The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043131	Bordetella holmesii strain H713 chromosome, complete genome	3696535	1095267	1202056	3696535	tRNA,transposase,protease	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095267_1096488_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096575_1097166_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097162_1097465_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097516_1098506_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098626_1099508_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099681_1100536_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100567_1101416_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101543_1102764_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102782_1103349_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103546_1104698_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104836_1105841_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1105997_1106969_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107047_1107836_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107907_1108144_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108152_1109064_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109107_1110979_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111139_1111937_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112168_1112543_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112619_1112943_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113026_1113299_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113313_1113769_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113890_1114727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114723_1116097_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116173_1117130_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117217_1118195_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118319_1119975_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120023_1120488_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120484_1120946_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121171_1122359_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122355_1123660_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123656_1125066_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125259_1126379_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126514_1127534_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127542_1130248_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130387_1131041_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131103_1131466_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132032_1133493_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133755_1134829_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134913_1136134_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137891_1139012_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138985_1140485_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140498_1141602_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141606_1142857_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142853_1144299_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144295_1144610_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144611_1145730_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145912_1147133_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147232_1148099_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148159_1149140_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149286_1150207_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150215_1151328_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151409_1152231_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152306_1152915_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153052_1154429_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154490_1154934_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155000_1155657_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155699_1156819_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156988_1157270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157980_1158769_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158765_1159872_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160546_1161905_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162019_1162217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162234_1163355_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163448_1164003_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164590_1165907_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165919_1166933_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167479_1168430_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168509_1168809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170169_1171828_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171976_1173197_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173314_1174598_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174601_1175543_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175652_1176111_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176491_1177112_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177519_1179940_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180047_1180785_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180831_1182076_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182398_1182671_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183254_1183983_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184004_1184922_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184921_1185431_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185547_1186219_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186328_1187396_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187415_1189260_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189396_1190584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190884_1191670_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191693_1192813_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192917_1194255_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194364_1195306_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195361_1196543_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196701_1196992_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197038_1197707_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197703_1197991_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198367_1199153_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199185_1199920_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200835_1202056_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043131	Bordetella holmesii strain H713 chromosome, complete genome	3696535	1206843	1263249	3696535	tRNA,transposase,protease	Ralstonia_virus(23.08%)	44	NA	NA
WP_005012808.1|1206843_1207794_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207875_1208355_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209566_1210766_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210911_1211289_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211312_1213094_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213102_1213840_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214124_1215684_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215743_1216502_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216598_1217255_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217408_1218173_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218187_1218367_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218392_1219427_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219423_1219837_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219833_1220418_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220770_1222129_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222222_1222801_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222925_1224046_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224118_1225375_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225478_1226684_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226747_1227197_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227329_1227575_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227799_1228114_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233367_1235473_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235526_1237836_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239189_1240857_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240859_1241525_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241657_1245464_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245689_1246835_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246953_1247883_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247879_1248956_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248952_1249759_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249755_1250487_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250863_1252102_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252149_1252488_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252735_1253686_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254004_1254187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254252_1255473_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255566_1256787_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256846_1257110_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257231_1258731_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012868.1|1259151_1259349_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259364_1259724_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259796_1260819_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260831_1263249_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043131	Bordetella holmesii strain H713 chromosome, complete genome	3696535	1586785	1693039	3696535	tRNA,transposase,integrase	Leptospira_phage(14.29%)	100	1644060:1644076	1689726:1689742
WP_005011985.1|1586785_1588006_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588360_1588837_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589095_1589704_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589722_1590394_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590567_1592454_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592481_1593324_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593320_1594664_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594848_1595664_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595729_1597211_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597409_1599482_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599701_1600739_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601925_1602783_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602810_1603587_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604414_1604924_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1606001_1606772_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1606768_1607779_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1607837_1608918_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1609086_1610206_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1610207_1610951_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1610955_1611327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611387_1611633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1611739_1613239_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1613860_1614196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614454_1614586_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614615_1615113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615122_1615497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615587_1616880_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1616996_1617896_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1618047_1618266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1618739_1620365_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620600_1622124_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622095_1622791_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623131_1624193_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624238_1624790_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1624796_1625717_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1625856_1628154_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628209_1629430_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1629688_1630294_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630304_1631465_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631486_1632368_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632664_1633363_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633504_1634227_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634345_1635284_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635314_1636094_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636080_1637304_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1637308_1638856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1638891_1639425_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639668_1640364_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640378_1640510_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640557_1641682_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1641687_1644027_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1644023_1644431_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1644060:1644076	