The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043153	Bordetella holmesii strain H319 chromosome, complete genome	3694444	1095291	1202080	3694444	transposase,protease,tRNA	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095291_1096512_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096599_1097190_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097186_1097489_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097540_1098530_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098650_1099532_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099705_1100560_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100591_1101440_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101567_1102788_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102806_1103373_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103570_1104722_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104860_1105865_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106021_1106993_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107071_1107860_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107931_1108168_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108176_1109088_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109131_1111003_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111163_1111961_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112192_1112567_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112643_1112967_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113050_1113323_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113337_1113793_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113914_1114751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114747_1116121_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116197_1117154_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117241_1118219_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118343_1119999_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120047_1120512_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120508_1120970_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121195_1122383_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122379_1123684_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123680_1125090_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125283_1126403_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126538_1127558_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127566_1130272_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130411_1131065_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131127_1131490_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132056_1133517_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133779_1134853_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134937_1136158_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137915_1139036_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1139009_1140509_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140522_1141626_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141630_1142881_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142877_1144323_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144319_1144634_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144635_1145754_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145936_1147157_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147256_1148123_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148183_1149164_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149310_1150231_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150239_1151352_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151433_1152255_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152330_1152939_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153076_1154453_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154514_1154958_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155024_1155681_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155723_1156843_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1157012_1157294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1158004_1158793_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158789_1159896_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160570_1161929_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162043_1162241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162258_1163379_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163472_1164027_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164614_1165931_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165943_1166957_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167503_1168454_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168533_1168833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170193_1171852_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1172000_1173221_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173338_1174622_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174625_1175567_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175676_1176135_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176515_1177136_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177543_1179964_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180071_1180809_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180855_1182100_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182422_1182695_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183278_1184007_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184028_1184946_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184945_1185455_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185571_1186243_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186352_1187420_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187439_1189284_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189420_1190608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190908_1191694_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191717_1192837_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192941_1194279_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194388_1195330_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195385_1196567_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196725_1197016_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197062_1197731_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197727_1198015_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198391_1199177_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199209_1199944_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200859_1202080_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043153	Bordetella holmesii strain H319 chromosome, complete genome	3694444	1206867	1263273	3694444	transposase,protease,tRNA	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1206867_1207818_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207899_1208379_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209590_1210790_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210935_1211313_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211336_1213118_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213126_1213864_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214148_1215708_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215767_1216526_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216622_1217279_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217432_1218197_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218211_1218391_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218416_1219451_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219447_1219861_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219857_1220442_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220794_1222153_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222246_1222825_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222949_1224070_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224142_1225399_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225502_1226708_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226771_1227221_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227353_1227599_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227823_1228138_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233391_1235497_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235550_1237860_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239213_1240881_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240883_1241549_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241681_1245488_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245713_1246859_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246977_1247907_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247903_1248980_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248976_1249783_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249779_1250511_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250887_1252126_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252173_1252512_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252759_1253710_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254028_1254211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254276_1255497_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255590_1256811_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256870_1257134_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257255_1258755_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1258802_1259078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259175_1259373_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259388_1259748_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259820_1260843_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260855_1263273_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043153	Bordetella holmesii strain H319 chromosome, complete genome	3694444	1651644	1692017	3694444	transposase,tRNA,integrase	Leptospira_phage(28.57%)	39	1644086:1644102	1688703:1688719
1644086:1644102	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|1651644_1652764_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1653416_1654172_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1654348_1655143_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1655139_1655577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1655688_1655841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1656261_1657230_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1657386_1658394_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1658451_1658910_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1658983_1660330_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1660347_1660719_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1660718_1662188_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1662343_1663069_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1663082_1665797_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1666048_1667413_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1667452_1668511_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1668538_1669357_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1669394_1669673_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1670936_1671236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1671805_1673209_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1673221_1673872_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1674013_1675234_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1675264_1676341_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1676487_1677618_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1677804_1679430_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1679436_1680252_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1680266_1681337_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1681388_1682048_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1682687_1683850_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1683891_1684206_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1684189_1684576_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1684614_1684881_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1685273_1685963_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1686062_1686224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1686374_1686539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1686665_1686902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1687091_1687340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1687453_1688824_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1688703:1688719	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1688824_1689565_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1690064_1692017_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 5
