The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043152	Bordetella holmesii strain H336 chromosome, complete genome	3697619	1095290	1203128	3697619	transposase,tRNA,protease	Ralstonia_virus(16.67%)	97	NA	NA
WP_005011985.1|1095290_1096511_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096598_1097189_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097185_1097488_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097539_1098529_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098649_1099531_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099704_1100559_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100590_1101439_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101566_1102787_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102805_1103372_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103569_1104721_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104859_1105864_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106020_1106992_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107070_1107859_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107930_1108167_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108175_1109087_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109130_1111002_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111162_1111960_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112191_1112566_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112642_1112966_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113049_1113322_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113336_1113792_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113913_1114750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114746_1116120_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116196_1117153_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117240_1118218_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005017650.1|1118470_1119421_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_153569496.1|1119400_1121047_-	AAA family ATPase	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.0e-68
WP_005012657.1|1121095_1121560_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1121556_1122018_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1122243_1123431_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1123427_1124732_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1124728_1126138_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1126331_1127451_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1127586_1128606_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1128614_1131320_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1131459_1132113_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1132175_1132538_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1133104_1134565_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1134827_1135901_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1135985_1137206_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1138963_1140084_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1140057_1141557_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1141570_1142674_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1142678_1143929_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1143925_1145371_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1145367_1145682_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1145683_1146802_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1146984_1148205_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1148304_1149171_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1149231_1150212_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1150358_1151279_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1151287_1152400_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1152481_1153303_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1153378_1153987_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1154124_1155501_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1155562_1156006_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1156072_1156729_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1156771_1157891_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1158060_1158342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1159052_1159841_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1159837_1160944_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1161618_1162977_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1163091_1163289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1163306_1164427_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1164520_1165075_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1165662_1166979_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1166991_1168005_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1168551_1169502_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1169581_1169881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1171241_1172900_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1173048_1174269_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1174386_1175670_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1175673_1176615_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1176724_1177183_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1177563_1178184_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1178591_1181012_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1181119_1181857_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1181903_1183148_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1183470_1183743_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1184326_1185055_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1185076_1185994_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1185993_1186503_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1186619_1187291_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1187400_1188468_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1188487_1190332_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1190468_1191656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1191956_1192742_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1192765_1193885_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1193989_1195327_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1195436_1196378_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1196433_1197615_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1197773_1198064_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1198110_1198779_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1198775_1199063_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1199439_1200225_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1200257_1200992_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1201907_1203128_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043152	Bordetella holmesii strain H336 chromosome, complete genome	3697619	1207915	1264321	3697619	transposase,tRNA,protease	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1207915_1208866_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1208947_1209427_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1210638_1211838_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1211983_1212361_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1212384_1214166_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1214174_1214912_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1215196_1216756_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1216815_1217574_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1217670_1218327_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1218480_1219245_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1219259_1219439_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1219464_1220499_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1220495_1220909_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1220905_1221490_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1221842_1223201_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1223294_1223873_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1223997_1225118_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1225190_1226447_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1226550_1227756_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1227819_1228269_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1228401_1228647_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1228871_1229186_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1234439_1236545_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1236598_1238908_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1240261_1241929_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1241931_1242597_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1242729_1246536_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1246761_1247907_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1248025_1248955_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1248951_1250028_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1250024_1250831_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1250827_1251559_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1251935_1253174_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1253221_1253560_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1253807_1254758_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1255076_1255259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1255324_1256545_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1256638_1257859_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1257918_1258182_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1258303_1259803_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1259850_1260126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1260223_1260421_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1260436_1260796_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1260868_1261891_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1261903_1264321_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043152	Bordetella holmesii strain H336 chromosome, complete genome	3697619	1587859	1694114	3697619	transposase,integrase,tRNA	Leptospira_phage(14.29%)	100	1645134:1645150	1690800:1690816
WP_005011985.1|1587859_1589080_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1589434_1589911_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1590169_1590778_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1590796_1591468_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1591641_1593528_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1593555_1594398_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1594394_1595738_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1595922_1596738_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1596803_1598285_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1598483_1600556_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1600775_1601813_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1602999_1603857_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1603884_1604661_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1605488_1605998_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1607075_1607846_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1607842_1608853_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1608911_1609992_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1610160_1611280_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1611281_1612025_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1612029_1612401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1612461_1612707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1612813_1614313_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1614934_1615270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1615528_1615660_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1615689_1616187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1616196_1616571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1616661_1617954_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1618070_1618970_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1619121_1619340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1619813_1621439_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1621674_1623198_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1623169_1623865_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1624205_1625267_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1625312_1625864_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1625870_1626791_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1626930_1629228_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1629283_1630504_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1630762_1631368_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1631378_1632539_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1632560_1633442_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1633738_1634437_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1634578_1635301_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1635419_1636358_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1636388_1637168_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1637154_1638378_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1638382_1639930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1639965_1640499_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1640742_1641438_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1641452_1641584_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1641631_1642756_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1642761_1645101_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1645097_1645505_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1645134:1645150	