The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043134	Bordetella holmesii strain H629 chromosome, complete genome	3696569	1095286	1202075	3696569	transposase,protease,tRNA	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095286_1096507_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096594_1097185_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097181_1097484_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097535_1098525_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098645_1099527_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_032976014.1|1099700_1100555_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100586_1101435_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101562_1102783_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102801_1103368_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103565_1104717_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104855_1105860_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106016_1106988_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107066_1107855_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107926_1108163_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108171_1109083_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109126_1110998_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111158_1111956_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112187_1112562_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112638_1112962_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113045_1113318_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113332_1113788_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113909_1114746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114742_1116116_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116192_1117149_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117236_1118214_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118338_1119994_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120042_1120507_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120503_1120965_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121190_1122378_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122374_1123679_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123675_1125085_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125278_1126398_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126533_1127553_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127561_1130267_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130406_1131060_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131122_1131485_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132051_1133512_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_032976136.1|1133774_1134848_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134932_1136153_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137910_1139031_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1139004_1140504_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140517_1141621_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141625_1142876_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142872_1144318_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144314_1144629_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144630_1145749_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145931_1147152_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147251_1148118_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148178_1149159_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149305_1150226_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150234_1151347_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151428_1152250_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152325_1152934_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153071_1154448_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154509_1154953_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155019_1155676_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155718_1156838_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1157007_1157289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157999_1158788_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158784_1159891_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160565_1161924_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162038_1162236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162253_1163374_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163467_1164022_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164609_1165926_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165938_1166952_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167498_1168449_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168528_1168828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170188_1171847_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171995_1173216_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173333_1174617_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174620_1175562_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175671_1176130_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176510_1177131_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177538_1179959_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180066_1180804_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180850_1182095_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182417_1182690_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183273_1184002_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184023_1184941_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184940_1185450_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185566_1186238_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186347_1187415_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187434_1189279_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189415_1190603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190903_1191689_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191712_1192832_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192936_1194274_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194383_1195325_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195380_1196562_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196720_1197011_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197057_1197726_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197722_1198010_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198386_1199172_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199204_1199939_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200854_1202075_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043134	Bordetella holmesii strain H629 chromosome, complete genome	3696569	1206862	1263268	3696569	transposase,protease,tRNA	Ralstonia_virus(23.08%)	44	NA	NA
WP_005012808.1|1206862_1207813_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207894_1208374_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209585_1210785_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210930_1211308_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211331_1213113_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213121_1213859_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214143_1215703_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215762_1216521_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216617_1217274_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217427_1218192_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218206_1218386_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218411_1219446_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219442_1219856_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219852_1220437_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220789_1222148_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222241_1222820_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222944_1224065_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224137_1225394_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225497_1226703_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226766_1227216_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227348_1227594_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227818_1228133_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233386_1235492_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235545_1237855_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239208_1240876_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240878_1241544_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241676_1245483_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245708_1246854_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246972_1247902_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247898_1248975_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248971_1249778_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249774_1250506_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250882_1252121_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252168_1252507_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252754_1253705_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254023_1254206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254271_1255492_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255585_1256806_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256865_1257129_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257250_1258750_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012868.1|1259170_1259368_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259383_1259743_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259815_1260838_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260850_1263268_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043134	Bordetella holmesii strain H629 chromosome, complete genome	3696569	1586806	1693062	3696569	transposase,tRNA,integrase	Leptospira_phage(14.29%)	100	1644081:1644097	1689747:1689763
WP_005011985.1|1586806_1588027_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588381_1588858_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589116_1589725_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589743_1590415_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590588_1592475_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592502_1593345_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593341_1594685_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594869_1595685_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595750_1597232_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597430_1599503_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599722_1600760_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601946_1602804_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602831_1603608_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604435_1604945_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1606022_1606793_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1606789_1607800_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1607858_1608939_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1609107_1610227_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1610228_1610972_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1610976_1611348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611408_1611654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1611760_1613260_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1613881_1614217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614475_1614607_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614636_1615134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615143_1615518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615608_1616901_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1617017_1617917_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1618068_1618287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1618760_1620386_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620621_1622145_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622116_1622812_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623152_1624214_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624259_1624811_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1624817_1625738_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1625877_1628175_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628230_1629451_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1629709_1630315_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630325_1631486_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631507_1632389_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632685_1633384_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633525_1634248_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634366_1635305_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635335_1636115_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636101_1637325_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1637329_1638877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1638912_1639446_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639689_1640385_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640399_1640531_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640578_1641703_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1641708_1644048_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1644044_1644452_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1644081:1644097	