013712.1|1821733_1823212_+	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013711.1|1823299_1823551_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013710.1|1823650_1824271_-	SCO family protein	NA	NA	NA	NA	NA
WP_005013708.1|1824628_1825144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1825140_1826091_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013707.1|1826200_1828255_-	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013706.1|1828374_1829229_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.4e-29
WP_005019390.1|1829225_1829852_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_032974136.1|1829848_1831603_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_005013703.1|1832148_1834860_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_005013702.1|1834872_1836537_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_005013701.1|1836552_1838328_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
WP_153566129.1|1838449_1838623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013700.1|1838741_1838954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013699.1|1839126_1840107_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013698.1|1840123_1840918_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_157933265.1|1840951_1841419_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013696.1|1842035_1842689_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005013695.1|1842770_1843706_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013694.1|1843967_1844114_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_005013693.1|1844204_1844606_+	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_005013692.1|1844681_1845566_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019382.1|1845658_1846363_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013691.1|1846401_1848483_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013690.1|1848615_1849527_-	phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
WP_005013689.1|1849591_1850023_-	TonB family protein	NA	NA	NA	NA	NA
WP_005013688.1|1850125_1851124_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_005013686.1|1851367_1852351_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005013685.1|1852467_1852749_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013684.1|1852822_1853287_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005019379.1|1853506_1853776_-	YunC family protein	NA	NA	NA	NA	NA
WP_005013682.1|1853850_1854069_+	SlyX family protein	NA	NA	NA	NA	NA
WP_005013681.1|1854094_1854877_+	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013680.1|1854915_1855413_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013679.1|1855711_1856935_+	MFS transporter	NA	NA	NA	NA	NA
WP_005013678.1|1856931_1857792_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1858010_1859231_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013677.1|1859319_1860639_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005013676.1|1860692_1862864_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013675.1|1863091_1863904_-	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005012353.1|1863979_1864984_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_101557815.1|1866049_1867170_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
1864929:1865267	attR	ATCAGGAGTACTTCTTCCTCAAGATCCGGTCTGCATTCCCCGGTATTCCTCGATGAACCATAAATCAGGGTGTGCATGCCCTCGGCCTCGAAAGCCAGGGCCGAATCCACATACTCCGACGTGGTGCCTGCCACCCGCGCGATCTCGACTCCGTCGCGGCTGATGACGACGTCGCCCTGCGGCTCGCCGACGCGCACCCAACGCAGAGTCACGCTTTTGTTATCCGTGGCCGTGCGCGTCACCAGTCTGCGCACCGCCACGGGTTCTGCCAGCGACGTGCCCGCCATGTCGTACGCGCGCGGCTCGGGCAATGCGCCCATGTGGCTCAACACGGTCGGC	NA	NA	NA	NA
WP_005013673.1|1868029_1868815_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_005013672.1|1869277_1870120_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_025341421.1|1870154_1871165_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|1871161_1871932_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_005013671.1|1872424_1872685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1872880_1873968_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
>prophage 6
NZ_CP043154	Bordetella holmesii strain H318 chromosome, complete genome	3699174	1887386	1931594	3699174	integrase,transposase,tRNA	Ralstonia_virus(22.22%)	47	1897349:1897408	1935808:1936378
WP_161992024.1|1887386_1887635_-|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_101557770.1|1887508_1888629_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013659.1|1888965_1889241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005019369.1|1889245_1890721_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013657.1|1891477_1892443_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019367.1|1892432_1895294_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013655.1|1895296_1895812_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_005013654.1|1895872_1897084_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.4	2.2e-36
1897349:1897408	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_005019364.1|1898263_1899004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013652.1|1899096_1899567_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013651.1|1899585_1900290_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_005013650.1|1900302_1900845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013649.1|1900866_1901334_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005013648.1|1901443_1902076_+	DedA family protein	NA	NA	NA	NA	NA
WP_005013647.1|1902096_1902555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013645.1|1902596_1903046_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
WP_005013644.1|1903918_1904590_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
WP_005013643.1|1904586_1905228_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
WP_005013642.1|1905238_1906126_-	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
WP_005013641.1|1906294_1907458_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013640.1|1907526_1908504_-	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_005013639.1|1908623_1909046_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005013638.1|1909092_1909302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013637.1|1909349_1911125_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_005013636.1|1911153_1911423_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_005013635.1|1911485_1911884_-	PTS IIa component	NA	NA	NA	NA	NA
WP_005013634.1|1911897_1912854_-	glutathione synthase	NA	NA	NA	NA	NA
WP_076879490.1|1913019_1913568_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
WP_005013632.1|1913588_1915541_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
WP_005013631.1|1916041_1916782_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013629.1|1916782_1918153_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_005013628.1|1918266_1918515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1918704_1918941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1919067_1919232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013626.1|1919382_1919544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013625.1|1919643_1920333_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_101557809.1|1920725_1920992_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153570001.1|1921030_1921594_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_162007654.1|1921623_1921716_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557807.1|1921757_1922919_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005013621.1|1923559_1924219_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_110097765.1|1924270_1925341_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005019353.1|1925355_1926171_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_005019351.1|1926177_1927803_-	membrane protein	NA	NA	NA	NA	NA