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1645766_1646027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1646249_1647200_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1647298_1648249_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1648298_1649507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1649728_1650268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1650492_1650897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1650961_1651717_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1651716_1653078_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1653074_1653698_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1653741_1654861_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1655513_1656269_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1656445_1657240_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1657236_1657674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1657785_1657938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1658358_1659327_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1659483_1660491_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1660548_1661007_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1661080_1662427_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1662444_1662816_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1662815_1664285_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1664440_1665166_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1665179_1667894_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1668145_1669510_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1669549_1670608_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1670635_1671454_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1671491_1671770_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1673033_1673333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1673902_1675306_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1675318_1675969_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1676110_1677331_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1677361_1678438_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1678584_1679715_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1679901_1681527_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1681533_1682349_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1682363_1683434_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1683485_1684145_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1684784_1685947_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1685988_1686303_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1686286_1686673_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1686711_1686978_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1687370_1688060_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1688159_1688321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1688471_1688636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1688762_1688999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1689188_1689437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1689550_1690921_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1690800:1690816	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1690921_1691662_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1692161_1694114_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043152	Bordetella holmesii strain H336 chromosome, complete genome	3697619	1712408	1756335	3697619	transposase,integrase,holin,tRNA	Leptospira_phage(33.33%)	37	1754903:1754917	1761379:1761393
WP_005019367.1|1712408_1715270_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1715259_1716225_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1716981_1718457_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1718461_1718737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1719073_1720193_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1720067_1720316_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1720494_1721703_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1721699_1723982_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1723992_1726374_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1726637_1728545_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1728559_1729450_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1729456_1730590_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1730589_1731411_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1731435_1732626_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1732927_1733209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1733374_1733695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1733734_1734821_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1735017_1735278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1735770_1736541_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1736537_1737548_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1737582_1738425_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1738887_1739673_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1740532_1741652_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1742718_1743723_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1743798_1744611_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1744838_1747010_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1747063_1748383_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1748471_1749692_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1749910_1750771_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1750767_1751991_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1752289_1752787_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1752825_1753608_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1753633_1753852_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1753926_1754196_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1754415_1754880_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1754903:1754917	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1754953_1755235_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1755351_1756335_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1761379:1761393	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043152	Bordetella holmesii strain H336 chromosome, complete genome	3697619	1781611	1823002	3697619	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1781611_1782562_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1782558_1783074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1783431_1784052_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1784151_1784403_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1784490_1785969_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1785965_1789136_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1789148_1790345_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1790533_1791466_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1791534_1792266_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1792331_1792967_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1792952_1794131_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1794291_1794840_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1794920_1795280_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1795327_1796548_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1796623_1797745_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1797782_1798496_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1798506_1799727_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1799809_1800364_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1800509_1801460_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1801419_1801581_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1801621_1802548_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1802561_1803434_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1803596_1804544_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1804882_1805464_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1806041_1806992_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1806971_1807724_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1807736_1808468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1808624_1810790_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1810879_1811149_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1811237_1811444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1811442_1811961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1811979_1812759_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1812926_1813943_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1814015_1814507_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1814517_1816233_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1817396_1818347_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1819998_1821240_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1821251_1822025_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1822051_1823002_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043152	Bordetella holmesii strain H336 chromosome, complete genome	3697619	2151216	2211339	3697619	transposase,protease,tRNA	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2151216_2151705_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2151697_2152546_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2152637_2153135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2153272_2153632_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2153628_2153910_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2153909_2154392_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2154393_2156022_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2156018_2156363_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2156364_2159307_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2159752_2160724_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2160713_2162096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2162238_2163189_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2163148_2164390_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2164386_2165508_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2166999_2167467_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2167537_2168188_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2168274_2169414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2169582_2170587_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2170583_2171831_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2172183_2173050_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2173009_2174614_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2174625_2175312_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2175308_2176349_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2176464_2177136_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2177132_2178125_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2178121_2179060_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2179056_2180211_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2180219_2181671_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2181701_2182184_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2182185_2183079_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2183075_2183519_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2183531_2183906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2184048_2184447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2184573_2184861_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2184857_2185274_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2185449_2186082_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2186110_2186557_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2186843_2187995_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2188108_2189113_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2190096_2190804_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2190736_2192188_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2192193_2195352_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2195364_2195886_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2195875_2196700_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2196696_2197296_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2197404_2199261_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2199409_2200414_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2200622_2201885_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2201889_2202225_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2202221_2203151_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2203155_2203869_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2203972_2205430_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2205426_2205723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2205847_2207206_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2207306_2208107_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2208286_2209405_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2209477_2209849_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2209855_2210707_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2210727_2211339_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043152	Bordetella holmesii strain H336 chromosome, complete genome	3697619	2306462	2427973	3697619	transposase,integrase,protease,tRNA	Leptospira_phage(15.15%)	106	2337992:2338051	2359299:2359573
