The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043146	Bordetella holmesii strain H401 chromosome, complete genome	3696575	631730	692528	3696575	tRNA,transposase	Ralstonia_virus(36.36%)	50	NA	NA
WP_005012861.1|631730_632951_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005018655.1|635960_636695_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.6e-40
WP_005011985.1|636863_638084_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005020417.1|638458_639445_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005020418.1|639448_642172_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	6.6e-20
WP_005018662.1|642172_643300_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005018665.1|643312_644725_+	TolC family protein	NA	NA	NA	NA	NA
WP_005018670.1|644899_645556_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005018673.1|645576_646623_+	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	39.5	1.4e-58
WP_005018676.1|646619_648209_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_005018678.1|648144_648654_-	GtrA family protein	NA	NA	NA	NA	NA
WP_017685335.1|648579_649473_+	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_005018681.1|649462_650359_-	alpha/beta fold hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	33.1	6.5e-09
WP_005020419.1|650405_651038_-	LysE family translocator	NA	NA	NA	NA	NA
WP_005018686.1|651062_651947_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005018689.1|652074_653556_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005018691.1|653628_653973_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_005018693.1|654058_654523_+	universal stress protein	NA	NA	NA	NA	NA
WP_005018697.1|655686_657801_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.1	6.0e-61
WP_005018699.1|657833_658631_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005013747.1|658842_659793_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005018702.1|659825_660272_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_005018704.1|660320_661010_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_005018707.1|661097_661592_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_005018709.1|661623_662940_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_005018710.1|662956_663877_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_005018713.1|663911_664373_-	protein TolR	NA	NA	NA	NA	NA
WP_005018715.1|664372_665047_-	protein TolQ	NA	NA	NA	NA	NA
WP_005018717.1|665049_665472_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005018720.1|665525_667256_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	28.6	1.2e-11
WP_005018723.1|667321_667891_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005018726.1|667871_668558_+	response regulator	NA	NA	NA	NA	NA
WP_005018729.1|668577_670083_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005018732.1|670311_670761_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_005018735.1|670766_672287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|672340_673561_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005018738.1|673657_674587_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005018740.1|674745_675651_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005011985.1|675850_677071_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005018744.1|677126_678632_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_005018747.1|678653_679109_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_005018750.1|679465_680038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005018752.1|680037_680349_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_005018754.1|680662_681424_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_005018757.1|681392_682187_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_005018762.1|682365_682701_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_005018764.1|682717_683275_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_005018766.1|683336_684449_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_005018783.1|684589_685066_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_101557886.1|691407_692528_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
>prophage 2
NZ_CP043146	Bordetella holmesii strain H401 chromosome, complete genome	3696575	765552	820443	3696575	tRNA,protease,transposase	Klosneuvirus(25.0%)	48	NA	NA
WP_101557770.1|765552_766672_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879506.1|766609_767368_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_005015920.1|767364_768951_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005015916.1|768943_770068_+	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_005015914.1|770045_770495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015912.1|770487_771363_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_005015908.1|771459_771714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015906.1|771706_772807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015904.1|772830_773415_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_005015902.1|773411_774437_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_005020050.1|774520_777142_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.5	2.8e-84
WP_005015899.1|777128_777380_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_005015897.1|777879_778140_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_005015895.1|778431_779025_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_005015892.1|779024_779888_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_005015889.1|779936_781157_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
WP_005015887.1|781210_784090_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	1.1e-137
WP_005015883.1|784409_784835_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.9	2.4e-22
WP_005015881.1|784864_786013_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_005015878.1|786009_786498_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005015875.1|786510_787797_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_032826677.1|787829_789125_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005015870.1|789128_789767_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005015868.1|789772_790930_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_005015867.1|790954_792310_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_005015866.1|792306_793380_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_003810707.1|793563_793800_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_005015862.1|793887_794994_+	GTPase HflX	NA	NA	NA	NA	NA
WP_005020041.1|794959_796264_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_005020040.1|796281_797169_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_005016668.1|797230_798451_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
