The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043141	Bordetella holmesii strain H572 chromosome, complete genome	3696571	1095284	1202073	3696571	tRNA,transposase,protease	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095284_1096505_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096592_1097183_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097179_1097482_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097533_1098523_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098643_1099525_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099698_1100553_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100584_1101433_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101560_1102781_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102799_1103366_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103563_1104715_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104853_1105858_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106014_1106986_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107064_1107853_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107924_1108161_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108169_1109081_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109124_1110996_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111156_1111954_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112185_1112560_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112636_1112960_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113043_1113316_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113330_1113786_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113907_1114744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114740_1116114_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116190_1117147_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117234_1118212_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118336_1119992_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120040_1120505_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120501_1120963_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121188_1122376_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122372_1123677_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123673_1125083_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125276_1126396_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126531_1127551_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127559_1130265_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130404_1131058_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131120_1131483_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132049_1133510_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133772_1134846_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134930_1136151_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137908_1139029_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1139002_1140502_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140515_1141619_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141623_1142874_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142870_1144316_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144312_1144627_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144628_1145747_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145929_1147150_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147249_1148116_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148176_1149157_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149303_1150224_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150232_1151345_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151426_1152248_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152323_1152932_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153069_1154446_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154507_1154951_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155017_1155674_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155716_1156836_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1157005_1157287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157997_1158786_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158782_1159889_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160563_1161922_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162036_1162234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162251_1163372_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163465_1164020_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164607_1165924_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165936_1166950_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167496_1168447_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168526_1168826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170186_1171845_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171993_1173214_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173331_1174615_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174618_1175560_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175669_1176128_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176508_1177129_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177536_1179957_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180064_1180802_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180848_1182093_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182415_1182688_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183271_1184000_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184021_1184939_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184938_1185448_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185564_1186236_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186345_1187413_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187432_1189277_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189413_1190601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190901_1191687_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191710_1192830_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192934_1194272_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194381_1195323_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195378_1196560_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196718_1197009_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197055_1197724_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197720_1198008_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198384_1199170_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199202_1199937_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200852_1202073_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043141	Bordetella holmesii strain H572 chromosome, complete genome	3696571	1206860	1263266	3696571	tRNA,transposase,protease	Ralstonia_virus(23.08%)	44	NA	NA
WP_005012808.1|1206860_1207811_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207892_1208372_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209583_1210783_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210928_1211306_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211329_1213111_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213119_1213857_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214141_1215701_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215760_1216519_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216615_1217272_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217425_1218190_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218204_1218384_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218409_1219444_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219440_1219854_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219850_1220435_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220787_1222146_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222239_1222818_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222942_1224063_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224135_1225392_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225495_1226701_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226764_1227214_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227346_1227592_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227816_1228131_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233384_1235490_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235543_1237853_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239206_1240874_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240876_1241542_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241674_1245481_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245706_1246852_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246970_1247900_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247896_1248973_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248969_1249776_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249772_1250504_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250880_1252119_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252166_1252505_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252752_1253703_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254021_1254204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254269_1255490_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255583_1256804_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256863_1257127_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257248_1258748_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012868.1|1259168_1259366_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259381_1259741_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259813_1260836_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260848_1263266_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043141	Bordetella holmesii strain H572 chromosome, complete genome	3696571	1586802	1693064	3696571	integrase,transposase,tRNA	Leptospira_phage(14.29%)	99	1671250:1671309	1685246:1685974
WP_005011985.1|1586802_1588023_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588377_1588854_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589112_1589721_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589739_1590411_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590584_1592471_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592498_1593341_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593337_1594681_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594865_1595681_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595746_1597228_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597426_1599499_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599718_1600756_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601942_1602800_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602827_1603604_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604431_1604941_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1606018_1606789_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1606785_1607796_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1607854_1608935_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1609103_1610223_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1610224_1610968_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1610972_1611344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611404_1611650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1611756_1613256_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1613877_1614213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614471_1614603_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614632_1615130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615139_1615514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615604_1616897_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1617013_1617913_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1618064_1618283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1618756_1620382_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620617_1622141_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622112_1622808_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623148_1624210_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624255_1624807_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1624813_1625734_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1625873_1628171_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628226_1629447_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1629705_1630311_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630321_1631482_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631503_1632385_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632681_1633380_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633521_1634244_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634362_1635301_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635331_1636111_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