The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043148	Bordetella holmesii strain H387 chromosome, complete genome	3696578	1095295	1202084	3696578	protease,transposase,tRNA	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095295_1096516_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096603_1097194_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097190_1097493_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097544_1098534_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098654_1099536_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099709_1100564_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100595_1101444_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101571_1102792_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102810_1103377_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103574_1104726_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104864_1105869_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106025_1106997_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107075_1107864_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107935_1108172_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108180_1109092_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109135_1111007_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111167_1111965_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112196_1112571_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112647_1112971_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113054_1113327_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113341_1113797_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113918_1114755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114751_1116125_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116201_1117158_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117245_1118223_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118347_1120003_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120051_1120516_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120512_1120974_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121199_1122387_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122383_1123688_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123684_1125094_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125287_1126407_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126542_1127562_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127570_1130276_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130415_1131069_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131131_1131494_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132060_1133521_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133783_1134857_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134941_1136162_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137919_1139040_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1139013_1140513_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140526_1141630_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141634_1142885_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142881_1144327_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144323_1144638_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144639_1145758_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145940_1147161_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147260_1148127_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148187_1149168_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149314_1150235_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150243_1151356_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151437_1152259_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152334_1152943_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153080_1154457_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154518_1154962_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155028_1155685_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155727_1156847_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1157016_1157298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1158008_1158797_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158793_1159900_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160574_1161933_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162047_1162245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162262_1163383_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163476_1164031_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164618_1165935_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165947_1166961_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167507_1168458_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168537_1168837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170197_1171856_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1172004_1173225_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173342_1174626_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174629_1175571_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175680_1176139_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176519_1177140_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177547_1179968_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180075_1180813_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180859_1182104_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182426_1182699_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183282_1184011_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184032_1184950_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184949_1185459_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185575_1186247_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186356_1187424_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187443_1189288_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189424_1190612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190912_1191698_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191721_1192841_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192945_1194283_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194392_1195334_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195389_1196571_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196729_1197020_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197066_1197735_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197731_1198019_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198395_1199181_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199213_1199948_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200863_1202084_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043148	Bordetella holmesii strain H387 chromosome, complete genome	3696578	1206871	1263277	3696578	protease,transposase,tRNA	Ralstonia_virus(23.08%)	44	NA	NA
WP_005012808.1|1206871_1207822_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207903_1208383_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209594_1210794_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210939_1211317_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211340_1213122_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213130_1213868_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214152_1215712_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215771_1216530_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216626_1217283_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217436_1218201_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218215_1218395_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218420_1219455_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219451_1219865_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219861_1220446_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220798_1222157_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222250_1222829_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222953_1224074_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224146_1225403_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225506_1226712_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226775_1227225_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227357_1227603_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227827_1228142_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233395_1235501_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235554_1237864_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239217_1240885_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240887_1241553_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241685_1245492_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245717_1246863_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246981_1247911_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247907_1248984_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248980_1249787_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249783_1250515_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250891_1252130_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252177_1252516_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252763_1253714_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254032_1254215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254280_1255501_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255594_1256815_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256874_1257138_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257259_1258759_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012868.1|1259179_1259377_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259392_1259752_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259824_1260847_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260859_1263277_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043148	Bordetella holmesii strain H387 chromosome, complete genome	3696578	1586815	1693071	3696578	transposase,integrase,tRNA	Leptospira_phage(14.29%)	100	1644090:1644106	1689756:1689772
WP_005011985.1|1586815_1588036_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588390_1588867_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589125_1589734_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589752_1590424_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590597_1592484_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592511_1593354_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593350_1594694_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594878_1595694_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595759_1597241_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597439_1599512_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599731_1600769_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601955_1602813_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602840_1603617_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604444_1604954_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1606031_1606802_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1606798_1607809_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1607867_1608948_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1609116_1610236_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1610237_1610981_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1610985_1611357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611417_1611663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1611769_1613269_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1613890_1614226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614484_1614616_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614645_1615143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615152_1615527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615617_1616910_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1617026_1617926_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1618077_1618296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1618769_1620395_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620630_1622154_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622125_1622821_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623161_1624223_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624268_1624820_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1624826_1625747_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1625886_1628184_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628239_1629460_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1629718_1630324_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630334_1631495_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631516_1632398_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632694_1633393_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633534_1634257_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634375_1635314_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635344_1636124_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636110_1637334_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1637338_1638886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1638921_1639455_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639698_1640394_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640408_1640540_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640587_1641712_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1641717_1644057_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1644053_1644461_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1644090:1644106	