WP_101557807.1|2306462_2307625_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2307737_2308706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2308702_2309623_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2309719_2314198_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2314576_2318911_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2319549_2320113_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2320124_2320370_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2320525_2321035_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2321080_2322061_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2322272_2324624_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2324670_2325501_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2325497_2326187_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2326179_2327460_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2327557_2328496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2328477_2330184_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2330261_2331365_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2331417_2332167_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2332173_2333688_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2333700_2333988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2334008_2334896_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2335046_2335553_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2335549_2336506_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2336693_2338040_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2337992:2338051	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2338007_2338238_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2338267_2338831_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2338985_2339756_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2339752_2340763_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2341077_2341524_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2341579_2341774_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2341775_2342117_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2342126_2343989_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2344028_2344535_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2344538_2344862_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2344863_2345268_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2345304_2346516_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2346537_2347086_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2347310_2347802_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2348016_2350047_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2350121_2351324_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2351866_2352802_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2353835_2354117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2354203_2354377_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2354488_2354833_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2354904_2355573_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2356988_2358032_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2358028_2358130_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2358221_2359341_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2359591_2360245_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2359299:2359573	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2360360_2361581_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2361631_2364061_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2364226_2365525_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2365629_2366283_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2366285_2367596_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2367823_2368363_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2368841_2369108_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2369146_2369512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032965889.1|2369393_2370404_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2370400_2371171_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2371256_2371916_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2371883_2372375_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2372484_2372688_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2373005_2373326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2373309_2373645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2373699_2373912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2373987_2374326_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_017685558.1|2374313_2374658_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2374720_2376292_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2377085_2377397_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2377589_2378710_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2378837_2379032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2385114_2386276_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2386661_2388125_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2388257_2389808_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2389804_2389954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2390119_2391240_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2392353_2393211_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2393263_2393761_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2393881_2395297_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2395306_2396491_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2396487_2398086_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2399268_2399514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2399924_2400110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2400265_2401177_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2401298_2402141_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2402343_2403717_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2404026_2405538_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2405690_2406422_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2406528_2407830_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2407837_2408746_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2408742_2409336_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2409379_2409793_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2409789_2410260_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2410266_2410872_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2412673_2414458_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2414454_2415840_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2415825_2416788_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2416857_2417487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2417524_2418733_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2418854_2419424_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2419555_2421109_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2421412_2422633_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2423040_2423943_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2423939_2424809_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2424805_2425657_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2425653_2426478_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2426752_2427973_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043152	Bordetella holmesii strain H336 chromosome, complete genome	3697619	2937434	3014494	3697619	transposase,integrase,tRNA	Ralstonia_virus(21.43%)	56	2940289:2940348	2988876:2989446
WP_005019978.1|2937434_2938214_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2938236_2939184_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2939185_2939386_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2939720_2940840_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2940289:2940348	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2941161_2941878_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2941874_2942768_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2942931_2944152_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2944304_2945387_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2947066_2948050_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2948112_2949525_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2949642_2950485_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2950763_2951372_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2951387_2952008_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2952073_2952781_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2952785_2953508_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2953494_2953785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2953860_2955081_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2955805_2956657_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2956708_2957962_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2958138_2958927_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2959046_2959961_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2960093_2961986_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2962171_2963551_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2963995_2964292_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2968092_2968695_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2968828_2969287_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2969288_2969888_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2969896_2970706_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2970740_2971595_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2971714_2972302_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2972298_2973678_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2974182_2974329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2982000_2983341_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2983354_2984206_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2984217_2985483_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2985544_2987449_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2989424_2990279_-	hypothetical protein	NA	NA	NA	NA	NA
2988876:2989446	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2990271_2991066_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2991281_2992232_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2992834_2993632_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2993671_2994325_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2994305_2995370_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2995533_2997759_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2998004_2999849_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2999965_3000838_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|3000884_3002585_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3002647_3003847_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3003857_3004736_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3004842_3005880_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3005960_3006365_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3006376_3007834_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3008476_3009073_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3009233_3009692_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3010469_3011441_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3011562_3011982_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3013273_3014494_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