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1644713_1644974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645196_1646147_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646245_1647196_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1647245_1648454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1648675_1649215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1649439_1649844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1649908_1650664_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1650663_1652025_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1652021_1652645_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1652688_1653808_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654460_1655216_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655392_1656187_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656183_1656621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656732_1656885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657305_1658274_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658430_1659438_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659495_1659954_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1660027_1661374_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661391_1661763_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661762_1663232_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663387_1664113_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664126_1666841_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667092_1668457_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668496_1669555_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669582_1670401_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670438_1670717_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671980_1672280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672849_1674253_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674265_1674916_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675057_1676278_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676308_1677385_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677531_1678662_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678848_1680474_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680480_1681296_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681310_1682381_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682432_1683092_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683731_1684894_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684935_1685250_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685233_1685620_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685658_1685925_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686317_1687007_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687106_1687268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687418_1687583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687709_1687946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688135_1688384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688497_1689868_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689747:1689763	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689868_1690609_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691109_1693062_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043134	Bordetella holmesii strain H629 chromosome, complete genome	3696569	1711356	1755283	3696569	transposase,holin,tRNA,integrase	Leptospira_phage(33.33%)	37	1753851:1753865	1760327:1760341
WP_005019367.1|1711356_1714218_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714207_1715173_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715929_1717405_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717409_1717685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1718021_1719141_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1719015_1719264_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719442_1720651_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720647_1722930_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722940_1725322_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725585_1727493_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727507_1728398_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728404_1729538_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729537_1730359_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730383_1731574_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731875_1732157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732322_1732643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732682_1733769_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733965_1734226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734718_1735489_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735485_1736496_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_162007577.1|1736530_1737373_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	7.4e-55
WP_005013673.1|1737835_1738621_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739480_1740600_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741666_1742671_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742746_1743559_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743786_1745958_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1746011_1747331_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747419_1748640_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748858_1749719_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749715_1750939_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751237_1751735_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751773_1752556_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752581_1752800_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752874_1753144_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753363_1753828_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753851:1753865	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753901_1754183_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754299_1755283_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760327:1760341	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043134	Bordetella holmesii strain H629 chromosome, complete genome	3696569	1780559	1821950	3696569	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780559_1781510_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781506_1782022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782379_1783000_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783099_1783351_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783438_1784917_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784913_1788084_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788096_1789293_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789481_1790414_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790482_1791214_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791279_1791915_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791900_1793079_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793239_1793788_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793868_1794228_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794275_1795496_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795571_1796693_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796730_1797444_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797454_1798675_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798757_1799312_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799457_1800408_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800367_1800529_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800569_1801496_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801509_1802382_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802544_1803492_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803830_1804412_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804989_1805940_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805919_1806672_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806684_1807416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807572_1809738_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809827_1810097_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810185_1810392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810390_1810909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810927_1811707_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811874_1812891_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812963_1813455_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813465_1815181_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816344_1817295_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818946_1820188_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820199_1820973_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1820999_1821950_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043134	Bordetella holmesii strain H629 chromosome, complete genome	3696569	2150163	2210286	3696569	transposase,protease,tRNA	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150163_2150652_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150644_2151493_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151584_2152082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152219_2152579_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152575_2152857_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152856_2153339_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153340_2154969_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154965_2155310_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155311_2158254_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158699_2159671_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159660_2161043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161185_2162136_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162095_2163337_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163333_2164455_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165946_2166414_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166484_2167135_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167221_2168361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168529_2169534_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169530_2170778_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171130_2171997_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171956_2173561_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173572_2174259_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174255_2175296_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175411_2176083_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019577.1|2176079_2177072_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177068_2178007_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2178003_2179158_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179166_2180618_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180648_2181131_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181132_2182026_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2182022_2182466_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182478_2182853