WP_005015849.1|799742_800162_-	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005015847.1|800283_801255_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015844.1|802032_802491_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015841.1|802651_803248_+	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015836.1|803890_805348_-	magnesium transporter	NA	NA	NA	NA	NA
WP_025341225.1|805359_805764_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015832.1|805844_806882_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_005015829.1|806988_807867_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015826.1|807877_809077_-	amidohydrolase	NA	NA	NA	NA	NA
WP_005015825.1|809139_810840_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015820.1|810886_811759_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015818.1|811875_813720_+|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015817.1|813965_816191_+	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015815.1|816354_817419_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015813.1|817399_818053_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005020039.1|818092_818890_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015810.1|819492_820443_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP043146	Bordetella holmesii strain H401 chromosome, complete genome	3696575	1370704	1479550	3696575	tRNA,integrase,protease,transposase	Leptospira_phage(15.62%)	99	1452366:1452425	1473673:1473948
WP_005014796.1|1370704_1372162_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	30.0	7.5e-39
WP_005014794.1|1372172_1372817_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_005014792.1|1372850_1373816_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_005014790.1|1373833_1374883_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_005019734.1|1374967_1376227_+	aspartate kinase	NA	NA	NA	NA	NA
WP_005014784.1|1376478_1376949_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_005014781.1|1377050_1378457_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	28.2	1.5e-20
WP_005014780.1|1378472_1380566_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	55.8	2.4e-107
WP_005014779.1|1380565_1381228_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014777.1|1381244_1383605_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
WP_005011985.1|1383750_1384971_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014769.1|1385245_1386070_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014767.1|1386066_1386918_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014766.1|1386914_1387784_-	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014765.1|1387780_1388683_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005011985.1|1389090_1390311_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014763.1|1390614_1392168_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014760.1|1392299_1392869_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014759.1|1392990_1394199_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014755.1|1394236_1394866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014754.1|1394935_1395898_+	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014753.1|1395883_1397269_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014750.1|1397265_1399050_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014748.1|1400851_1401457_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014747.1|1401463_1401934_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014744.1|1401930_1402344_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014741.1|1402387_1402981_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014740.1|1402977_1403886_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014730.1|1403893_1405195_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014728.1|1405301_1406033_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014726.1|1406185_1407697_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014723.1|1408006_1409380_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014721.1|1409582_1410425_+	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014720.1|1410546_1411458_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005014716.1|1411613_1411799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014714.1|1412209_1412455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014709.1|1413637_1415236_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014706.1|1415232_1416417_-	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014705.1|1416426_1417842_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014704.1|1417962_1418460_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014703.1|1418512_1419370_-	DMT family transporter	NA	NA	NA	NA	NA
WP_101557770.1|1420483_1421603_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_017685964.1|1421769_1421919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014698.1|1421915_1423466_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_005019713.1|1423598_1425062_-	ribonuclease G	NA	NA	NA	NA	NA
WP_101557807.1|1425446_1426609_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005011899.1|1432691_1432886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1433013_1434133_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014621.1|1434326_1434638_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_005014618.1|1435431_1437003_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014613.1|1437065_1437401_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014610.1|1437397_1437736_-	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014607.1|1437811_1438024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|1438078_1438414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014600.1|1438397_1438718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014599.1|1439035_1439239_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014598.1|1439348_1439840_+	DUF924 family protein	NA	NA	NA	NA	NA
WP_050427733.1|1439807_1440467_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005013542.1|1440552_1441323_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341473.1|1441319_1442330_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_135238891.1|1442211_1442577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557809.1|1442615_1442882_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005014595.1|1443360_1443900_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_005014590.1|1444127_1445438_+	trigger factor	NA	NA	NA	NA	NA
WP_005014589.1|1445440_1446094_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014587.1|1446198_1447497_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014581.1|1447662_1450092_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_032974133.1|1450142_1451363_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014574.1|1451478_1452132_-	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
