The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043143	Bordetella holmesii strain H557 chromosome, complete genome	3696591	1095303	1202092	3696591	tRNA,transposase,protease	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095303_1096524_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096611_1097202_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097198_1097501_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097552_1098542_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098662_1099544_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099717_1100572_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100603_1101452_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101579_1102800_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102818_1103385_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103582_1104734_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104872_1105877_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106033_1107005_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107083_1107872_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107943_1108180_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108188_1109100_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109143_1111015_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111175_1111973_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112204_1112579_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112655_1112979_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113062_1113335_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113349_1113805_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113926_1114763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114759_1116133_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116209_1117166_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117253_1118231_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118355_1120011_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120059_1120524_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120520_1120982_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121207_1122395_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122391_1123696_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123692_1125102_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125295_1126415_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126550_1127570_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127578_1130284_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130423_1131077_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131139_1131502_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132068_1133529_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133791_1134865_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134949_1136170_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137927_1139048_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1139021_1140521_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140534_1141638_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141642_1142893_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142889_1144335_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144331_1144646_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144647_1145766_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145948_1147169_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147268_1148135_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148195_1149176_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149322_1150243_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150251_1151364_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151445_1152267_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152342_1152951_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153088_1154465_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154526_1154970_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155036_1155693_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155735_1156855_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1157024_1157306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1158016_1158805_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158801_1159908_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160582_1161941_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162055_1162253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162270_1163391_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163484_1164039_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164626_1165943_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165955_1166969_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167515_1168466_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168545_1168845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170205_1171864_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1172012_1173233_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173350_1174634_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174637_1175579_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175688_1176147_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176527_1177148_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177555_1179976_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180083_1180821_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180867_1182112_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182434_1182707_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183290_1184019_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184040_1184958_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184957_1185467_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185583_1186255_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186364_1187432_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187451_1189296_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189432_1190620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190920_1191706_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191729_1192849_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192953_1194291_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194400_1195342_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195397_1196579_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196737_1197028_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197074_1197743_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197739_1198027_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198403_1199189_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199221_1199956_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200871_1202092_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043143	Bordetella holmesii strain H557 chromosome, complete genome	3696591	1206879	1263285	3696591	tRNA,transposase,protease	Ralstonia_virus(23.08%)	44	NA	NA
WP_005012808.1|1206879_1207830_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207911_1208391_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209602_1210802_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210947_1211325_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211348_1213130_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213138_1213876_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214160_1215720_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215779_1216538_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216634_1217291_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217444_1218209_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218223_1218403_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218428_1219463_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219459_1219873_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219869_1220454_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220806_1222165_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222258_1222837_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222961_1224082_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224154_1225411_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225514_1226720_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226783_1227233_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227365_1227611_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227835_1228150_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233403_1235509_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235562_1237872_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239225_1240893_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240895_1241561_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241693_1245500_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245725_1246871_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246989_1247919_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247915_1248992_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248988_1249795_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249791_1250523_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250899_1252138_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252185_1252524_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252771_1253722_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254040_1254223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254288_1255509_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255602_1256823_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256882_1257146_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257267_1258767_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012868.1|1259187_1259385_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259400_1259760_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259832_1260855_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260867_1263285_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043143	Bordetella holmesii strain H557 chromosome, complete genome	3696591	1586823	1693084	3696591	transposase,tRNA,integrase	Leptospira_phage(14.29%)	100	1644098:1644114	1689764:1689780
WP_005011985.1|1586823_1588044_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588398_1588875_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589133_1589742_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589760_1590432_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590605_1592492_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592519_1593362_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593358_1594702_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594886_1595702_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595767_1597249_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597447_1599520_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599739_1600777_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601963_1602821_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602848_1603625_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604452_1604962_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1606039_1606810_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1606806_1607817_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1607875_1608956_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1609124_1610244_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1610245_1610989_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1610993_1611365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611425_1611671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1611777_1613277_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1613898_1614234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614492_1614624_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614653_1615151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615160_1615535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615625_1616918_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1617034_1617934_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1618085_1618304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1618777_1620403_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620638_1622162_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622133_1622829_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623169_1624231_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624276_1624828_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1624834_1625755_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1625894_1628192_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628247_1629468_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1629726_1630332_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630342_1631503_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631524_1632406_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632702_1633401_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633542_1634265_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634383_1635322_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635352_1636132_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636118_1637342_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1637346_1638894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1638929_1639463_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639706_1640402_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640416_1640548_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640595_1641720_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1641725_1644065_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1644061_1644469_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1644098:1644114	