The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043132	Bordetella holmesii strain H641 chromosome, complete genome	3696559	1095302	1202091	3696559	transposase,tRNA,protease	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095302_1096523_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096610_1097201_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097197_1097500_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097551_1098541_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098661_1099543_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099716_1100571_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100602_1101451_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101578_1102799_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102817_1103384_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103581_1104733_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104871_1105876_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106032_1107004_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107082_1107871_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107942_1108179_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108187_1109099_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109142_1111014_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111174_1111972_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112203_1112578_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112654_1112978_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113061_1113334_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113348_1113804_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113925_1114762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114758_1116132_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116208_1117165_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117252_1118230_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118354_1120010_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120058_1120523_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120519_1120981_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121206_1122394_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122390_1123695_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123691_1125101_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125294_1126414_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126549_1127569_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127577_1130283_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130422_1131076_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131138_1131501_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132067_1133528_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133790_1134864_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134948_1136169_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137926_1139047_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1139020_1140520_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140533_1141637_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141641_1142892_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142888_1144334_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144330_1144645_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144646_1145765_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145947_1147168_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147267_1148134_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148194_1149175_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149321_1150242_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150250_1151363_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151444_1152266_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152341_1152950_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153087_1154464_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154525_1154969_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155035_1155692_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155734_1156854_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1157023_1157305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1158015_1158804_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158800_1159907_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160581_1161940_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162054_1162252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162269_1163390_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163483_1164038_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164625_1165942_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165954_1166968_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167514_1168465_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168544_1168844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170204_1171863_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1172011_1173232_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173349_1174633_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174636_1175578_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175687_1176146_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176526_1177147_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177554_1179975_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180082_1180820_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180866_1182111_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182433_1182706_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183289_1184018_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184039_1184957_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184956_1185466_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185582_1186254_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186363_1187431_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187450_1189295_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189431_1190619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190919_1191705_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191728_1192848_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192952_1194290_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194399_1195341_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195396_1196578_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196736_1197027_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197073_1197742_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197738_1198026_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198402_1199188_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199220_1199955_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200870_1202091_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043132	Bordetella holmesii strain H641 chromosome, complete genome	3696559	1206878	1263284	3696559	transposase,tRNA,protease	Ralstonia_virus(23.08%)	44	NA	NA
WP_005012808.1|1206878_1207829_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207910_1208390_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209601_1210801_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210946_1211324_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211347_1213129_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213137_1213875_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214159_1215719_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215778_1216537_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216633_1217290_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217443_1218208_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218222_1218402_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218427_1219462_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219458_1219872_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219868_1220453_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220805_1222164_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222257_1222836_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222960_1224081_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224153_1225410_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225513_1226719_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226782_1227232_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227364_1227610_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227834_1228149_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233402_1235508_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235561_1237871_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239224_1240892_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240894_1241560_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241692_1245499_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245724_1246870_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246988_1247918_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247914_1248991_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248987_1249794_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249790_1250522_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250898_1252137_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252184_1252523_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252770_1253721_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254039_1254222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254287_1255508_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255601_1256822_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256881_1257145_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257266_1258766_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012868.1|1259186_1259384_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259399_1259759_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259831_1260854_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260866_1263284_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043132	Bordetella holmesii strain H641 chromosome, complete genome	3696559	1658445	1719274	3696559	integrase,transposase,tRNA	Ralstonia_virus(18.18%)	60	1670800:1670859	1709253:1709823
WP_025341429.1|1658445_1659453_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659510_1659969_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1660042_1661389_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661406_1661778_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661777_1663247_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663402_1664128_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664141_1666856_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667107_1668472_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668511_1669570_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669597_1670416_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670453_1670732_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