1452366:1452425	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_101557770.1|1452381_1453502_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879527.1|1453593_1453695_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005014572.1|1453691_1454735_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_005014566.1|1456150_1456819_-	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014564.1|1456890_1457235_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014560.1|1457346_1457520_-	OsmC family protein	NA	NA	NA	NA	NA
WP_005014556.1|1457606_1457888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032826331.1|1458921_1459857_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014553.1|1460399_1461602_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_017685984.1|1461676_1463707_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014551.1|1463921_1464413_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_005014547.1|1464637_1465186_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014546.1|1465207_1466419_+	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014545.1|1466455_1466860_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014544.1|1466861_1467185_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014543.1|1467188_1467695_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014539.1|1467734_1469597_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014536.1|1469606_1469948_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014534.1|1469949_1470144_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_076879495.1|1470199_1470646_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_025341421.1|1470960_1471971_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_032968029.1|1471967_1472738_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_101558036.1|1472892_1473456_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_025341181.1|1473485_1473716_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_005019683.1|1473683_1475030_-	TonB-dependent receptor	NA	NA	NA	NA	NA
1473673:1473948	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCATCGCCCCGATAGGTATTGGGCGGCCCCAGTCGGCCGCTACGCAGCAAATACTTGATGTCGTTCGTTTCATCCACGCGCACCACAGCCGCCTTGAATTTCCATCCATTGGAAAATCGGTGGGTGAGGTCGGCGAACCAAGTGTTCTGGGTTTTATACGCGTGATTCCATTTGGCGCTCAGATTGGTCGAGCGTGAATACTCCGGCATCGACCCGTCT	NA	NA	NA	NA
WP_005014518.1|1475217_1476174_-	FecR family protein	NA	NA	NA	NA	NA
WP_005014516.1|1476170_1476677_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014514.1|1476827_1477715_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005019680.1|1477735_1478023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014511.1|1478035_1479550_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
>prophage 4
NZ_CP043146	Bordetella holmesii strain H401 chromosome, complete genome	3696575	1600390	1649491	3696575	tRNA,protease,transposase	Ralstonia_virus(25.0%)	48	NA	NA
WP_005014292.1|1600390_1601002_+|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
WP_005014290.1|1601022_1601874_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014289.1|1601880_1602252_-	lipoprotein	NA	NA	NA	NA	NA
WP_005014286.1|1602324_1603443_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014285.1|1603622_1604423_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014283.1|1604523_1605882_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014281.1|1606006_1606303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014278.1|1606299_1607757_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014277.1|1607860_1608574_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014275.1|1608578_1609508_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005014274.1|1609504_1609840_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014271.1|1609844_1611107_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005012353.1|1611315_1612320_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014269.1|1612468_1614325_+	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005014267.1|1614433_1615033_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014265.1|1615029_1615854_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014263.1|1615843_1616365_+	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014260.1|1616377_1619536_-	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_032954285.1|1619541_1620993_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014256.1|1620925_1621633_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_005012353.1|1622616_1623621_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014253.1|1623734_1624886_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005014250.1|1625172_1625619_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014248.1|1625647_1626280_-	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014247.1|1626455_1626872_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_076879494.1|1626868_1627156_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014242.1|1627282_1627681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014241.1|1627823_1628198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014239.1|1628210_1628654_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014237.1|1628650_1629544_-	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014235.1|1629545_1630028_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014231.1|1630058_1631510_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014229.1|1631518_1632673_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014228.1|1632669_1633608_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005019577.1|1633604_1634597_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014226.1|1634593_1635265_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014223.1|1635380_1636421_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014221.1|1636417_1637104_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014215.1|1637115_1638720_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014213.1|1638679_1639546_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014212.1|1639898_1641146_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005012353.1|1641142_1642147_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014211.1|1642315_1643455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014210.1|1643541_1644192_-	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014203.1|1644262_1644730_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014202.1|1646221_1647343_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014200.1|1647339_1648581_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_005012067.1|1648540_1649491_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP043146	Bordetella holmesii strain H401 chromosome, complete genome	3696575	1967389	2077994	3696575	integrase,holin,transposase	Ralstonia_virus(25.0%)	99	2015177:2015236	2068955:2069293
WP_005013764.1|1967389_1968340_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013763.1|1968330_1969515_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005013762.1|1969594_1970512_-	FecR family protein	NA	NA	NA	NA	NA