NZ_CP043153	Bordetella holmesii strain H319 chromosome, complete genome	3694444	1710311	1754238	3694444	transposase,holin,tRNA,integrase	Leptospira_phage(33.33%)	37	1752806:1752820	1759282:1759296
WP_005019367.1|1710311_1713173_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1713162_1714128_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1714884_1716360_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1716364_1716640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1716976_1718096_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1717970_1718219_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1718397_1719606_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1719602_1721885_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1721895_1724277_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1724540_1726448_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1726462_1727353_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1727359_1728493_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1728492_1729314_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1729338_1730529_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1730830_1731112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1731277_1731598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1731637_1732724_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1732920_1733181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1733673_1734444_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1734440_1735451_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1735485_1736328_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1736790_1737576_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1738435_1739555_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1740621_1741626_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1741701_1742514_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1742741_1744913_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1744966_1746286_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_153567296.1|1746374_1747595_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	6.1e-183
WP_005013678.1|1747813_1748674_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1748670_1749894_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1750192_1750690_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1750728_1751511_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1751536_1751755_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1751829_1752099_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1752318_1752783_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1752806:1752820	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1752856_1753138_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1753254_1754238_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1759282:1759296	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP043153	Bordetella holmesii strain H319 chromosome, complete genome	3694444	1779514	1820905	3694444	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1779514_1780465_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1780461_1780977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1781334_1781955_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1782054_1782306_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1782393_1783872_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1783868_1787039_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1787051_1788248_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1788436_1789369_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1789437_1790169_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1790234_1790870_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1790855_1792034_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1792194_1792743_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1792823_1793183_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1793230_1794451_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1794526_1795648_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1795685_1796399_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1796409_1797630_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1797712_1798267_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1798412_1799363_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1799322_1799484_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1799524_1800451_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1800464_1801337_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1801499_1802447_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1802785_1803367_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1803944_1804895_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1804874_1805627_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1805639_1806371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1806527_1808693_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1808782_1809052_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1809140_1809347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1809345_1809864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1809882_1810662_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1810829_1811846_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1811918_1812410_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1812420_1814136_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1815299_1816250_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1817901_1819143_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1819154_1819928_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1819954_1820905_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043153	Bordetella holmesii strain H319 chromosome, complete genome	3694444	2148070	2208193	3694444	protease,transposase,tRNA	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2148070_2148559_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2148551_2149400_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2149491_2149989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2150126_2150486_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2150482_2150764_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2150763_2151246_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2151247_2152876_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2152872_2153217_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2153218_2156161_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2156606_2157578_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2157567_2158950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2159092_2160043_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2160002_2161244_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2161240_2162362_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2163853_2164321_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2164391_2165042_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2165128_2166268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2166436_2167441_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2167437_2168685_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2169037_2169904_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2169863_2171468_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2171479_2172166_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2172162_2173203_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2173318_2173990_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2173986_2174979_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2174975_2175914_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2175910_2177065_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2177073_2178525_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2178555_2179038_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2179039_2179933_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2179929_2180373_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2180385_2180760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2180902_2181301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2181427_2181715_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2181711_2182128_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2182303_2182936_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2182964_2183411_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2183697_2184849_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2184962_2185967_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2186950_2187658_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2187590_2189042_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2189047_2192206_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2192218_2192740_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2192729_2193554_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2193550_2194150_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2194258_2196115_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2196263_2197268_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2197476_2198739_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2198743_2199079_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2199075_2200005_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2200009_2200723_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2200826_2202284_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2202280_2202577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2202701_2204060_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2204160_2204961_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2205140_2206259_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2206331_2206703_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2206709_2207561_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2207581_2208193_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043153	Bordetella holmesii strain H319 chromosome, complete genome	3694444	2303316	2424827	3694444	protease,transposase,tRNA,integrase	Leptospira_phage(12.5%)	104	2334846:2334905	2356153:2356427
WP_101557807.1|2303316_2304479_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2304591_2305560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2305556_2306477_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2306573_2311052_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2311430_2315765_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2316403_2316967_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2316978_2317224_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2317379_2317889_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2317934_2318915_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2319126_2321478_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2321524_2322355_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2322351_2323041_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2323033_2324314_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2324411_2325350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2325331_2327038_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2327115_2328219_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2328271_2329021_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2329027_2330542_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005014513.1|2330554_2330842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2330862_2331750_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2331900_2332407_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2332403_2333360_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2333547_2334894_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2334846:2334905	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2334861_2335092_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2335121_2335685_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2335839_2336610_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2336606_2337617_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2337931_2338378_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2338433_2338628_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2338629_2338971_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2338980_2340843_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2340882_2341389_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2341392_2341716_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2341717_2342122_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2342158_2343370_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2343391_2343940_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2344164_2344656_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2344870_2346901_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2346975_2348178_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2348720_2349656_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2350689_2350971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2351057_2351231_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2351342_2351687_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2351758_2352427_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2353842_2354886_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2354882_2354984_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2355075_2356195_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2356445_2357099_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2356153:2356427	