The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043138	Bordetella holmesii strain H610 chromosome, complete genome	3693564	1095267	1203105	3693564	protease,tRNA,transposase	Ralstonia_virus(16.67%)	99	NA	NA
WP_005011985.1|1095267_1096488_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096575_1097166_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097162_1097465_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097516_1098506_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098626_1099508_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099681_1100536_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100567_1101416_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101543_1102764_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102782_1103349_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103546_1104698_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104836_1105841_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1105997_1106969_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107047_1107836_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107907_1108144_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108152_1109064_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109107_1110979_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111139_1111937_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112168_1112543_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112619_1112943_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113026_1113299_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113313_1113769_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113890_1114727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114723_1116097_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116173_1117130_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117217_1118195_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118319_1119975_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120023_1120488_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120484_1120946_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121171_1122359_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122355_1123660_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123656_1125066_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125259_1126379_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126514_1127534_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127542_1130248_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130387_1131041_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131103_1131466_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132032_1133493_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133755_1134829_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134913_1136134_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137891_1139012_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138985_1140485_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140498_1141602_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141606_1142857_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142853_1144299_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144295_1144610_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144611_1145730_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145912_1147133_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147232_1148099_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148159_1149140_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149286_1150207_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150215_1151328_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151409_1152231_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152306_1152915_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153052_1154429_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154490_1154934_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155000_1155657_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155699_1156819_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156988_1157270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157980_1158769_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158765_1159872_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160546_1161905_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162019_1162217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162234_1163355_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163448_1164003_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164590_1165907_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165919_1166933_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167479_1168430_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168509_1168809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153567792.1|1168796_1169558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1169656_1170607_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_153567793.1|1170628_1171222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1171218_1172877_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1173025_1174246_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1174363_1175647_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1175650_1176592_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1176701_1177160_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1177540_1178161_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1178568_1180989_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1181096_1181834_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1181880_1183125_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1183447_1183720_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1184303_1185032_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1185053_1185971_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1185970_1186480_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1186596_1187268_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1187377_1188445_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1188464_1190309_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1190445_1191633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1191933_1192719_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1192742_1193862_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1193966_1195304_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1195413_1196355_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1196410_1197592_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1197750_1198041_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1198087_1198756_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1198752_1199040_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1199416_1200202_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1200234_1200969_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1201884_1203105_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043138	Bordetella holmesii strain H610 chromosome, complete genome	3693564	1207892	1264298	3693564	protease,tRNA,transposase	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1207892_1208843_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1208924_1209404_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1210615_1211815_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1211960_1212338_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1212361_1214143_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1214151_1214889_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1215173_1216733_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1216792_1217551_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1217647_1218304_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1218457_1219222_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1219236_1219416_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1219441_1220476_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1220472_1220886_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1220882_1221467_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1221819_1223178_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1223271_1223850_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1223974_1225095_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1225167_1226424_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1226527_1227733_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1227796_1228246_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1228378_1228624_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1228848_1229163_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1234416_1236522_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1236575_1238885_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1240238_1241906_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1241908_1242574_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1242706_1246513_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1246738_1247884_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1248002_1248932_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1248928_1250005_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1250001_1250808_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1250804_1251536_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1251912_1253151_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1253198_1253537_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1253784_1254735_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1255053_1255236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1255301_1256522_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1256615_1257836_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1257895_1258159_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1258280_1259780_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1259827_1260103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1260200_1260398_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1260413_1260773_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1260845_1261868_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1261880_1264298_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043138	Bordetella holmesii strain H610 chromosome, complete genome	3693564	1652669	1693043	3693564	tRNA,transposase,integrase	Leptospira_phage(28.57%)	39	1645111:1645127	1689728:1689744