WP_005013761.1|1970513_1971008_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005013759.1|1971150_1972131_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.2	5.6e-14
WP_076879523.1|1972114_1972855_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_025341443.1|1974095_1974302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013757.1|1974309_1974939_-	MarC family protein	NA	NA	NA	NA	NA
WP_005013756.1|1975233_1977438_-	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_005013755.1|1977548_1978772_-	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_005013754.1|1978894_1979869_-	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_005013753.1|1979936_1981130_-	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_005013752.1|1981144_1981945_-	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_005013751.1|1981941_1983798_-	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_005013750.1|1983794_1984400_-	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_003814013.1|1984418_1985804_-	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_003814011.1|1987845_1988628_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_005013747.1|1988726_1989677_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814010.1|1989703_1990477_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_003814009.1|1990488_1991730_+	MFS transporter	NA	NA	NA	NA	NA
WP_005012808.1|1993381_1994332_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814007.1|1995495_1997211_+	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005013744.1|1997221_1997713_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_005013742.1|1997785_1998802_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003814004.1|1998969_1999749_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013740.1|1999767_2000286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005019401.1|2000284_2000491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013738.1|2000579_2000849_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005013736.1|2000938_2003104_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005019399.1|2003260_2003992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013735.1|2004004_2004757_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005012808.1|2004736_2005687_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_026087954.1|2006264_2006846_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005013732.1|2007184_2008132_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013731.1|2008294_2009167_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013730.1|2009180_2010107_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013729.1|2010147_2010309_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013727.1|2010268_2011219_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013726.1|2011364_2011919_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013725.1|2012001_2013222_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013724.1|2013232_2013946_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013723.1|2013983_2015105_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
2015177:2015236	attL	TGGTTCATCGAGGAATACCGGGGAATGCAGACCGGATCTTGAGGAAGAAGTACTCCTGAT	NA	NA	NA	NA
WP_005011985.1|2015180_2016401_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013722.1|2016448_2016808_-	LysE family transporter	NA	NA	NA	NA	NA
WP_005013721.1|2016888_2017437_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013720.1|2017597_2018776_+	MFS transporter	NA	NA	NA	NA	NA
WP_005013719.1|2018761_2019397_-	chorismate lyase	NA	NA	NA	NA	NA
WP_005013718.1|2019462_2020194_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013717.1|2020262_2021195_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013715.1|2021383_2022580_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013714.1|2022592_2025763_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013712.1|2025759_2027238_+	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013711.1|2027325_2027577_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013710.1|2027676_2028297_-	SCO family protein	NA	NA	NA	NA	NA
WP_005013708.1|2028654_2029170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2029166_2030117_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013707.1|2030226_2032281_-	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013706.1|2032400_2033255_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.4e-29
WP_005019390.1|2033251_2033878_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013704.1|2033874_2035629_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_005013703.1|2036174_2038886_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_005013702.1|2038898_2040563_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_005013701.1|2040578_2042354_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
WP_153566129.1|2042475_2042649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013700.1|2042767_2042980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013699.1|2043152_2044133_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013698.1|2044149_2044944_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_157933265.1|2044977_2045445_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013696.1|2046061_2046715_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005013695.1|2046796_2047732_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013694.1|2047993_2048140_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_005013693.1|2048230_2048632_+	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_005013692.1|2048707_2049592_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019382.1|2049684_2050389_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013691.1|2050427_2052509_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013690.1|2052641_2053553_-	phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
WP_005013689.1|2053617_2054049_-	TonB family protein	NA	NA	NA	NA	NA
WP_005013688.1|2054151_2055150_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_005013686.1|2055393_2056377_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005013685.1|2056493_2056775_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013684.1|2056848_2057313_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005019379.1|2057532_2057802_-	YunC family protein	NA	NA	NA	NA	NA
WP_005013682.1|2057876_2058095_+	SlyX family protein	NA	NA	NA	NA	NA
WP_005013681.1|2058120_2058903_+	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013680.1|2058941_2059439_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013679.1|2059737_2060961_+	MFS transporter	NA	NA	NA	NA	NA
