The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043151	Bordetella holmesii strain H359 chromosome, complete genome	3695562	1095277	1202065	3695562	transposase,protease,tRNA	Ralstonia_virus(16.67%)	95	NA	NA
WP_005011985.1|1095277_1096498_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096585_1097176_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097172_1097475_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097526_1098516_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098636_1099518_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099691_1100546_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100577_1101426_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101553_1102774_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102792_1103359_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103556_1104708_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104846_1105851_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106007_1106979_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107057_1107846_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107917_1108154_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108162_1109074_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109117_1110989_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111149_1111947_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112178_1112553_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112629_1112953_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113036_1113309_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113323_1113779_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113900_1114737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114733_1116107_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116183_1117140_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117227_1118205_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118329_1119985_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120033_1120498_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120494_1120956_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121181_1122369_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122365_1123670_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123666_1125076_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125269_1126389_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126524_1127544_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127552_1130258_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130397_1131051_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131113_1131476_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132042_1133503_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133765_1134839_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134923_1136144_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137901_1139022_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138995_1140495_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140508_1141612_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141616_1142867_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142863_1144309_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144305_1144620_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144621_1145740_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145922_1147143_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147242_1148109_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148169_1149150_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149296_1150217_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150225_1151338_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151419_1152241_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152316_1152925_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153062_1154439_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154500_1154944_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155010_1155667_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155709_1156829_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156998_1157280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157990_1158779_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158775_1159882_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160556_1161915_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162029_1162227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162244_1163365_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163458_1164013_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164600_1165917_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165929_1166943_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012745.1|1168518_1168818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170178_1171837_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171985_1173206_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173323_1174607_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174610_1175552_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175661_1176120_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176500_1177121_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177528_1179949_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180056_1180794_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180840_1182085_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182407_1182680_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183263_1183992_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184013_1184931_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184930_1185440_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185556_1186228_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186337_1187405_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187424_1189269_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189405_1190593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190893_1191679_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191702_1192822_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192926_1194264_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194373_1195315_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195370_1196552_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196710_1197001_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197047_1197716_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197712_1198000_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198376_1199162_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199194_1199929_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200844_1202065_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043151	Bordetella holmesii strain H359 chromosome, complete genome	3695562	1206852	1261944	3695562	transposase,protease,tRNA	Ralstonia_virus(16.67%)	43	NA	NA
WP_005012808.1|1206852_1207803_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207884_1208364_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209575_1210775_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210920_1211298_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211321_1213103_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213111_1213849_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214133_1215693_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215752_1216511_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216607_1217264_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217417_1218182_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218196_1218376_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218401_1219436_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219432_1219846_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219842_1220427_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220779_1222138_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222231_1222810_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222934_1224055_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224127_1225384_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225487_1226693_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226756_1227206_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227338_1227584_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227808_1228123_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233376_1235482_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235535_1237845_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239198_1240866_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240868_1241534_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241666_1245473_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245698_1246844_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246962_1247892_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247888_1248965_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248961_1249768_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249764_1250496_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250872_1252111_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252158_1252497_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252744_1253695_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254013_1254196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012861.1|1254261_1255482_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1255541_1255805_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1255926_1257426_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012868.1|1257846_1258044_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1258059_1258419_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1258491_1259514_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1259526_1261944_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043151	Bordetella holmesii strain H359 chromosome, complete genome	3695562	1585482	1691743	3695562	integrase,transposase,tRNA	Leptospira_phage(14.29%)	100	1642757:1642773	1688423:1688439