WP_005013618.1|1927989_1929120_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005013617.1|1929266_1930343_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005011985.1|1930373_1931594_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
1935808:1936378	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCACCATGGTTACGCCGGCCCAACAGAGCTCGGCCAGGCGCTCGGCGTGGTGGCCCAAGGCGGCATGTGGATGGGTCGATCTCTGGTAGGCCGCCTGTTACGCACGGCCCGAAATCGCGCCGGCACACCCGCGGATTGGGGCCACGCTCTGTTGACCGCACGGGAAGACACCGTCGCGCGCCACGCCTCTGCCGGTCAATCCAACGCGCAGATCGCCGAACAGCTCGGCATTACCGAACGCACCGTCAAAGCGCATCTGTCCGCGGTCTTTGAGAAAGTCGGCGTGGCAGATCGCCTGCAGTTAGCGCTATTGGTCCATGGCGTCACACCCGCCAAAACCGGCCATTGACTCAACGGCACCGCACCTCAATCGCCTGCCGGATCCATCAACGGCGGGCCTGCTCGTACAAGGGCAAAACCCGCTCTGACGCCTGCTTCAGATCCGCGATGCGTGTGCTGGCCGAGGGATGCGTGGAGAGAAACTCCGGCGAGGCCTGTCCAGTCTGGGCCGCTG	NA	NA	NA	NA
>prophage 7
NZ_CP043154	Bordetella holmesii strain H318 chromosome, complete genome	3699174	1947213	1998813	3699174	transposase,tRNA	Leptospira_phage(20.0%)	52	NA	NA
WP_025341429.1|1947213_1948221_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005013598.1|1948377_1949346_+	homoserine kinase	NA	NA	NA	NA	NA
WP_153566127.1|1949766_1949919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013597.1|1950030_1950468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013596.1|1950464_1951259_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013595.1|1951435_1952191_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_101557770.1|1952842_1953963_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013592.1|1954006_1954630_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_005013591.1|1954626_1955988_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013590.1|1955987_1956743_-	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013589.1|1956807_1957212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1957436_1957976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013587.1|1958197_1959406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1959455_1960406_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013586.1|1960628_1960889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013585.1|1961150_1961558_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_005013584.1|1961554_1963894_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013583.1|1963899_1965024_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013582.1|1965071_1965203_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013581.1|1965217_1965913_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013580.1|1966156_1966690_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013579.1|1966725_1968273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013578.1|1968277_1969501_-	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013577.1|1969487_1970267_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005019317.1|1970297_1971236_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013573.1|1971354_1972077_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005013572.1|1972218_1972917_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013571.1|1973213_1974095_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013570.1|1974116_1975277_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013569.1|1975287_1975893_-	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|1976151_1977372_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013568.1|1977427_1979725_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005013567.1|1979864_1980785_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013566.1|1980791_1981343_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013565.1|1981388_1982450_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013564.1|1982790_1983486_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013563.1|1983457_1984981_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_017685641.1|1985216_1986842_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013561.1|1987315_1987534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013559.1|1987685_1988585_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013558.1|1988701_1989994_-	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013556.1|1990084_1990459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013555.1|1990468_1990966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1990995_1991127_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013552.1|1991385_1991721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1992342_1993842_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013550.1|1993948_1994194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013549.1|1994254_1994626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080601033.1|1994630_1995374_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_101557831.1|1995374_1996495_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_101557920.1|1996662_1997744_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_025341421.1|1997802_1998813_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
>prophage 8
NZ_CP043154	Bordetella holmesii strain H318 chromosome, complete genome	3699174	2310095	2377786	3699174	protease,transposase,tRNA	Ralstonia_virus(16.67%)	59	NA	NA
WP_005011985.1|2310095_2311316_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012942.1|2311943_2312372_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_005012941.1|2312400_2312847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012939.1|2312979_2314896_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_005012937.1|2315067_2317590_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_005012934.1|2317584_2318238_-	serine/threonine protein phosphatase 1	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	47.7	6.3e-54
WP_005012933.1|2318415_2319591_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_005012931.1|2319587_2319794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012930.1|2319840_2320827_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_005012927.1|2320831_2321287_-	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	48.3	2.1e-35
WP_080687431.1|2322456_2322912_-	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.9e-20
WP_005012922.1|2322980_2324780_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.4	8.7e-45
WP_005012921.1|2324833_2325199_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_005012919.1|2325205_2325421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012916.1|2325511_2326594_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_005012915.1|2326721_2326934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012914.1|2327081_2327324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012913.1|2327418_2327622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012912.1|2327773_2327956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012910.1|2328012_2328297_-	CsbD family protein	NA	NA	NA	NA	NA
WP_005012903.1|2328344_2328938_-	lipoprotein	NA	NA	NA	NA	NA
WP_005012901.1|2329229_2329700_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012900.1|2329696_2330149_-	low affinity iron permease family protein	NA	G1JW61	Mycobacterium_phage	36.3	8.9e-07
WP_005012896.1|2330242_2330521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012894.1|2330650_2330899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012893.1|2331027_2332989_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	29.9	2.3e-27
WP_005012891.1|2333023_2333770_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	31.2	7.3e-22
WP_005012888.1|2334165_2334375_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	57.1	8.6e-13