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1644692_1644953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645175_1646126_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646224_1647175_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1647224_1648433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1648654_1649194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1649418_1649823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1649887_1650643_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1650642_1652004_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1652000_1652624_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1652667_1653787_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654439_1655195_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655371_1656166_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656162_1656600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656711_1656864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657284_1658253_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658409_1659417_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659474_1659933_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1660006_1661353_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661370_1661742_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661741_1663211_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663366_1664092_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664105_1666820_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667071_1668436_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668475_1669534_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669561_1670380_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670417_1670696_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671959_1672259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672828_1674232_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674244_1674895_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675036_1676257_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676287_1677364_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677510_1678641_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678827_1680453_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680459_1681275_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681289_1682360_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682411_1683071_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683710_1684873_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684914_1685229_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685212_1685599_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685637_1685904_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686296_1686986_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687085_1687247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687397_1687562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687688_1687925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688114_1688363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688476_1689847_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689726:1689742	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689847_1690588_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691086_1693039_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043131	Bordetella holmesii strain H713 chromosome, complete genome	3696535	1711333	1755260	3696535	tRNA,transposase,integrase,holin	Leptospira_phage(33.33%)	37	1753828:1753842	1760304:1760318
WP_005019367.1|1711333_1714195_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714184_1715150_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715906_1717382_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717386_1717662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1717998_1719118_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1718992_1719241_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719419_1720628_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720624_1722907_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722917_1725299_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725562_1727470_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727484_1728375_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728381_1729515_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729514_1730336_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730360_1731551_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731852_1732134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732299_1732620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732659_1733746_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733942_1734203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734695_1735466_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735462_1736473_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736507_1737350_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737812_1738598_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739457_1740577_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741643_1742648_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742723_1743536_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743763_1745935_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1745988_1747308_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747396_1748617_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748835_1749696_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749692_1750916_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751214_1751712_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751750_1752533_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752558_1752777_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752851_1753121_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753340_1753805_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753828:1753842	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753878_1754160_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754276_1755260_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760304:1760318	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043131	Bordetella holmesii strain H713 chromosome, complete genome	3696535	1780536	1843261	3696535	transposase	Ralstonia_virus(33.33%)	54	NA	NA
WP_005012067.1|1780536_1781487_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781483_1781999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782356_1782977_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783076_1783328_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783415_1784894_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784890_1788061_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788073_1789270_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789458_1790391_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790459_1791191_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791256_1791892_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791877_1793056_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793216_1793765_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793845_1794205_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794252_1795473_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795548_1796670_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796707_1797421_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797431_1798652_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798734_1799289_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013729.1|1800342_1800504_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800544_1801471_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801484_1802357_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802519_1803467_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803805_1804387_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804964_1805915_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805894_1806647_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806659_1807391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807547_1809713_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809802_1810072_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810160_1810367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810365_1810884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810902_1811682_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811849_1812866_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812938_1813430_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813440_1815156_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816319_1817270_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818921_1820163_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820174_1820948_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_003814011.1|1822022_1822805_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003814013.1|1824846_1826232_+	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_005013750.1|1826250_1826856_+	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_005013751.1|1826852_1828709_+	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_005013752.1|1828705_1829506_+	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_005013753.1|1829520_1830714_+	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_005013754.1|1830781_1831756_+	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_005013755.1|1831878_1833102_+	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_005013756.1|1833212_1835417_+	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_005013757.1|1835711_1836341_+	MarC family protein	NA	NA	NA	NA	NA
WP_025341443.1|1836348_1836555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076879523.1|1837795_1838536_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005013759.1|1838519_1839500_+	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.2	5.6e-14
WP_005013761.1|1839642_1840137_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005013762.1|1840138_1841056_+	FecR family protein	NA	NA	NA	NA	NA
WP_005013763.1|1841135_1842320_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005013764.1|1842310_1843261_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043131	Bordetella holmesii strain H713 chromosome, complete genome	3696535	2150137	2210260	3696535	tRNA,transposase,protease	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150137_2150626_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150618_2151467_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151558_2152056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152193_2152553_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152549_2152831_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152830_2153313_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153314_2154943_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154939_2155284_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155285_2158228_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158673_2159645_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159634_2161017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161159_2162110_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162069_2163311_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163307_2164429_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165920_2166388_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166458_2167109_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167195_2168335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168503_2169508_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169504_2170752_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171104_2171971_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171930_2173535_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173546_2174233_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174229_2175270_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175385_2176057_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019577.1|2176053_2177046_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177042_2177981_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2177977_2179132_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179140_2180592_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180622_2181105_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181106_2182000_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2181996_2182440_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182452_2182827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2182969_2183368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183494_2183782_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183778_2184195_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184370_2185003_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185031_2185478_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185764_2186916_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187029_2188034_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189017_2189725_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189657_2191109_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191114_2194273_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194285_2194807_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194796_2195621_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195617_2196217_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196325_2198182_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198330_2199335_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199543_2200806_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200810_2201146_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201142_2202072_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202076_2202790_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202893_2204351_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204347_2204644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204768_2206127_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206227_2207028_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207207_2208326_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208398_2208770_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208776_2209628_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209648_2210260_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043131	Bordetella holmesii strain H713 chromosome, complete genome	3696535	2305388	2426898	3696535	tRNA,transposase,integrase,protease	Leptospira_phage(15.15%)	106	2336918:2336977	2358225:2358499