WP_005011985.1|1585482_1586703_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1587057_1587534_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1587792_1588401_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1588419_1589091_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1589264_1591151_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1591178_1592021_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1592017_1593361_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1593545_1594361_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1594426_1595908_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1596106_1598179_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1598398_1599436_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1600622_1601480_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1601507_1602284_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1603111_1603621_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1604698_1605469_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1605465_1606476_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1606534_1607615_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1607783_1608903_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1608904_1609648_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1609652_1610024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1610084_1610330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1610436_1611936_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1612557_1612893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1613151_1613283_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1613312_1613810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1613819_1614194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1614284_1615577_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1615693_1616593_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1616744_1616963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1617436_1619062_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1619297_1620821_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1620792_1621488_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1621828_1622890_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1622935_1623487_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1623493_1624414_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1624553_1626851_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1626906_1628127_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1628385_1628991_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1629001_1630162_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1630183_1631065_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1631361_1632060_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1632201_1632924_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1633042_1633981_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1634011_1634791_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1634777_1636001_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1636005_1637553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1637588_1638122_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1638365_1639061_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1639075_1639207_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1639254_1640379_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1640384_1642724_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1642720_1643128_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1642757:1642773	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1643389_1643650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1643872_1644823_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1644921_1645872_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1645921_1647130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1647351_1647891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1648115_1648520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1648584_1649340_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1649339_1650701_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1650697_1651321_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1651364_1652484_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1653136_1653892_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1654068_1654863_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1654859_1655297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1655408_1655561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1655981_1656950_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1657106_1658114_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1658171_1658630_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1658703_1660050_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1660067_1660439_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1660438_1661908_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1662063_1662789_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1662802_1665517_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1665768_1667133_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1667172_1668231_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1668258_1669077_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1669114_1669393_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1670656_1670956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1671525_1672929_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1672941_1673592_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1673733_1674954_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1674984_1676061_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1676207_1677338_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1677524_1679150_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1679156_1679972_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1679986_1681057_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1681108_1681768_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1682407_1683570_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1683611_1683926_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1683909_1684296_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1684334_1684601_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1684993_1685683_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1685782_1685944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1686094_1686259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1686385_1686622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1686811_1687060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1687173_1688544_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1688423:1688439	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1688544_1689285_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1689790_1691743_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043151	Bordetella holmesii strain H359 chromosome, complete genome	3695562	1710037	1753964	3695562	integrase,transposase,holin,tRNA	Leptospira_phage(33.33%)	37	1752532:1752546	1759008:1759022
WP_005019367.1|1710037_1712899_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1712888_1713854_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1714610_1716086_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1716090_1716366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1716702_1717822_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1717696_1717945_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1718123_1719332_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1719328_1721611_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1721621_1724003_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1724266_1726174_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1726188_1727079_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1727085_1728219_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1728218_1729040_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1729064_1730255_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1730556_1730838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1731003_1731324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1731363_1732450_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1732646_1732907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1733399_1734170_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1734166_1735177_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1735211_1736054_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1736516_1737302_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1738161_1739281_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1740347_1741352_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1741427_1742240_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1742467_1744639_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1744692_1746012_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1746100_1747321_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1747539_1748400_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1748396_1749620_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1749918_1750416_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1750454_1751237_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1751262_1751481_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1751555_1751825_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1752044_1752509_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1752532:1752546	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1752582_1752864_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1752980_1753964_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1759008:1759022	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043151	Bordetella holmesii strain H359 chromosome, complete genome	3695562	1779240	1838627	3695562	transposase	Ralstonia_virus(40.0%)	52	NA	NA