1645111:1645127	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|1652669_1653789_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654441_1655197_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655373_1656168_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656164_1656602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656713_1656866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657286_1658255_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658411_1659419_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659476_1659935_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1660008_1661355_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661372_1661744_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661743_1663213_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663368_1664094_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664107_1666822_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667073_1668438_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668477_1669536_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669563_1670382_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670419_1670698_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671961_1672261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672830_1674234_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674246_1674897_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675038_1676259_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676289_1677366_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677512_1678643_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678829_1680455_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680461_1681277_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681291_1682362_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682413_1683073_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683712_1684875_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684916_1685231_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685214_1685601_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685639_1685906_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686298_1686988_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687087_1687249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687399_1687564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687690_1687927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688116_1688365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688478_1689849_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689728:1689744	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689849_1690590_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691090_1693043_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 5
NZ_CP043138	Bordetella holmesii strain H610 chromosome, complete genome	3693564	1711604	1755531	3693564	tRNA,integrase,transposase,holin	Leptospira_phage(33.33%)	37	1754099:1754113	1760575:1760589
WP_005019367.1|1711604_1714466_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714455_1715421_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1716177_1717653_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717657_1717933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1718269_1719389_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1719263_1719512_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719690_1720899_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720895_1723178_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1723188_1725570_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725833_1727741_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727755_1728646_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728652_1729786_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729785_1730607_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730631_1731822_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1732123_1732405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732570_1732891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732930_1734017_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1734213_1734474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734966_1735737_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735733_1736744_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736778_1737621_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1738083_1738869_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739728_1740848_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741914_1742919_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742994_1743807_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1744034_1746206_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1746259_1747579_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747667_1748888_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1749106_1749967_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749963_1751187_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751485_1751983_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1752021_1752804_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752829_1753048_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1753122_1753392_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753611_1754076_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1754099:1754113	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1754149_1754431_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754547_1755531_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760575:1760589	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP043138	Bordetella holmesii strain H610 chromosome, complete genome	3693564	1780807	1822198	3693564	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780807_1781758_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781754_1782270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782627_1783248_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783347_1783599_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783686_1785165_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1785161_1788332_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788344_1789541_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789729_1790662_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790730_1791462_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791527_1792163_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1792148_1793327_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793487_1794036_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1794116_1794476_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794523_1795744_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795819_1796941_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796978_1797692_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797702_1798923_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1799005_1799560_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799705_1800656_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800615_1800777_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800817_1801744_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801757_1802630_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802792_1803740_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1804078_1804660_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1805237_1806188_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1806167_1806920_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806932_1807664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807820_1809986_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1810075_1810345_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810433_1810640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810638_1811157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1811175_1811955_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1812122_1813139_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1813211_1813703_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813713_1815429_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816592_1817543_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1819194_1820436_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820447_1821221_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1821247_1822198_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043138	Bordetella holmesii strain H610 chromosome, complete genome	3693564	2147163	2207286	3693564	protease,tRNA,transposase	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2147163_2147652_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2147644_2148493_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2148584_2149082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2149219_2149579_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2149575_2149857_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2149856_2150339_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2150340_2151969_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2151965_2152310_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2152311_2155254_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2155699_2156671_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2156660_2158043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2158185_2159136_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2159095_2160337_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2160333_2161455_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2162946_2163414_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2163484_2164135_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2164221_2165361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2165529_2166534_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2166530_2167778_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2168130_2168997_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2168956_2170561_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2170572_2171259_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2171255_2172296_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2172411_2173083_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2173079_2174072_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2174068_2175007_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2175003_2176158_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2176166_2177618_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2177648_2178131_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2178132_2179026_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2179022_2179466_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2179478_2179853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2179995_2180394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2180520_2180808_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2180804_2181221_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2181396_2182029_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2182057_2182504_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2182790_2183942_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2184055_2185060_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2186043_2186751_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2186683_2188135_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2188140_2191299_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2191311_2191833_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2191822_2192647_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2192643_2193243_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2193351_2195208_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2195356_2196361_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2196569_2197832_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2197836_2198172_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2198168_2199098_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2199102_2199816_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2199919_2201377_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2201373_2201670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2201794_2203153_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2203253_2204054_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2204233_2205352_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2205424_2205796_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2205802_2206654_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2206674_2207286_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043138	Bordetella holmesii strain H610 chromosome, complete genome	3693564	2302409	2423920	3693564	protease,tRNA,transposase,integrase	Leptospira_phage(15.15%)	106	2333939:2333998	2355246:2355520