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1644722_1644983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645205_1646156_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646254_1647205_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1647254_1648463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1648684_1649224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1649448_1649853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1649917_1650673_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1650672_1652034_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1652030_1652654_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1652697_1653817_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654469_1655225_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655401_1656196_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656192_1656630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656741_1656894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657314_1658283_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658439_1659447_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659504_1659963_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1660036_1661383_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661400_1661772_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661771_1663241_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663396_1664122_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664135_1666850_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667101_1668466_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668505_1669564_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669591_1670410_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670447_1670726_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671989_1672289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672858_1674262_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674274_1674925_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675066_1676287_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676317_1677394_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677540_1678671_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678857_1680483_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680489_1681305_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681319_1682390_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682441_1683101_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683740_1684903_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684944_1685259_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685242_1685629_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685667_1685934_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686326_1687016_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687115_1687277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687427_1687592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687718_1687955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688144_1688393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688506_1689877_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689756:1689772	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689877_1690618_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691118_1693071_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043148	Bordetella holmesii strain H387 chromosome, complete genome	3696578	1711365	1755292	3696578	transposase,integrase,tRNA,holin	Leptospira_phage(33.33%)	37	1753860:1753874	1760336:1760350
WP_005019367.1|1711365_1714227_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714216_1715182_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715938_1717414_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717418_1717694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1718030_1719150_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1719024_1719273_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719451_1720660_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720656_1722939_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722949_1725331_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725594_1727502_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727516_1728407_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728413_1729547_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729546_1730368_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730392_1731583_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731884_1732166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732331_1732652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732691_1733778_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733974_1734235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734727_1735498_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735494_1736505_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736539_1737382_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737844_1738630_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739489_1740609_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741675_1742680_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742755_1743568_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743795_1745967_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1746020_1747340_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747428_1748649_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748867_1749728_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749724_1750948_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751246_1751744_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751782_1752565_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752590_1752809_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752883_1753153_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753372_1753837_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753860:1753874	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753910_1754192_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754308_1755292_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760336:1760350	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043148	Bordetella holmesii strain H387 chromosome, complete genome	3696578	1780568	1821959	3696578	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780568_1781519_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781515_1782031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782388_1783009_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783108_1783360_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783447_1784926_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784922_1788093_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788105_1789302_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789490_1790423_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790491_1791223_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791288_1791924_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791909_1793088_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793248_1793797_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793877_1794237_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794284_1795505_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795580_1796702_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796739_1797453_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797463_1798684_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798766_1799321_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799466_1800417_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800376_1800538_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800578_1801505_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801518_1802391_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802553_1803501_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803839_1804421_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804998_1805949_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805928_1806681_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806693_1807425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807581_1809747_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809836_1810106_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810194_1810401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810399_1810918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810936_1811716_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811883_1812900_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812972_1813464_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813474_1815190_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816353_1817304_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818955_1820197_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820208_1820982_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1821008_1821959_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043148	Bordetella holmesii strain H387 chromosome, complete genome	3696578	2150174	2210297	3696578	transposase,tRNA,protease	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150174_2150663_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150655_2151504_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151595_2152093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152230_2152590_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152586_2152868_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152867_2153350_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153351_2154980_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154976_2155321_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155322_2158265_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158710_2159682_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159671_2161054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161196_2162147_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162106_2163348_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163344_2164466_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165957_2166425_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166495_2167146_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167232_2168372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168540_2169545_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169541_2170789_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171141_2172008_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171967_2173572_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173583_2174270_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174266_2175307_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175422_2176094_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2176090_2177083_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177079_2178018_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2178014_2179169_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179177_2180629_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180659_2181142_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181143_2182037_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2182033_2182477_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182489_2182864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2183006_2183405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183531_2183819_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183815_2184232_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184407_2185040_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185068_2185515_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185801_2186953_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187066_2188071_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189054_2189762_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189694_2191146_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191151_2194310_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194322_2194844_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194833_2195658_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195654_2196254_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196362_2198219_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198367_2199372_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199580_2200843_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200847_2201183_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201179_2202109_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202113_2202827_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202930_2204388_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204384_2204681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204805_2206164_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206264_2207065_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207244_2208363_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208435_2208807_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208813_2209665_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209685_2210297_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043148	Bordetella holmesii strain H387 chromosome, complete genome	3696578	2305420	2426933	3696578	protease,transposase,integrase,tRNA	Leptospira_phage(12.5%)	105	2336950:2337009	2358257:2358531