WP_005012887.1|2336255_2337260_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012885.1|2337290_2338280_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012883.1|2338307_2339051_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012882.1|2339337_2339592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685460.1|2339973_2340702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685459.1|2340732_2341299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012873.1|2341521_2341920_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012872.1|2341977_2342319_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	43.3	1.3e-13
WP_005012871.1|2342336_2344754_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005012870.1|2344766_2345789_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012869.1|2345861_2346221_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012868.1|2346236_2346434_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012866.1|2346854_2348354_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012863.1|2348475_2348739_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012861.1|2348798_2350019_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005011985.1|2350112_2351333_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012855.1|2351398_2351581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2351899_2352850_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012854.1|2353097_2353436_+	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012853.1|2353483_2354722_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012851.1|2355098_2355830_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012850.1|2355826_2356633_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012848.1|2356629_2357706_-	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012847.1|2357702_2358632_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012844.1|2358750_2359896_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012843.1|2360121_2363928_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012841.1|2364060_2364726_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012840.1|2364728_2366396_-	MCE family protein	NA	NA	NA	NA	NA
WP_005012839.1|2367749_2370059_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012838.1|2370112_2372218_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012835.1|2377471_2377786_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
>prophage 9
NZ_CP043154	Bordetella holmesii strain H318 chromosome, complete genome	3699174	2381539	2443350	3699174	transposase	Leptospira_phage(17.65%)	56	NA	NA
WP_101557770.1|2381539_2382659_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012829.1|2382784_2383363_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_005012828.1|2383456_2384815_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012827.1|2385167_2385752_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012826.1|2385748_2386162_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012823.1|2386158_2387193_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012822.1|2387218_2387398_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012820.1|2387412_2388177_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005019095.1|2388330_2388987_+	adenylate kinase	NA	NA	NA	NA	NA
WP_005012817.1|2389083_2389842_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005012815.1|2389901_2391461_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012814.1|2391745_2392483_+	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012813.1|2392491_2394273_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012812.1|2394296_2394674_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012811.1|2394819_2396019_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012810.1|2397230_2397710_+	sensor protein	NA	NA	NA	NA	NA
WP_005012808.1|2397791_2398742_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012807.1|2398795_2398942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012806.1|2399143_2399407_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_005012805.1|2399532_2400303_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_005012804.1|2400345_2401341_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012803.1|2403172_2403454_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_005011985.1|2403529_2404750_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012801.1|2405665_2406400_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019092.1|2406432_2407218_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012798.1|2407594_2407882_+	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005012797.1|2407878_2408547_+	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012796.1|2408593_2408884_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012795.1|2409042_2410224_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012790.1|2410279_2411221_+	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012789.1|2411330_2412668_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_101557770.1|2412771_2413892_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012786.1|2413915_2414701_-	acyltransferase	NA	NA	NA	NA	NA
WP_005012784.1|2415001_2416189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012781.1|2416325_2418170_-	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012779.1|2418189_2419257_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012777.1|2419366_2420038_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012775.1|2420154_2420664_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_153570005.1|2420663_2421581_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012771.1|2421602_2422331_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012769.1|2422914_2423187_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005019089.1|2423509_2424754_-	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012762.1|2424800_2425538_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005012761.1|2425645_2428066_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_026087875.1|2428473_2429094_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012755.1|2429474_2429933_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005012753.1|2430042_2430984_+	AEC family transporter	NA	NA	NA	NA	NA
WP_005012751.1|2430987_2432271_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012749.1|2432388_2433609_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012747.1|2433757_2435416_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012745.1|2436776_2437076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2437155_2438106_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005019086.1|2438652_2439666_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012730.1|2439678_2440995_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_076879487.1|2441582_2442137_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_101557770.1|2442230_2443350_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
>prophage 10
NZ_CP043154	Bordetella holmesii strain H318 chromosome, complete genome	3699174	2448765	2506959	3699174	protease,transposase,tRNA	Leptospira_phage(21.43%)	53	NA	NA
WP_101557770.1|2448765_2449886_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080688213.1|2449928_2450585_+	cytochrome B	NA	NA	NA	NA	NA
WP_005012704.1|2450651_2451095_-	cytochrome c	NA	NA	NA	NA	NA