636097_1637321_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1637325_1638873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1638908_1639442_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639685_1640381_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640395_1640527_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640574_1641699_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1641704_1644044_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1644040_1644448_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_005013586.1|1644709_1644970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645192_1646143_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646241_1647192_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1647241_1648450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1648671_1649211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1649435_1649840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1649904_1650660_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1650659_1652021_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1652017_1652641_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1652684_1653804_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654456_1655212_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655388_1656183_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656179_1656617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656728_1656881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657301_1658270_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658426_1659434_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659491_1659950_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1660023_1661370_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661387_1661759_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661758_1663228_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663383_1664109_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664122_1666837_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667088_1668453_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668492_1669551_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669578_1670397_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670434_1670713_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
1671250:1671309	attL	ACAGCGGAATCGGCGGCCATAGGCTATGGCCGTCGGCCACAAAGTCCATTGACCAACTCT	NA	NA	NA	NA
WP_005013614.1|1671975_1672275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672844_1674248_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674260_1674911_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675052_1676273_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676303_1677380_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677526_1678657_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678843_1680469_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680475_1681291_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681305_1682376_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682427_1683087_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683726_1684889_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684930_1685245_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685228_1685615_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685653_1685920_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686312_1687002_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
1685246:1685974	attR	ACAGCGGAATCGGCGGCCATAGGCTATGGCCGTCGGCCACAAAGTCCATTGACCAACTCTGATTCGGCGCGATTGCCGCTGGGCGAACCACGCGCTCGGTCGCCGCGATTCGCTTACGCTTTCGTTTTCGCACGCTTAACCCTGCCAGACTGTACAGCCGCCAGATTCGCTTGTGATTTGCTTGCCAGCCTTCGCGACGTAAGAGCACATGGATCCTCCGATAGCCGTAGCGTCGTTTCGCCACTGCCATCTCTTTCATGCGCTCGGTCAGCGCAGCATCGCCTGAGCGTGTGCTCTCGTAGGCAAACAGCGACCGCGAAATTCCTACCAGCCCACAGGCCCGGGTAACACCCATGCTGCGCTCGGTCATTAATGTCCTGACCGCCTCGCGTTTGGCCTGCGGGCTGACTACTTTCGGCTTAGCAGATCCTGAAGCGCCGCCTTGTCCAGCATCGACTCGGCCAACAGCTTCTTGAGCTTGTTGTTCTCCTGCTCCAGCTCCTTGAGCCTCTGAGCGTCCGACACCGTCATGCCACCGAACTTCGCCTTCCAGTTGTAGTACGTTGCCTCGGAGATTCCGTGCTTGCGGCACAACTCTGCGGGCTTGGCACCTGCATCGGCTTCCTTGAGCACGCCGATGATTTGCTCTTCCGTAAATCGTTTCTTCATTGCCATTCCTTTGGGAACGGACTCTACATCGATTTCGTACTAATCACGGGGAGCAGGTCA	NA	NA	NA	NA
WP_005013626.1|1687101_1687263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687413_1687578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687704_1687941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688130_1688379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013631.1|1689863_1690604_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691111_1693064_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043141	Bordetella holmesii strain H572 chromosome, complete genome	3696571	1711358	1755285	3696571	integrase,transposase,holin,tRNA	Leptospira_phage(33.33%)	37	1753853:1753867	1760329:1760343
WP_005019367.1|1711358_1714220_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714209_1715175_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715931_1717407_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717411_1717687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1718023_1719143_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1719017_1719266_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719444_1720653_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720649_1722932_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722942_1725324_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725587_1727495_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727509_1728400_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728406_1729540_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729539_1730361_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730385_1731576_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731877_1732159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732324_1732645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732684_1733771_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733967_1734228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734720_1735491_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735487_1736498_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736532_1737375_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737837_1738623_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739482_1740602_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741668_1742673_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742748_1743561_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743788_1745960_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1746013_1747333_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747421_1748642_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748860_1749721_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749717_1750941_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751239_1751737_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751775_1752558_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752583_1752802_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752876_1753146_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753365_1753830_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753853:1753867	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753903_1754185_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754301_1755285_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760329:1760343	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043141	Bordetella holmesii strain H572 chromosome, complete genome	3696571	1780561	1821952	3696571	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780561_1781512_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781508_1782024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782381_1783002_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783101_1783353_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783440_1784919_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784915_1788086_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788098_1789295_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789483_1790416_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790484_1791216_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791281_1791917_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791902_1793081_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793241_1793790_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793870_1794230_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794277_1795498_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795573_1796695_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796732_1797446_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797456_1798677_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798759_1799314_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799459_1800410_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800369_1800531_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800571_1801498_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801511_1802384_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802546_1803494_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803832_1804414_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804991_1805942_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805921_1806674_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806686_1807418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807574_1809740_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809829_1810099_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810187_1810394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810392_1810911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810929_1811709_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811876_1812893_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812965_1813457_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813467_1815183_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816346_1817297_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818948_1820190_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820201_1820975_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1821001_1821952_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043141	Bordetella holmesii strain H572 chromosome, complete genome	3696571	2150165	2210288	3696571	transposase,protease,tRNA	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150165_2150654_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150646_2151495_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151586_2152084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152221_2152581_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152577_2152859_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152858_2153341_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153342_2154971_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154967_2155312_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155313_2158256_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158701_2159673_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159662_2161045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161187_2162138_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162097_2163339_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163335_2164457_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165948_2166416_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166486_2167137_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167223_2168363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168531_2169536_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169532_2170780_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171132_2171999_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171958_2173563_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173574_2174261_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174257_2175298_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175413_2176085_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019577.1|2176081_2177074_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177070_2178009_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2178005_2179160_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179168_2180620_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180650_2181133_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181134_2182028_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2182024_2182468_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182480_2182855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2182997_2183396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183522_2183810_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183806_2184223_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184398_2185031_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185059_2185506_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185792_2186944_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187057_2188062_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189045_2189753_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189685_2191137_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191142_2194301_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194313_2194835_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194824_2195649_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195645_2196245_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196353_2198210_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198358_2199363_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199571_2200834_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200838_2201174_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201170_2202100_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202104_2202818_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202921_2204379_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204375_2204672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204796_2206155_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206255_2207056_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207235_2208354_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208426_2208798_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208804_2209656_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209676_2210288_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043141	Bordetella holmesii strain H572 chromosome, complete genome	3696571	2305417	2426928	3696571	integrase,transposase,protease,tRNA	Leptospira_phage(15.15%)	106	2336947:2337006	2358254:2358528