WP_005012067.1|1779240_1780191_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1780187_1780703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1781060_1781681_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1781780_1782032_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1782119_1783598_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1783594_1786765_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1786777_1787974_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1788162_1789095_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1789163_1789895_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1789960_1790596_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1790581_1791760_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1791920_1792469_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1792549_1792909_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1792956_1794177_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1794252_1795374_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1795411_1796125_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1796135_1797356_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1797438_1797993_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1798138_1799089_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1799048_1799210_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1799250_1800177_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1800190_1801063_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1801225_1802173_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1802511_1803093_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1803670_1804621_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1804600_1805353_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1805365_1806097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1806253_1808419_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1808508_1808778_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1808866_1809073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1809071_1809590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1809608_1810388_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1810555_1811572_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1811644_1812136_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1812146_1813862_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1815025_1815976_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1817627_1818869_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1818880_1819654_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1819680_1820631_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814011.1|1820729_1821512_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003814013.1|1823553_1824939_+	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_005013750.1|1824957_1825563_+	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_005013751.1|1825559_1827416_+	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_005013752.1|1827412_1828213_+	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_005013753.1|1828227_1829421_+	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_005013754.1|1829488_1830463_+	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_005013755.1|1830585_1831809_+	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_005013756.1|1831919_1834124_+	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_005013757.1|1834418_1835048_+	MarC family protein	NA	NA	NA	NA	NA
WP_025341443.1|1835055_1835262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076879523.1|1836502_1837243_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005016705.1|1837676_1838627_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043151	Bordetella holmesii strain H359 chromosome, complete genome	3695562	2149894	2210017	3695562	transposase,protease,tRNA	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2149894_2150383_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150375_2151224_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151315_2151813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2151950_2152310_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152306_2152588_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152587_2153070_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153071_2154700_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154696_2155041_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155042_2157985_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158430_2159402_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159391_2160774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2160916_2161867_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2161826_2163068_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163064_2164186_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165677_2166145_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166215_2166866_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2166952_2168092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168260_2169265_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169261_2170509_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2170861_2171728_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171687_2173292_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173303_2173990_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2173986_2175027_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175142_2175814_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2175810_2176803_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2176799_2177738_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2177734_2178889_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2178897_2180349_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180379_2180862_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2180863_2181757_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2181753_2182197_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182209_2182584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2182726_2183125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183251_2183539_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183535_2183952_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184127_2184760_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2184788_2185235_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185521_2186673_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2186786_2187791_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2188774_2189482_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189414_2190866_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2190871_2194030_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194042_2194564_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194553_2195378_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195374_2195974_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196082_2197939_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198087_2199092_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199300_2200563_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200567_2200903_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2200899_2201829_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2201833_2202547_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202650_2204108_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204104_2204401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204525_2205884_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2205984_2206785_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_153569491.1|2206964_2208083_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.2	9.7e-79
WP_005014289.1|2208155_2208527_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208533_2209385_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209405_2210017_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043151	Bordetella holmesii strain H359 chromosome, complete genome	3695562	2305140	2425920	3695562	integrase,transposase,protease,tRNA	Leptospira_phage(15.62%)	105	2305123:2305182	2384183:2384701
2305123:2305182	attL	TGAATCGCCCCGGGTTTCTTAGACAGTCCCGTTCATCAAAAAGTAGCGCCGTTCGAACTC	NA	NA	NA	NA
WP_101557807.1|2305140_2306303_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306415_2307384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307380_2308301_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308397_2312876_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313254_2317589_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318227_2318791_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2318802_2319048_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319203_2319713_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2319758_2320739_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2320950_2323302_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323348_2324179_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324175_2324865_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2324857_2326138_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326235_2327174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327155_2328862_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2328939_2330043_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330095_2330845_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2330851_2332366_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332378_2332666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332686_2333574_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2333724_2334231_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334227_2335184_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335371_2336718_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_025341181.1|2336685_2336916_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2336945_2337509_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337663_2338434_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338430_2339441_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2339755_2340202_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340257_2340452_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340453_2340795_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2340804_2342667_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2342706_2343213_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343216_2343540_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343541_2343946_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2343982_2345194_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345215_2345764_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2345988_2346480_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2346694_2348725_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2348799_2350002_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350544_2351480_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352513_2352795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2352881_2353055_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353166_2353511_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353582_2354251_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355666_2356710_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2356706_2356808_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2356899_2358019_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358269_2358923_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