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1644730_1644991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645213_1646164_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646262_1647213_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1647262_1648471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1648692_1649232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1649456_1649861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1649925_1650681_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1650680_1652042_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1652038_1652662_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1652705_1653825_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654477_1655233_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655409_1656204_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656200_1656638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656749_1656902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657322_1658291_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658447_1659455_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659512_1659971_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1660044_1661391_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661408_1661780_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661779_1663249_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663404_1664130_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664143_1666858_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667109_1668474_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668513_1669572_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669599_1670418_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670455_1670734_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671997_1672297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672866_1674270_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674282_1674933_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675074_1676295_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676325_1677402_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677548_1678679_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678865_1680491_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680497_1681313_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681327_1682398_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682449_1683109_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683748_1684911_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684952_1685267_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685250_1685637_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685675_1685942_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686334_1687024_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687123_1687285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687435_1687600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687726_1687963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688152_1688401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688514_1689885_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689764:1689780	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689885_1690626_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691131_1693084_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043143	Bordetella holmesii strain H557 chromosome, complete genome	3696591	1711378	1755305	3696591	holin,transposase,tRNA,integrase	Leptospira_phage(33.33%)	37	1753873:1753887	1760349:1760363
WP_005019367.1|1711378_1714240_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714229_1715195_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715951_1717427_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717431_1717707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1718043_1719163_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1719037_1719286_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719464_1720673_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720669_1722952_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722962_1725344_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725607_1727515_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727529_1728420_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728426_1729560_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729559_1730381_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730405_1731596_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731897_1732179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732344_1732665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732704_1733791_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733987_1734248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734740_1735511_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735507_1736518_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736552_1737395_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737857_1738643_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739502_1740622_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741688_1742693_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742768_1743581_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743808_1745980_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1746033_1747353_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747441_1748662_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748880_1749741_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749737_1750961_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751259_1751757_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751795_1752578_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752603_1752822_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752896_1753166_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753385_1753850_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753873:1753887	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753923_1754205_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754321_1755305_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760349:1760363	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043143	Bordetella holmesii strain H557 chromosome, complete genome	3696591	1780581	1821972	3696591	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780581_1781532_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781528_1782044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782401_1783022_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783121_1783373_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783460_1784939_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784935_1788106_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788118_1789315_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789503_1790436_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790504_1791236_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791301_1791937_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791922_1793101_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793261_1793810_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793890_1794250_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794297_1795518_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795593_1796715_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796752_1797466_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797476_1798697_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798779_1799334_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799479_1800430_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800389_1800551_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800591_1801518_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801531_1802404_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802566_1803514_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803852_1804434_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1805011_1805962_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805941_1806694_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806706_1807438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807594_1809760_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809849_1810119_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810207_1810414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810412_1810931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810949_1811729_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811896_1812913_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812985_1813477_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813487_1815203_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816366_1817317_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818968_1820210_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820221_1820995_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1821021_1821972_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043143	Bordetella holmesii strain H557 chromosome, complete genome	3696591	2150185	2210308	3696591	protease,transposase,tRNA	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150185_2150674_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150666_2151515_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151606_2152104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152241_2152601_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152597_2152879_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152878_2153361_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153362_2154991_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154987_2155332_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155333_2158276_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158721_2159693_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159682_2161065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161207_2162158_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162117_2163359_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163355_2164477_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165968_2166436_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166506_2167157_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167243_2168383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168551_2169556_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169552_2170800_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171152_2172019_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171978_2173583_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173594_2174281_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174277_2175318_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175433_2176105_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019577.1|2176101_2177094_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177090_2178029_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2178025_2179180_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179188_2180640_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180670_2181153_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181154_2182048_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2182044_2182488_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182500_2182875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2183017_2183416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183542_2183830_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183826_2184243_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184418_2185051_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185079_2185526_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185812_2186964_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187077_2188082_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189065_2189773_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189705_2191157_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191162_2194321_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194333_2194855_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194844_2195669_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195665_2196265_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196373_2198230_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198378_2199383_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199591_2200854_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200858_2201194_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201190_2202120_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202124_2202838_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202941_2204399_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204395_2204692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204816_2206175_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206275_2207076_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207255_2208374_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208446_2208818_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208824_2209676_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209696_2210308_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043143	Bordetella holmesii strain H557 chromosome, complete genome	3696591	2305437	2426948	3696591	protease,transposase,tRNA,integrase	Leptospira_phage(15.15%)	106	2336967:2337026	2358274:2358548