1670800:1670859	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_005013614.1|1671995_1672295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672864_1674268_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674280_1674931_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675072_1676293_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676323_1677400_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677546_1678677_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678863_1680489_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680495_1681311_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681325_1682396_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682447_1683107_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_157933264.1|1684948_1685263_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685246_1685633_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685671_1685938_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686330_1687020_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687119_1687281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687431_1687596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687722_1687959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688148_1688397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688510_1689881_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_005013631.1|1689881_1690622_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691119_1693072_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
WP_076879490.1|1693092_1693641_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
WP_005013634.1|1693806_1694763_+	glutathione synthase	NA	NA	NA	NA	NA
WP_005013635.1|1694776_1695175_+	PTS IIa component	NA	NA	NA	NA	NA
WP_005013636.1|1695237_1695507_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_005013637.1|1695535_1697311_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_005013638.1|1697358_1697568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013639.1|1697614_1698037_-	OsmC family protein	NA	NA	NA	NA	NA
WP_005013640.1|1698156_1699134_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_005013641.1|1699202_1700366_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013642.1|1700534_1701422_+	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
WP_005013643.1|1701432_1702074_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
WP_005013644.1|1702070_1702742_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
WP_005013645.1|1703614_1704064_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
WP_005013647.1|1704105_1704564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013648.1|1704584_1705217_-	DedA family protein	NA	NA	NA	NA	NA
WP_005013649.1|1705326_1705794_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005013650.1|1705815_1706358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013651.1|1706370_1707075_+	dipeptidase PepE	NA	NA	NA	NA	NA
WP_005013652.1|1707093_1707564_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019364.1|1707656_1708397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013654.1|1709576_1710788_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.4	2.2e-36
1709253:1709823	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGGGGGGTGCTCATCATCGATGAAGCCCAGCGTATGCAACTGTCGGCGCGCACCCGCTTTCTGGCTCTTTGCTGGTTGTCACTATCGCACTCGTTGATCGAGGACACATTGCTCTTGCTGGCAGTGGGAGCCAATGTGTGGATCGTGTTGCTGGGGCGTGTCGTTCTAACGTTGCTGGTCGTGGCGGGGCTGGCGCGCCTGTGGCCTCTGAGCCCGGGCATGGCGCCCGGCAAAGCGTTAGGCATCCGGTGGCTGGAAAGCTGCCTCAGGCCTGGACGTTGCCTTGCGCAAAGCGGCCCGCGATCTCGGCTATCAGCCGGCGGGCGGCATCCAACTTGGGTGCGGCCGGCAACGGATGCGCGCCCAGGGCATCGAACAGCACCAGTTCGGTCGTATCCGCATCCATCACTTTATGCGCCAGATTACCCACCAATAGAGGGATGCCCTTGCGCTGGCGCTTGGCCTCGGCGTGCTCCGACAGTTTCTCGGTTTCGGCCGCGAAACCGACGCAC	NA	NA	NA	NA
WP_005013655.1|1710848_1711364_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_005019367.1|1711366_1714228_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714217_1715183_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715939_1717415_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717419_1717695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1718031_1719151_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1719025_1719274_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
>prophage 5
NZ_CP043132	Bordetella holmesii strain H641 chromosome, complete genome	3696559	1732692	1781520	3696559	integrase,transposase,holin	Leptospira_phage(30.0%)	44	1737317:1737376	1768145:1768223
WP_101557814.1|1732692_1733779_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733975_1734236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734728_1735499_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735495_1736506_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736540_1737383_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
1737317:1737376	attL	GCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCC	NA	NA	NA	NA
WP_005013673.1|1737845_1738631_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739490_1740610_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741676_1742681_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742756_1743569_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743796_1745968_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1746021_1747341_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747429_1748650_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748868_1749729_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749725_1750949_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751247_1751745_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751783_1752566_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752591_1752810_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752884_1753154_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753373_1753838_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013685.1|1753911_1754193_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754309_1755293_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005013688.1|1755536_1756535_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_005013689.1|1756637_1757069_+	TonB family protein	NA	NA	NA	NA	NA
WP_005013690.1|1757133_1758045_+	phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
WP_005013691.1|1758177_1760259_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005019382.1|1760297_1761002_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013692.1|1761094_1761979_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013693.1|1762054_1762456_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_005013694.1|1762546_1762693_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_005013695.1|1762954_1763890_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013696.1|1763971_1764625_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_157933265.1|1765241_1765709_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013698.1|1765742_1766537_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005013699.1|1766553_1767534_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013700.1|1767706_1767919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153566129.1|1768037_1768211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013701.1|1768332_1770108_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
1768145:1768223	attR	GCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAG	NA	NA	NA	NA
WP_005013702.1|1770123_1771788_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_005013703.1|1771800_1774512_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_005013704.1|1775057_1776812_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_005019390.1|1776808_1777435_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013706.1|1777431_1778286_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.4e-29
WP_005013707.1|1778405_1780460_+	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_005012067.1|1780569_1781520_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043132	Bordetella holmesii strain H641 chromosome, complete genome	3696559	2150168	2210291	3696559	transposase,tRNA,protease	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150168_2150657_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150649_2151498_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151589_2152087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152224_2152584_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152580_2152862_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152861_2153344_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153345_2154974_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154970_2155315_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155316_2158259_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158704_2159676_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159665_2161048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161190_2162141_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162100_2163342_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163338_2164460_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165951_2166419_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166489_2167140_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167226_2168366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168534_2169539_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169535_2170783_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171135_2172002_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171961_2173566_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173577_2174264_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174260_2175301_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175416_2176088_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019577.1|2176084_2177077_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177073_2178012_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2178008_2179163_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179171_2180623_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180653_2181136_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181137_2182031_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2182027_2182471_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182483_2182858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2183000_2183399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183525_2183813_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183809_2184226_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184401_2185034_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185062_2185509_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185795_2186947_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187060_2188065_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189048_2189756_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_162007583.1|2189688_2191140_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191145_2194304_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194316_2194838_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194827_2195652_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195648_2196248_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196356_2198213_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198361_2199366_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199574_2200837_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200841_2201177_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201173_2202103_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202107_2202821_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202924_2204382_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204378_2204675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204799_2206158_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206258_2207059_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207238_2208357_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208429_2208801_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208807_2209659_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209679_2210291_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043132	Bordetella holmesii strain H641 chromosome, complete genome	3696559	2305420	2426924	3696559	integrase,transposase,tRNA,protease	Leptospira_phage(15.15%)	106	2336950:2337009	2358257:2358531