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2357214_2358435_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2358485_2360915_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2361080_2362379_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2362483_2363137_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2363139_2364450_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2364677_2365217_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2365695_2365962_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2366000_2366366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2366247_2367258_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2367254_2368025_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2368110_2368770_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2368737_2369229_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2369338_2369542_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2369859_2370180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2370163_2370499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2370553_2370766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2370841_2371180_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2371176_2371512_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2371574_2373146_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2373939_2374251_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557886.1|2374441_2375562_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2375689_2375884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2381966_2383128_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2383513_2384977_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2385109_2386660_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2386656_2386806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014703.1|2389207_2390065_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2390117_2390615_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2390735_2392151_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2392160_2393345_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2393341_2394940_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2396122_2396368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2396778_2396964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2397119_2398031_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2398152_2398995_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014726.1|2400880_2402392_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2402544_2403276_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2403382_2404684_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2404691_2405600_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2405596_2406190_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2406233_2406647_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2406643_2407114_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2407120_2407726_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2409527_2411312_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2411308_2412694_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2412679_2413642_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2413711_2414341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2414378_2415587_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2415708_2416278_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2416409_2417963_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2418266_2419487_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2419894_2420797_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2420793_2421663_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2421659_2422511_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2422507_2423332_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2423606_2424827_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043153	Bordetella holmesii strain H319 chromosome, complete genome	3694444	2624172	2671799	3694444	protease,transposase,tRNA	Bacillus_phage(25.0%)	47	NA	NA
WP_005015146.1|2624172_2624925_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005015148.1|2624967_2625687_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005015150.1|2625729_2626785_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_101557744.1|2627794_2628914_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015154.1|2629474_2630053_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_005012861.1|2630195_2631416_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005015155.1|2631720_2632698_+	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_005015156.1|2632846_2633677_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015157.1|2633790_2634606_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015162.1|2634628_2635483_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015163.1|2635481_2635865_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005015164.1|2635971_2637345_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
WP_005019837.1|2637416_2637908_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_005015166.1|2637907_2638660_-	membrane protein	NA	NA	NA	NA	NA
WP_005015167.1|2639007_2639211_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_005015168.1|2639240_2639663_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_005015169.1|2639674_2640772_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005015170.1|2640784_2642254_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_005015171.1|2642375_2643215_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
WP_005019846.1|2643236_2644094_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_005015173.1|2644166_2645285_-	porin	NA	NA	NA	NA	NA
WP_005015175.1|2645271_2645886_-	magnesium transporting ATPase P-type 1	NA	NA	NA	NA	NA
WP_101557744.1|2645915_2647036_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005015176.1|2647079_2647709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015177.1|2647866_2649210_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005015178.1|2649218_2649602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015179.1|2649761_2650913_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_005015180.1|2651011_2651962_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015181.1|2652105_2653131_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005015182.1|2653171_2653411_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_005019849.1|2653476_2655066_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	4.3e-64
WP_005015184.1|2655065_2655611_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A088FT24	Mycobacterium_phage	30.8	3.5e-05
WP_005015187.1|2655694_2656267_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005019851.1|2656270_2657038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015190.1|2657069_2657405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015191.1|2657328_2658396_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.5	2.1e-06
WP_005015192.1|2658392_2660213_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	33.9	8.7e-77
WP_005015193.1|2660328_2661537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015194.1|2661770_2662472_+	response regulator	NA	W8CYM9	Bacillus_phage	36.6	2.8e-31
WP_005015195.1|2662484_2663963_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005015196.1|2663978_2665031_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005019853.1|2665027_2666365_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005015199.1|2666483_2668244_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	52.4	2.2e-170
WP_005015201.1|2668429_2669272_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_005015204.1|2669365_2670181_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_005015207.1|2670184_2670457_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005012365.1|2670578_2671799_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.2e-183
>prophage 10
NZ_CP043153	Bordetella holmesii strain H319 chromosome, complete genome	3694444	2934285	3009967	3694444	transposase,tRNA,integrase	Leptospira_phage(14.29%)	56	2937140:2937199	2985727:2986297
WP_005019978.1|2934285_2935065_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2935087_2936035_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2936036_2936237_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2936571_2937691_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2937140:2937199	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2938012_2938729_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2938725_2939619_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2939782_2941003_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2941155_2942238_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2943917_2944901_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2944963_2946376_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2946493_2947336_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2947614_2948223_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2948238_2948859_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2948924_2949632_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2949636_2950359_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2950345_2950636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2950711_2951932_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2952656_2953508_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2953559_2954813_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2954989_2955778_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2955897_2956812_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2956944_2958837_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2959022_2960402_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2960846_2961143_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2964943_2965546_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2965679_2966138_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2966139_2966739_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2966747_2967557_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2967591_2968446_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2968565_2969153_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2969149_2970529_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2971033_2971180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2978851_2980192_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2980205_2981057_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2981068_2982334_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2982395_2984300_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2986275_2987130_-	hypothetical protein	NA	NA	NA	NA	NA
2985727:2986297	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2987122_2987917_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2988132_2989083_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2989685_2990483_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2990522_2991176_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2991156_2992221_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2992384_2994610_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2994855_2996700_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2996816_2997689_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2997735_2999436_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|2999498_3000698_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3000708_3001587_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3001693_3002731_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3002811_3003216_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3003227_3004685_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3005327_3005924_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3006084_3006543_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3007320_3008292_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3008413_3008833_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_101557744.1|3008846_3009967_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