WP_101557807.1|2305420_2306583_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306695_2307664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307660_2308581_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308677_2313156_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_153569247.1|2313534_2317869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014481.1|2318507_2319071_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319082_2319328_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319483_2319993_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320038_2321019_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321230_2323582_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323628_2324459_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324455_2325145_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325137_2326418_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326515_2327454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327435_2329142_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329219_2330323_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330375_2331125_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331131_2332646_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332658_2332946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332966_2333854_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2334004_2334511_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334507_2335464_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335651_2336998_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336950:2337009	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2336965_2337196_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337225_2337789_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337943_2338714_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338710_2339721_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2340035_2340482_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340537_2340732_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340733_2341075_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341084_2342947_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2342986_2343493_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343496_2343820_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343821_2344226_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344262_2345474_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345495_2346044_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346268_2346760_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2346974_2349005_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349079_2350282_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350824_2351760_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352793_2353075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353161_2353335_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353446_2353791_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353862_2354531_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355946_2356990_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2356986_2357088_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357179_2358299_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358549_2359203_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358257:2358531	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359318_2360539_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360589_2363019_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363184_2364483_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364587_2365241_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365243_2366554_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366781_2367321_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367799_2368066_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368104_2368470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368351_2369362_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369358_2370129_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370214_2370874_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370841_2371333_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371442_2371646_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371963_2372284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372267_2372603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372657_2372870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372945_2373284_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_017685558.1|2373271_2373616_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373678_2375250_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376043_2376355_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_005011899.1|2377797_2377992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384074_2385236_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385621_2387085_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387217_2388768_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388764_2388914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389079_2390200_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391313_2392171_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392223_2392721_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392841_2394257_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394266_2395451_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395447_2397046_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398228_2398474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398884_2399070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399225_2400137_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400258_2401101_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401303_2402677_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2402986_2404498_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404650_2405382_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405488_2406790_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406797_2407706_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407702_2408296_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408339_2408753_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408749_2409220_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409226_2409832_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411633_2413418_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413414_2414800_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414785_2415748_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415817_2416447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416484_2417693_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417814_2418384_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418515_2420069_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420372_2421593_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2422000_2422903_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422899_2423769_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423765_2424617_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424613_2425438_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425712_2426933_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043148	Bordetella holmesii strain H387 chromosome, complete genome	3696578	2936393	3013453	3696578	transposase,tRNA,integrase	Ralstonia_virus(21.43%)	56	2939248:2939307	2987835:2988405
WP_005019978.1|2936393_2937173_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937195_2938143_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938144_2938345_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938679_2939799_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939248:2939307	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940120_2940837_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940833_2941727_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941890_2943111_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943263_2944346_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2946025_2947009_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947071_2948484_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948601_2949444_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949722_2950331_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950346_2950967_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951032_2951740_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951744_2952467_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952453_2952744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952819_2954040_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954764_2955616_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955667_2956921_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957097_2957886_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2958005_2958920_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959052_2960945_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961130_2962510_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962954_2963251_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967051_2967654_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967787_2968246_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968247_2968847_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968855_2969665_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969699_2970554_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970673_2971261_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971257_2972637_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973141_2973288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2980959_2982300_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982313_2983165_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983176_2984442_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984503_2986408_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988383_2989238_-	hypothetical protein	NA	NA	NA	NA	NA
2987835:2988405	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989230_2990025_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990240_2991191_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991793_2992591_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992630_2993284_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993264_2994329_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994492_2996718_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996963_2998808_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998924_2999797_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999843_3001544_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001606_3002806_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002816_3003695_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003801_3004839_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004919_3005324_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005335_3006793_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007435_3008032_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008192_3008651_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009428_3010400_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010521_3010941_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012232_3013453_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