WP_005013678.1|2060957_2061818_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2062036_2063257_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013677.1|2063345_2064665_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005013676.1|2064718_2066890_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013675.1|2067117_2067930_-	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005012353.1|2068005_2069010_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_101557815.1|2070075_2071196_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
2068955:2069293	attR	ATCAGGAGTACTTCTTCCTCAAGATCCGGTCTGCATTCCCCGGTATTCCTCGATGAACCATAAATCAGGGTGTGCATGCCCTCGGCCTCGAAAGCCAGGGCCGAATCCACATACTCCGACGTGGTGCCTGCCACCCGCGCGATCTCGACTCCGTCGCGGCTGATGACGACGTCGCCCTGCGGCTCGCCGACGCGCACCCAACGCAGAGTCACGCTTTTGTTATCCGTGGCCGTGCGCGTCACCAGTCTGCGCACCGCCACGGGTTCTGCCAGCGACGTGCCCGCCATGTCGTACGCGCGCGGCTCGGGCAATGCGCCCATGTGGCTCAACACGGTCGGC	NA	NA	NA	NA
WP_005013673.1|2072055_2072841_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_005013672.1|2073303_2074146_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_025341421.1|2074180_2075191_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2075187_2075958_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_005013671.1|2076450_2076711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|2076906_2077994_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
>prophage 6
NZ_CP043146	Bordetella holmesii strain H401 chromosome, complete genome	3696575	2091412	2135619	3696575	tRNA,integrase,transposase	Ralstonia_virus(20.0%)	47	2101375:2101434	2139833:2140403
WP_161992024.1|2091412_2091661_-|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_101557770.1|2091534_2092655_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013659.1|2092991_2093267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005019369.1|2093271_2094747_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013657.1|2095503_2096469_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019367.1|2096458_2099320_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013655.1|2099322_2099838_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_005013654.1|2099898_2101110_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.4	2.2e-36
2101375:2101434	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_005019364.1|2102289_2103030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013652.1|2103122_2103593_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013651.1|2103611_2104316_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_005013650.1|2104328_2104871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013649.1|2104892_2105360_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005013648.1|2105469_2106102_+	DedA family protein	NA	NA	NA	NA	NA
WP_005013647.1|2106122_2106581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013645.1|2106622_2107072_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
WP_005013644.1|2107944_2108616_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
WP_005013643.1|2108612_2109254_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
WP_005013642.1|2109264_2110152_-	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
WP_005013641.1|2110320_2111484_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013640.1|2111552_2112530_-	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_005013639.1|2112649_2113072_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005013638.1|2113118_2113328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013637.1|2113375_2115151_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_005013636.1|2115179_2115449_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_005013635.1|2115511_2115910_-	PTS IIa component	NA	NA	NA	NA	NA
WP_005013634.1|2115923_2116880_-	glutathione synthase	NA	NA	NA	NA	NA
WP_076879490.1|2117045_2117594_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
WP_005013632.1|2117614_2119567_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
WP_005013631.1|2120067_2120808_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013629.1|2120808_2122179_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_005013628.1|2122292_2122541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|2122730_2122967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|2123093_2123258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013626.1|2123408_2123570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013625.1|2123669_2124359_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_101557809.1|2124751_2125018_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080687433.1|2125056_2125443_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157933264.1|2125426_2125741_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_101557807.1|2125782_2126944_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005013621.1|2127584_2128244_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_110097765.1|2128295_2129366_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005019353.1|2129380_2130196_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_005019351.1|2130202_2131828_-	membrane protein	NA	NA	NA	NA	NA
WP_005013618.1|2132014_2133145_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005013617.1|2133291_2134368_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005011985.1|2134398_2135619_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
2139833:2140403	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCACCATGGTTACGCCGGCCCAACAGAGCTCGGCCAGGCGCTCGGCGTGGTGGCCCAAGGCGGCATGTGGATGGGTCGATCTCTGGTAGGCCGCCTGTTACGCACGGCCCGAAATCGCGCCGGCACACCCGCGGATTGGGGCCACGCTCTGTTGACCGCACGGGAAGACACCGTCGCGCGCCACGCCTCTGCCGGTCAATCCAACGCGCAGATCGCCGAACAGCTCGGCATTACCGAACGCACCGTCAAAGCGCATCTGTCCGCGGTCTTTGAGAAAGTCGGCGTGGCAGATCGCCTGCAGTTAGCGCTATTGGTCCATGGCGTCACACCCGCCAAAACCGGCCATTGACTCAACGGCACCGCACCTCAATCGCCTGCCGGATCCATCAACGGCGGGCCTGCTCGTACAAGGGCAAAACCCGCTCTGACGCCTGCTTCAGATCCGCGATGCGTGTGCTGGCCGAGGGATGCGTGGAGAGAAACTCCGGCGAGGCCTGTCCAGTCTGGGCCGCTG	NA	NA	NA	NA
>prophage 7
NZ_CP043146	Bordetella holmesii strain H401 chromosome, complete genome	3696575	2151238	2202818	3696575	tRNA,transposase	Leptospira_phage(21.43%)	52	NA	NA
WP_025341429.1|2151238_2152246_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005013598.1|2152402_2153371_+	homoserine kinase	NA	NA	NA	NA	NA