WP_101557807.1|2302409_2303572_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2303684_2304653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2304649_2305570_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2305666_2310145_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2310523_2314858_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2315496_2316060_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2316071_2316317_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2316472_2316982_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2317027_2318008_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2318219_2320571_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2320617_2321448_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2321444_2322134_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2322126_2323407_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2323504_2324443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2324424_2326131_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2326208_2327312_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2327364_2328114_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2328120_2329635_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2329647_2329935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2329955_2330843_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2330993_2331500_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2331496_2332453_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2332640_2333987_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2333939:2333998	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2333954_2334185_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2334214_2334778_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2334932_2335703_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2335699_2336710_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2337024_2337471_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2337526_2337721_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2337722_2338064_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2338073_2339936_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2339975_2340482_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2340485_2340809_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2340810_2341215_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2341251_2342463_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2342484_2343033_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2343257_2343749_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2343963_2345994_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2346068_2347271_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2347813_2348749_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2349782_2350064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2350150_2350324_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2350435_2350780_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2350851_2351520_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2352935_2353979_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2353975_2354077_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2354168_2355288_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2355538_2356192_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2355246:2355520	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2356307_2357528_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2357578_2360008_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2360173_2361472_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2361576_2362230_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2362232_2363543_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2363770_2364310_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2364788_2365055_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2365093_2365459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032965889.1|2365340_2366351_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2366347_2367118_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2367203_2367863_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2367830_2368322_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2368431_2368635_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2368952_2369273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2369256_2369592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2369646_2369859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2369934_2370273_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_017685558.1|2370260_2370605_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2370667_2372239_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2373032_2373344_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2373536_2374657_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2374784_2374979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2381061_2382223_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2382608_2384072_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2384204_2385755_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2385751_2385901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2386066_2387187_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2388300_2389158_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2389210_2389708_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2389828_2391244_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2391253_2392438_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2392434_2394033_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2395215_2395461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2395871_2396057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2396212_2397124_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2397245_2398088_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2398290_2399664_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2399973_2401485_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2401637_2402369_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2402475_2403777_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2403784_2404693_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2404689_2405283_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2405326_2405740_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2405736_2406207_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2406213_2406819_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2408620_2410405_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2410401_2411787_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2411772_2412735_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2412804_2413434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2413471_2414680_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2414801_2415371_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2415502_2417056_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2417359_2418580_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2418987_2419890_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2419886_2420756_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2420752_2421604_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2421600_2422425_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2422699_2423920_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043138	Bordetella holmesii strain H610 chromosome, complete genome	3693564	2933379	3010439	3693564	tRNA,transposase,integrase	Ralstonia_virus(21.43%)	56	2936234:2936293	2984821:2985391
WP_005019978.1|2933379_2934159_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2934181_2935129_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2935130_2935331_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2935665_2936785_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2936234:2936293	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2937106_2937823_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2937819_2938713_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2938876_2940097_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2940249_2941332_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2943011_2943995_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2944057_2945470_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2945587_2946430_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2946708_2947317_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2947332_2947953_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2948018_2948726_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2948730_2949453_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2949439_2949730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2949805_2951026_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2951750_2952602_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2952653_2953907_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2954083_2954872_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2954991_2955906_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2956038_2957931_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2958116_2959496_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2959940_2960237_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2964037_2964640_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2964773_2965232_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2965233_2965833_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2965841_2966651_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2966685_2967540_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2967659_2968247_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2968243_2969623_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2970127_2970274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2977945_2979286_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2979299_2980151_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2980162_2981428_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2981489_2983394_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2985369_2986224_-	hypothetical protein	NA	NA	NA	NA	NA
2984821:2985391	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2986216_2987011_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2987226_2988177_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2988779_2989577_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2989616_2990270_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2990250_2991315_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2991478_2993704_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2993949_2995794_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2995910_2996783_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2996829_2998530_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|2998592_2999792_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|2999802_3000681_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3000787_3001825_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3001905_3002310_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3002321_3003779_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3004421_3005018_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3005178_3005637_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3006414_3007386_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3007507_3007927_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3009218_3010439_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