WP_032974133.1|2359038_2360259_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360309_2362739_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2362904_2364203_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364307_2364961_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2364963_2366274_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366501_2367041_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367519_2367786_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2367824_2368190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368071_2369082_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369078_2369849_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2369934_2370594_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370561_2371053_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371162_2371366_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371683_2372004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2371987_2372323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372377_2372590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372665_2373004_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2373000_2373336_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373398_2374970_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2375763_2376075_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376267_2377388_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377515_2377710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005019713.1|2384608_2386072_+	ribonuclease G	NA	NA	NA	NA	NA
2384183:2384701	attR	GAGTTCGAACGGCGCTACTTTTTGATGAACGGGACTGTCTAAGAAACCCGGGGCGATTCAGGAATCCCGGCCGGCTCTTCGCCTAATCCTCACTCCCCGTGTTCGAAATCACTTCCCGCTTCCTGCGCCCCGCTCATGCGGCAATCGCCTCGGAAACCGAAAAACCAATCTCGCTTCGGTCCTCACTACACCGACTGCGTTGCATCTGCGTTGCTGTCTGTGCTGCGAGGGGGCGAACTATAGCATAGAAAAAAATCGTGTGTCACGGCTTTGACACCTTTTTTATAAAAAACCTGTTTTTTCTTCCTCACGACGCCGTACAGGCTGGTCAGCAGGCGCATTTTCCTCCTCCACACCGGGGCTGTTGCCTGCGCCGCAGCGACTTACGCTACCCTAGCGCATCCCTATATATAGACACGGACAACAATGACTGAAAACATTCTGATCAACGTCACGCCTTTTGAAACCCGTGTTGCCATCGTCGCGCAGGGCGCGGTGCAGGAATTGCATGTCGAGCGC	NA	NA	NA	NA
WP_005014698.1|2386204_2387755_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2387751_2387901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2388066_2389187_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2390300_2391158_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2391210_2391708_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2391828_2393244_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2393253_2394438_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2394434_2396033_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2397215_2397461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2397871_2398057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2398212_2399124_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2399245_2400088_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2400290_2401664_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2401973_2403485_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2403637_2404369_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2404475_2405777_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2405784_2406693_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2406689_2407283_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2407326_2407740_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2407736_2408207_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2408213_2408819_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2410620_2412405_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2412401_2413787_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2413772_2414735_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2414804_2415434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2415471_2416680_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2416801_2417371_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2417502_2419056_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2419359_2420580_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2420987_2421890_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2421886_2422756_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2422752_2423604_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2423600_2424425_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2424699_2425920_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043151	Bordetella holmesii strain H359 chromosome, complete genome	3695562	2935380	3012439	3695562	integrase,transposase,tRNA	Ralstonia_virus(21.43%)	56	2938235:2938294	2986821:2987391
WP_005019978.1|2935380_2936160_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2936182_2937130_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2937131_2937332_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2937666_2938786_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2938235:2938294	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2939107_2939824_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2939820_2940714_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2940877_2942098_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2942250_2943333_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2945012_2945996_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2946058_2947471_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2947588_2948431_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2948709_2949318_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2949333_2949954_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2950019_2950727_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2950731_2951454_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2951440_2951731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2951806_2953027_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2953751_2954603_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2954654_2955908_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2956084_2956873_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2956992_2957907_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2958039_2959932_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2960117_2961497_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2961941_2962238_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2966038_2966641_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2966774_2967233_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2967234_2967834_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2967842_2968652_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2968686_2969541_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2969660_2970248_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2970244_2971624_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2972128_2972275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2979945_2981286_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2981299_2982151_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2982162_2983428_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2983489_2985394_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2987369_2988224_-	hypothetical protein	NA	NA	NA	NA	NA
2986821:2987391	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2988216_2989011_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2989226_2990177_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2990779_2991577_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2991616_2992270_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2992250_2993315_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2993478_2995704_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2995949_2997794_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2997910_2998783_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2998829_3000530_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3000592_3001792_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3001802_3002681_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3002787_3003825_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3003905_3004310_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3004321_3005779_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3006421_3007018_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3007178_3007637_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3008414_3009386_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3009507_3009927_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3011218_3012439_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