WP_101557807.1|2305437_2306600_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306712_2307681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307677_2308598_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308694_2313173_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313551_2317886_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318524_2319088_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319099_2319345_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319500_2320010_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320055_2321036_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321247_2323599_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323645_2324476_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324472_2325162_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325154_2326435_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326532_2327471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327452_2329159_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329236_2330340_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330392_2331142_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331148_2332663_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332675_2332963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332983_2333871_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2334021_2334528_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334524_2335481_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335668_2337015_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336967:2337026	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2336982_2337213_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337242_2337806_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337960_2338731_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338727_2339738_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2340052_2340499_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340554_2340749_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340750_2341092_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341101_2342964_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2343003_2343510_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343513_2343837_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343838_2344243_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344279_2345491_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345512_2346061_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346285_2346777_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2346991_2349022_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349096_2350299_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350841_2351777_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352810_2353092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353178_2353352_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353463_2353808_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353879_2354548_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355963_2357007_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2357003_2357105_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357196_2358316_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358566_2359220_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358274:2358548	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359335_2360556_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360606_2363036_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363201_2364500_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364604_2365258_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365260_2366571_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366798_2367338_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367816_2368083_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368121_2368487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368368_2369379_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369375_2370146_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370231_2370891_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370858_2371350_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371459_2371663_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371980_2372301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372284_2372620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372674_2372887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372962_2373301_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_017685558.1|2373288_2373633_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373695_2375267_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376060_2376372_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376564_2377685_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377812_2378007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384089_2385251_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385636_2387100_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387232_2388783_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388779_2388929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389094_2390215_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391328_2392186_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392238_2392736_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392856_2394272_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394281_2395466_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395462_2397061_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398243_2398489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398899_2399085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399240_2400152_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400273_2401116_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401318_2402692_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2403001_2404513_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404665_2405397_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405503_2406805_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406812_2407721_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407717_2408311_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408354_2408768_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408764_2409235_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409241_2409847_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411648_2413433_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413429_2414815_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414800_2415763_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415832_2416462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416499_2417708_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417829_2418399_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418530_2420084_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420387_2421608_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2422015_2422918_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422914_2423784_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423780_2424632_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424628_2425453_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425727_2426948_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043143	Bordetella holmesii strain H557 chromosome, complete genome	3696591	2936406	3013466	3696591	transposase,tRNA,integrase	Ralstonia_virus(21.43%)	56	2939261:2939320	2987848:2988418
WP_005019978.1|2936406_2937186_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937208_2938156_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938157_2938358_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938692_2939812_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939261:2939320	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940133_2940850_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940846_2941740_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941903_2943124_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943276_2944359_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2946038_2947022_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947084_2948497_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948614_2949457_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949735_2950344_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950359_2950980_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951045_2951753_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951757_2952480_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952466_2952757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952832_2954053_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954777_2955629_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955680_2956934_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957110_2957899_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2958018_2958933_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959065_2960958_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961143_2962523_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962967_2963264_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967064_2967667_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967800_2968259_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968260_2968860_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968868_2969678_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969712_2970567_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970686_2971274_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971270_2972650_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973154_2973301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2980972_2982313_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982326_2983178_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983189_2984455_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984516_2986421_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988396_2989251_-	hypothetical protein	NA	NA	NA	NA	NA
2987848:2988418	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989243_2990038_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990253_2991204_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991806_2992604_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992643_2993297_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993277_2994342_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994505_2996731_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996976_2998821_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998937_2999810_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999856_3001557_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001619_3002819_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002829_3003708_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003814_3004852_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004932_3005337_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005348_3006806_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007448_3008045_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008205_3008664_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009441_3010413_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010534_3010954_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012245_3013466_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