WP_101557807.1|2305417_2306580_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306692_2307661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307657_2308578_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308674_2313153_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313531_2317866_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318504_2319068_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319079_2319325_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319480_2319990_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320035_2321016_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321227_2323579_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323625_2324456_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324452_2325142_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325134_2326415_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326512_2327451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327432_2329139_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329216_2330320_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330372_2331122_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331128_2332643_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332655_2332943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332963_2333851_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2334001_2334508_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334504_2335461_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335648_2336995_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336947:2337006	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2336962_2337193_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337222_2337786_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337940_2338711_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338707_2339718_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2340032_2340479_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340534_2340729_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340730_2341072_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341081_2342944_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2342983_2343490_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343493_2343817_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343818_2344223_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344259_2345471_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345492_2346041_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346265_2346757_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2346971_2349002_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349076_2350279_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350821_2351757_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352790_2353072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353158_2353332_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353443_2353788_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353859_2354528_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355943_2356987_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2356983_2357085_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357176_2358296_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358546_2359200_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358254:2358528	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359315_2360536_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360586_2363016_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363181_2364480_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364584_2365238_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365240_2366551_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366778_2367318_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367796_2368063_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368101_2368467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368348_2369359_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369355_2370126_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370211_2370871_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370838_2371330_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371439_2371643_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371960_2372281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372264_2372600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372654_2372867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372942_2373281_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2373277_2373613_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373675_2375247_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376040_2376352_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376544_2377665_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377792_2377987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384069_2385231_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385616_2387080_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387212_2388763_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388759_2388909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389074_2390195_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391308_2392166_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392218_2392716_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392836_2394252_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394261_2395446_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395442_2397041_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398223_2398469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398879_2399065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399220_2400132_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400253_2401096_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401298_2402672_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2402981_2404493_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404645_2405377_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405483_2406785_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406792_2407701_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407697_2408291_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408334_2408748_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408744_2409215_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409221_2409827_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411628_2413413_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413409_2414795_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414780_2415743_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415812_2416442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416479_2417688_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417809_2418379_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418510_2420064_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420367_2421588_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2421995_2422898_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422894_2423764_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423760_2424612_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424608_2425433_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425707_2426928_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043141	Bordetella holmesii strain H572 chromosome, complete genome	3696571	2936386	3013446	3696571	integrase,transposase,tRNA	Ralstonia_virus(21.43%)	56	2939241:2939300	2987828:2988398
WP_005019978.1|2936386_2937166_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937188_2938136_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938137_2938338_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938672_2939792_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939241:2939300	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940113_2940830_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940826_2941720_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941883_2943104_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943256_2944339_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2946018_2947002_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947064_2948477_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948594_2949437_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949715_2950324_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950339_2950960_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951025_2951733_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951737_2952460_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952446_2952737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952812_2954033_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954757_2955609_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955660_2956914_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957090_2957879_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2957998_2958913_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959045_2960938_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961123_2962503_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962947_2963244_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967044_2967647_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967780_2968239_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968240_2968840_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968848_2969658_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969692_2970547_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970666_2971254_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971250_2972630_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973134_2973281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2980952_2982293_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982306_2983158_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983169_2984435_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984496_2986401_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988376_2989231_-	hypothetical protein	NA	NA	NA	NA	NA
2987828:2988398	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989223_2990018_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990233_2991184_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991786_2992584_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992623_2993277_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993257_2994322_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994485_2996711_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996956_2998801_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998917_2999790_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999836_3001537_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001599_3002799_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002809_3003688_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003794_3004832_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004912_3005317_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005328_3006786_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007428_3008025_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008185_3008644_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009421_3010393_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010514_3010934_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012225_3013446_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