WP_101557807.1|2305388_2306551_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306663_2307632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307628_2308549_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308645_2313124_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313502_2317837_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318475_2319039_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319050_2319296_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319451_2319961_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320006_2320987_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321198_2323550_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323596_2324427_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324423_2325113_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325105_2326386_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326483_2327422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327403_2329110_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329187_2330291_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330343_2331093_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331099_2332614_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332626_2332914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332934_2333822_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2333972_2334479_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334475_2335432_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335619_2336966_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336918:2336977	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2336933_2337164_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337193_2337757_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337911_2338682_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338678_2339689_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2340003_2340450_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340505_2340700_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340701_2341043_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341052_2342915_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2342954_2343461_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343464_2343788_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343789_2344194_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344230_2345442_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345463_2346012_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346236_2346728_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2346942_2348973_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349047_2350250_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350792_2351728_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352761_2353043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353129_2353303_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353414_2353759_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353830_2354499_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355914_2356958_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2356954_2357056_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357147_2358267_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358517_2359171_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358225:2358499	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359286_2360507_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360557_2362987_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363152_2364451_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364555_2365209_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365211_2366522_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366749_2367289_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367767_2368034_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368072_2368438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368319_2369330_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369326_2370097_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370182_2370842_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370809_2371301_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371410_2371614_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371931_2372252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372235_2372571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372625_2372838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372913_2373252_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2373248_2373584_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373646_2375218_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376011_2376323_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376515_2377636_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377763_2377958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384039_2385201_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385586_2387050_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387182_2388733_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388729_2388879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389044_2390165_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391278_2392136_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392188_2392686_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392806_2394222_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394231_2395416_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395412_2397011_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398193_2398439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398849_2399035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399190_2400102_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400223_2401066_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401268_2402642_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2402951_2404463_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404615_2405347_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405453_2406755_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406762_2407671_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407667_2408261_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408304_2408718_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408714_2409185_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409191_2409797_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411598_2413383_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413379_2414765_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414750_2415713_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415782_2416412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416449_2417658_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417779_2418349_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418480_2420034_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420337_2421558_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2421965_2422868_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422864_2423734_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423730_2424582_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424578_2425403_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425677_2426898_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043131	Bordetella holmesii strain H713 chromosome, complete genome	3696535	2936356	3013416	3696535	tRNA,transposase,integrase	Ralstonia_virus(21.43%)	56	2939211:2939270	2987798:2988368
WP_005019978.1|2936356_2937136_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937158_2938106_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938107_2938308_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938642_2939762_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939211:2939270	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940083_2940800_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940796_2941690_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941853_2943074_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943226_2944309_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2945988_2946972_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947034_2948447_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948564_2949407_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949685_2950294_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950309_2950930_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2950995_2951703_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_153570263.1|2951707_2952430_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	3.3e-11
WP_005015745.1|2952416_2952707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952782_2954003_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954727_2955579_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955630_2956884_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957060_2957849_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2957968_2958883_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959015_2960908_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961093_2962473_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962917_2963214_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967014_2967617_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967750_2968209_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968210_2968810_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968818_2969628_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969662_2970517_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970636_2971224_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971220_2972600_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973104_2973251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2980922_2982263_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982276_2983128_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983139_2984405_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984466_2986371_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988346_2989201_-	hypothetical protein	NA	NA	NA	NA	NA
2987798:2988368	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989193_2989988_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990203_2991154_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991756_2992554_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992593_2993247_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993227_2994292_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994455_2996681_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996926_2998771_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998887_2999760_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999806_3001507_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001569_3002769_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002779_3003658_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003764_3004802_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004882_3005287_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005298_3006756_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007398_3007995_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008155_3008614_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009391_3010363_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010484_3010904_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012195_3013416_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