WP_153566127.1|2153791_2153944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013597.1|2154055_2154493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013596.1|2154489_2155284_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013595.1|2155460_2156216_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_101557770.1|2156867_2157988_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013592.1|2158031_2158655_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_005013591.1|2158651_2160013_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013590.1|2160012_2160768_-	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013589.1|2160832_2161237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|2161461_2162001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013587.1|2162222_2163431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2163480_2164431_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2164529_2165480_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013586.1|2165702_2165963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013585.1|2166224_2166632_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_005013584.1|2166628_2168968_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013583.1|2168973_2170098_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013582.1|2170145_2170277_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013581.1|2170291_2170987_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013580.1|2171230_2171764_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013579.1|2171799_2173347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013578.1|2173351_2174575_-	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013577.1|2174561_2175341_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005019317.1|2175371_2176310_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013573.1|2176428_2177151_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005013572.1|2177292_2177991_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013571.1|2178287_2179169_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013570.1|2179190_2180351_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013569.1|2180361_2180967_-	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2181225_2182446_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013568.1|2182501_2184799_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005013567.1|2184938_2185859_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013566.1|2185865_2186417_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013565.1|2186462_2187524_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013564.1|2187864_2188560_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013563.1|2188531_2190055_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_017685641.1|2190290_2191916_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013561.1|2192389_2192608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013559.1|2192759_2193659_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013558.1|2193775_2195068_-	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013556.1|2195158_2195533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013555.1|2195542_2196040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|2196069_2196201_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013552.1|2196459_2196795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|2197416_2198916_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013550.1|2199022_2199268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013549.1|2199328_2199700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080601033.1|2199704_2200448_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_101557831.1|2200448_2201569_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_101557920.1|2201736_2202818_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
>prophage 8
NZ_CP043146	Bordetella holmesii strain H401 chromosome, complete genome	3696575	2508104	2557922	3696575	tRNA,transposase	Ralstonia_virus(25.0%)	54	NA	NA
WP_005011985.1|2508104_2509325_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005019139.1|2509938_2510772_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_005012970.1|2510779_2512027_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_005012967.1|2512149_2512587_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012964.1|2512608_2513835_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_005019132.1|2513973_2514435_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	43.4	2.0e-17
WP_005011985.1|2515169_2516390_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012942.1|2517017_2517446_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_005012941.1|2517474_2517921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012939.1|2518053_2519970_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_005012937.1|2520141_2522664_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_005012934.1|2522658_2523312_-	serine/threonine protein phosphatase 1	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	47.7	6.3e-54
WP_005012933.1|2523489_2524665_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_005012931.1|2524661_2524868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012930.1|2524914_2525901_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_005012927.1|2525905_2526361_-	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	48.3	2.1e-35
WP_101557744.1|2526384_2527505_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_080687431.1|2527528_2527984_-	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.9e-20
WP_005012922.1|2528052_2529852_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.4	8.7e-45
WP_005012921.1|2529905_2530271_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_005012919.1|2530277_2530493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012916.1|2530583_2531666_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_005012915.1|2531793_2532006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012914.1|2532153_2532396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012913.1|2532490_2532694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012912.1|2532845_2533028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012910.1|2533084_2533369_-	CsbD family protein	NA	NA	NA	NA	NA
WP_005012903.1|2533416_2534010_-	lipoprotein	NA	NA	NA	NA	NA
WP_005012901.1|2534301_2534772_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012900.1|2534768_2535221_-	low affinity iron permease family protein	NA	G1JW61	Mycobacterium_phage	36.3	8.9e-07
WP_005012896.1|2535314_2535593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012894.1|2535722_2535971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012893.1|2536099_2538061_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	29.9	2.3e-27
WP_005012891.1|2538095_2538842_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	31.2	7.3e-22
WP_005012888.1|2539237_2539447_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	57.1	8.6e-13
WP_005012887.1|2541327_2542332_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012885.1|2542362_2543352_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012883.1|2543379_2544123_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012882.1|2544409_2544664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685460.1|2545045_2545774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685459.1|2545804_2546371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012873.1|2546593_2546992_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012872.1|2547049_2547391_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	43.3	1.3e-13