WP_005012700.1|2451156_2452533_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005019071.1|2452670_2453279_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012695.1|2453354_2454176_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005012692.1|2454257_2455370_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012689.1|2455378_2456299_-	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012688.1|2456445_2457426_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012685.1|2457486_2458353_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012682.1|2458452_2459673_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005019066.1|2459855_2460974_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012678.1|2460975_2461290_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019055.1|2461286_2462732_+	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012675.1|2462728_2463979_-	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005012673.1|2463983_2465087_-	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005019053.1|2465100_2466600_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_101557770.1|2466573_2467693_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012670.1|2469451_2470672_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_005012669.1|2470756_2471830_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012668.1|2472092_2473553_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005019040.1|2474119_2474482_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012664.1|2474544_2475198_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005012663.1|2475337_2478043_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012662.1|2478051_2479071_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_101557744.1|2479205_2480326_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012661.1|2480519_2481929_-	threonine synthase	NA	NA	NA	NA	NA
WP_005019036.1|2481925_2483230_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012659.1|2483226_2484414_-	alanine transaminase	NA	NA	NA	NA	NA
WP_005012658.1|2484639_2485101_+	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012657.1|2485097_2485562_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012656.1|2485610_2487266_+	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012655.1|2487390_2488368_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005019033.1|2488455_2489412_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012644.1|2489488_2490862_-	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005012643.1|2490858_2491695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012642.1|2491816_2492272_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012641.1|2492286_2492559_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012639.1|2492642_2492966_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012637.1|2493042_2493417_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012636.1|2493648_2494446_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012634.1|2494606_2496478_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012631.1|2496521_2497433_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012627.1|2497441_2497678_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012626.1|2497749_2498538_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012624.1|2498616_2499588_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012623.1|2499744_2500749_+	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012620.1|2500887_2502039_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012619.1|2502236_2502803_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012613.1|2502821_2504042_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012610.1|2504169_2505018_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_005019028.1|2505049_2505904_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005012607.1|2506077_2506959_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 11
NZ_CP043154	Bordetella holmesii strain H318 chromosome, complete genome	3699174	2938990	3016050	3699174	integrase,transposase,tRNA	Ralstonia_virus(21.43%)	56	2941845:2941904	2990432:2991002
WP_005019978.1|2938990_2939770_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2939792_2940740_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2940741_2940942_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2941276_2942396_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2941845:2941904	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2942717_2943434_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2943430_2944324_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2944487_2945708_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2945860_2946943_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2948622_2949606_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2949668_2951081_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2951198_2952041_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2952319_2952928_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2952943_2953564_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2953629_2954337_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2954341_2955064_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2955050_2955341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2955416_2956637_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2957361_2958213_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2958264_2959518_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2959694_2960483_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2960602_2961517_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2961649_2963542_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2963727_2965107_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2965551_2965848_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2969648_2970251_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2970384_2970843_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2970844_2971444_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2971452_2972262_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2972296_2973151_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2973270_2973858_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2973854_2975234_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2975738_2975885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2983556_2984897_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2984910_2985762_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2985773_2987039_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2987100_2989005_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2990980_2991835_-	hypothetical protein	NA	NA	NA	NA	NA
2990432:2991002	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2991827_2992622_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2992837_2993788_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2994390_2995188_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2995227_2995881_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2995861_2996926_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2997089_2999315_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2999560_3001405_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|3001521_3002394_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|3002440_3004141_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3004203_3005403_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3005413_3006292_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3006398_3007436_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3007516_3007921_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3007932_3009390_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3010032_3010629_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3010789_3011248_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3012025_3012997_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3013118_3013538_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3014829_3016050_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