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2182995_2183394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183520_2183808_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183804_2184221_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184396_2185029_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185057_2185504_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185790_2186942_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187055_2188060_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189043_2189751_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189683_2191135_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191140_2194299_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194311_2194833_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194822_2195647_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195643_2196243_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196351_2198208_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198356_2199361_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199569_2200832_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200836_2201172_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201168_2202098_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202102_2202816_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202919_2204377_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204373_2204670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204794_2206153_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206253_2207054_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207233_2208352_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208424_2208796_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208802_2209654_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209674_2210286_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043134	Bordetella holmesii strain H629 chromosome, complete genome	3696569	2280751	2339715	3696569	transposase,tRNA,integrase	Leptospira_phage(18.18%)	51	2281574:2281633	2337784:2337857
WP_101557770.1|2280751_2281872_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2281574:2281633	attL	TAATGTCCTGACCGCCTCGCGTTTGGCCTGCGGGCTGACTACTTTCGGCTTAGCAGATCC	NA	NA	NA	NA
WP_110097776.1|2281966_2282086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014417.1|2282082_2283381_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_005014419.1|2283423_2284452_+	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_005019641.1|2284566_2285139_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_025341466.1|2285197_2286043_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_005019653.1|2286100_2286976_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005014425.1|2287227_2287842_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_005011985.1|2287851_2289072_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014428.1|2289120_2289786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005019657.1|2289833_2290829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014433.1|2294006_2294921_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014435.1|2295070_2296036_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005014437.1|2296043_2296460_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_005014438.1|2296456_2297374_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014440.1|2297385_2297805_+	EthD family reductase	NA	NA	NA	NA	NA
WP_005014441.1|2297713_2299102_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019661.1|2299098_2299350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014444.1|2299520_2300477_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014447.1|2300459_2300672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014448.1|2300721_2301495_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005019667.1|2301491_2302625_+	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_005014461.1|2302634_2303585_+	D-3-phosphoglycerate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	28.4	4.8e-18
WP_005014462.1|2303616_2304417_+	aldolase	NA	NA	NA	NA	NA
WP_005014464.1|2304431_2305586_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_101557807.1|2305413_2306576_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306688_2307657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341469.1|2308671_2313150_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313528_2317863_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318501_2319065_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319076_2319322_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319477_2319987_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320032_2321013_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321224_2323576_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323622_2324453_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324449_2325139_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325131_2326412_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326509_2327448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327429_2329136_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329213_2330317_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330369_2331119_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331125_2332640_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332652_2332940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332960_2333848_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2333998_2334505_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334501_2335458_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335645_2336992_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_025341181.1|2336959_2337190_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337219_2337783_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337937_2338708_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
2337784:2337857	attR	TAATGTCCTGACCGCCTCGCGTTTGGCCTGCGGGCTGACTACTTTCGGCTTAGCAGATCCTGAAGCGCCGCCTT	NA	NA	NA	NA
WP_025341421.1|2338704_2339715_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
>prophage 8
NZ_CP043134	Bordetella holmesii strain H629 chromosome, complete genome	3696569	2355940	2390192	3696569	transposase,protease	Leptospira_phage(22.22%)	31	NA	NA
WP_005014572.1|2355940_2356984_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2356980_2357082_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357173_2358293_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358543_2359197_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
WP_032974133.1|2359312_2360533_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360583_2363013_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363178_2364477_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364581_2365235_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365237_2366548_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366775_2367315_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367793_2368060_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368098_2368464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368345_2369356_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369352_2370123_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370208_2370868_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370835_2371327_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371436_2371640_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371957_2372278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372261_2372597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372651_2372864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372939_2373278_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2373274_2373610_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373672_2375244_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376037_2376349_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376541_2377662_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377789_2377984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384066_2385228_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385613_2387077_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387209_2388760_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388756_2388906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389071_2390192_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
>prophage 9
NZ_CP043134	Bordetella holmesii strain H629 chromosome, complete genome	3696569	2936384	3013444	3696569	transposase,tRNA,integrase	Ralstonia_virus(21.43%)	56	2939239:2939298	2987826:2988396
WP_005019978.1|2936384_2937164_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937186_2938134_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938135_2938336_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938670_2939790_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939239:2939298	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940111_2940828_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940824_2941718_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941881_2943102_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943254_2944337_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2946016_2947000_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947062_2948475_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948592_2949435_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949713_2950322_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950337_2950958_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951023_2951731_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951735_2952458_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952444_2952735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952810_2954031_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954755_2955607_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955658_2956912_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957088_2957877_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2957996_2958911_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959043_2960936_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961121_2962501_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962945_2963242_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967042_2967645_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967778_2968237_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968238_2968838_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968846_2969656_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969690_2970545_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970664_2971252_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971248_2972628_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973132_2973279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2980950_2982291_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982304_2983156_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983167_2984433_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984494_2986399_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988374_2989229_-	hypothetical protein	NA	NA	NA	NA	NA
2987826:2988396	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989221_2990016_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990231_2991182_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991784_2992582_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992621_2993275_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993255_2994320_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994483_2996709_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996954_2998799_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998915_2999788_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999834_3001535_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001597_3002797_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002807_3003686_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003792_3004830_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004910_3005315_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005326_3006784_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007426_3008023_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008183_3008642_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009419_3010391_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010512_3010932_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012223_3013444_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