WP_005012871.1|2547408_2549826_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005012870.1|2549838_2550861_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012869.1|2550933_2551293_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012868.1|2551308_2551506_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_131285595.1|2551603_2551879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012866.1|2551926_2553426_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012863.1|2553547_2553811_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012861.1|2553870_2555091_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005011985.1|2555184_2556405_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012855.1|2556470_2556653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2556971_2557922_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP043146	Bordetella holmesii strain H401 chromosome, complete genome	3696575	2572821	2618964	3696575	protease,transposase	uncultured_Mediterranean_phage(15.38%)	39	NA	NA
WP_005012839.1|2572821_2575131_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012838.1|2575184_2577290_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012835.1|2582543_2582858_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012834.1|2583082_2583328_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012833.1|2583460_2583910_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005019101.1|2583973_2585179_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_080601032.1|2585282_2586539_-	chloride channel protein	NA	NA	NA	NA	NA
WP_101557770.1|2586611_2587731_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012829.1|2587856_2588435_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_005012828.1|2588528_2589887_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012827.1|2590239_2590824_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012826.1|2590820_2591234_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012823.1|2591230_2592265_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012822.1|2592290_2592470_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012820.1|2592484_2593249_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005019095.1|2593402_2594059_+	adenylate kinase	NA	NA	NA	NA	NA
WP_005012817.1|2594155_2594914_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005012815.1|2594973_2596533_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012814.1|2596817_2597555_+	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012813.1|2597563_2599345_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012812.1|2599368_2599746_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012811.1|2599891_2601091_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012810.1|2602302_2602782_+	sensor protein	NA	NA	NA	NA	NA
WP_005012808.1|2602863_2603814_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012807.1|2603867_2604014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012806.1|2604215_2604479_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_005012805.1|2604604_2605375_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_005012804.1|2605417_2606413_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012803.1|2608244_2608526_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_005011985.1|2608601_2609822_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012801.1|2610737_2611472_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019092.1|2611504_2612290_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012798.1|2612666_2612954_+	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005012797.1|2612950_2613619_+	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012796.1|2613665_2613956_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012795.1|2614114_2615296_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012790.1|2615351_2616293_+	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012789.1|2616402_2617740_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_101557770.1|2617843_2618964_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
>prophage 10
NZ_CP043146	Bordetella holmesii strain H401 chromosome, complete genome	3696575	2642227	2685398	3696575	tRNA,protease,transposase	Leptospira_phage(30.77%)	36	NA	NA
WP_005012067.1|2642227_2643178_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005019086.1|2643724_2644738_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012730.1|2644750_2646067_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_076879487.1|2646654_2647209_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_101557770.1|2647302_2648422_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012717.1|2648440_2648638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012715.1|2648752_2650111_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012713.1|2650785_2651892_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012711.1|2651888_2652677_-	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012709.1|2653387_2653669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2653837_2654958_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080688213.1|2655000_2655657_+	cytochrome B	NA	NA	NA	NA	NA
WP_005012704.1|2655723_2656167_-	cytochrome c	NA	NA	NA	NA	NA
WP_005012700.1|2656228_2657605_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005019071.1|2657742_2658351_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012695.1|2658426_2659248_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005012692.1|2659329_2660442_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012689.1|2660450_2661371_-	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012688.1|2661517_2662498_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012685.1|2662558_2663425_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012682.1|2663524_2664745_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005019066.1|2664927_2666046_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012678.1|2666047_2666362_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019055.1|2666358_2667804_+	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012675.1|2667800_2669051_-	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005012673.1|2669055_2670159_-	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005019053.1|2670172_2671672_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_101557770.1|2671645_2672765_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012670.1|2674523_2675744_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_005012669.1|2675828_2676902_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012668.1|2677164_2678625_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005019040.1|2679191_2679554_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012664.1|2679616_2680270_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005012663.1|2680409_2683115_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012662.1|2683123_2684143_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_101557744.1|2684277_2685398_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