WP_101557807.1|2305420_2306583_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306695_2307664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307660_2308581_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308677_2313156_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313534_2317869_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318507_2319071_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319082_2319328_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319483_2319993_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320038_2321019_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321230_2323582_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323628_2324459_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324455_2325145_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325137_2326418_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326515_2327454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327435_2329142_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329219_2330323_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330375_2331125_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331131_2332646_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332658_2332946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332966_2333854_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2334004_2334511_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334507_2335464_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335651_2336998_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336950:2337009	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2336965_2337196_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337225_2337789_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337943_2338714_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338710_2339721_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2340035_2340482_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340537_2340732_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340733_2341075_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341084_2342947_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2342986_2343493_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343496_2343820_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343821_2344226_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344262_2345474_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345495_2346044_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346268_2346760_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2346974_2349005_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349079_2350282_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350824_2351760_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352793_2353075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353161_2353335_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353446_2353791_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353862_2354531_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355946_2356990_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2356986_2357088_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357179_2358299_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358549_2359203_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358257:2358531	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359318_2360539_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360589_2363019_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363184_2364483_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364587_2365241_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365243_2366554_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366781_2367321_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367799_2368066_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368104_2368470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368351_2369362_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369358_2370129_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370214_2370874_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370841_2371333_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371442_2371646_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371963_2372284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372267_2372603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372657_2372870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372945_2373284_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2373280_2373616_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373678_2375250_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376043_2376355_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376547_2377668_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377795_2377990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384065_2385227_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385612_2387076_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387208_2388759_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388755_2388905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389070_2390191_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391304_2392162_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392214_2392712_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392832_2394248_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394257_2395442_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395438_2397037_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398219_2398465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398875_2399061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399216_2400128_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400249_2401092_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401294_2402668_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2402977_2404489_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404641_2405373_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405479_2406781_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406788_2407697_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407693_2408287_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408330_2408744_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408740_2409211_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409217_2409823_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411624_2413409_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413405_2414791_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414776_2415739_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415808_2416438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416475_2417684_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417805_2418375_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418506_2420060_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420363_2421584_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2421991_2422894_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422890_2423760_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423756_2424608_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424604_2425429_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425703_2426924_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043132	Bordetella holmesii strain H641 chromosome, complete genome	3696559	2936381	3013440	3696559	integrase,transposase,tRNA	Ralstonia_virus(21.43%)	56	2939236:2939295	2987823:2988393
WP_005019978.1|2936381_2937161_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937183_2938131_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938132_2938333_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938667_2939787_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939236:2939295	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940108_2940825_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940821_2941715_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941878_2943099_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943251_2944334_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2946013_2946997_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947059_2948472_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948589_2949432_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949710_2950319_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950334_2950955_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951020_2951728_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951732_2952455_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952441_2952732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952807_2954028_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954752_2955604_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955655_2956909_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957085_2957874_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2957993_2958908_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959040_2960933_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961118_2962498_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962942_2963239_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967039_2967642_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967775_2968234_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968235_2968835_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968843_2969653_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969687_2970542_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970661_2971249_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971245_2972625_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973129_2973276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2980947_2982288_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982301_2983153_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983164_2984430_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984491_2986396_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988371_2989226_-	hypothetical protein	NA	NA	NA	NA	NA
2987823:2988393	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989218_2990013_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990228_2991179_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991781_2992579_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992618_2993272_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993252_2994317_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994480_2996706_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996951_2998796_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998912_2999785_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_153570268.1|2999831_3001532_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	3.0e-31
WP_005015826.1|3001594_3002794_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002804_3003683_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003789_3004827_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004907_3005312_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005323_3006781_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007423_3008020_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008180_3008639_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009416_3010388_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010509_3010929_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012219_3013440_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
