The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043128	Bordetella holmesii strain H807 chromosome, complete genome	3695342	1095293	1202082	3695342	transposase,tRNA,protease	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095293_1096514_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096601_1097192_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097188_1097491_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097542_1098532_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098652_1099534_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099707_1100562_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100593_1101442_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101569_1102790_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102808_1103375_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103572_1104724_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104862_1105867_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106023_1106995_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107073_1107862_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107933_1108170_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108178_1109090_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109133_1111005_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111165_1111963_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112194_1112569_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112645_1112969_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113052_1113325_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113339_1113795_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113916_1114753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114749_1116123_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116199_1117156_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117243_1118221_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118345_1120001_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120049_1120514_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120510_1120972_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121197_1122385_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122381_1123686_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123682_1125092_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125285_1126405_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126540_1127560_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127568_1130274_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130413_1131067_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131129_1131492_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132058_1133519_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133781_1134855_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134939_1136160_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137917_1139038_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1139011_1140511_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140524_1141628_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141632_1142883_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142879_1144325_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144321_1144636_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144637_1145756_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145938_1147159_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147258_1148125_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148185_1149166_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149312_1150233_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150241_1151354_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151435_1152257_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152332_1152941_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153078_1154455_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154516_1154960_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155026_1155683_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155725_1156845_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1157014_1157296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1158006_1158795_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158791_1159898_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160572_1161931_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162045_1162243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162260_1163381_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163474_1164029_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164616_1165933_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165945_1166959_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167505_1168456_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168535_1168835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170195_1171854_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1172002_1173223_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173340_1174624_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174627_1175569_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175678_1176137_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176517_1177138_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177545_1179966_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180073_1180811_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180857_1182102_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182424_1182697_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183280_1184009_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184030_1184948_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184947_1185457_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185573_1186245_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186354_1187422_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187441_1189286_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189422_1190610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190910_1191696_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191719_1192839_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192943_1194281_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194390_1195332_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195387_1196569_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196727_1197018_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197064_1197733_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197729_1198017_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198393_1199179_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199211_1199946_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200861_1202082_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043128	Bordetella holmesii strain H807 chromosome, complete genome	3695342	1206869	1263275	3695342	transposase,tRNA,protease	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1206869_1207820_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207901_1208381_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209592_1210792_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210937_1211315_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211338_1213120_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213128_1213866_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214150_1215710_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215769_1216528_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216624_1217281_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217434_1218199_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218213_1218393_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218418_1219453_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219449_1219863_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219859_1220444_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220796_1222155_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222248_1222827_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222951_1224072_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224144_1225401_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225504_1226710_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226773_1227223_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227355_1227601_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227825_1228140_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233393_1235499_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235552_1237862_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239215_1240883_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240885_1241551_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241683_1245490_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245715_1246861_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246979_1247909_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247905_1248982_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248978_1249785_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249781_1250513_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250889_1252128_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252175_1252514_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252761_1253712_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254030_1254213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254278_1255499_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255592_1256813_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256872_1257136_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257257_1258757_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1258804_1259080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259177_1259375_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259390_1259750_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259822_1260845_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260857_1263275_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043128	Bordetella holmesii strain H807 chromosome, complete genome	3695342	1586813	1693067	3695342	transposase,integrase,tRNA	Leptospira_phage(14.29%)	100	1644088:1644104	1689754:1689770
WP_005011985.1|1586813_1588034_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588388_1588865_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589123_1589732_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589750_1590422_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590595_1592482_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592509_1593352_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593348_1594692_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594876_1595692_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595757_1597239_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597437_1599510_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599729_1600767_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601953_1602811_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602838_1603615_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604442_1604952_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1606029_1606800_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1606796_1607807_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1607865_1608946_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1609114_1610234_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1610235_1610979_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1610983_1611355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611415_1611661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1611767_1613267_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1613888_1614224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614482_1614614_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614643_1615141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615150_1615525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615615_1616908_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1617024_1617924_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1618075_1618294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162007579.1|1618767_1620393_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620628_1622152_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622123_1622819_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623159_1624221_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624266_1624818_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1624824_1625745_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1625884_1628182_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628237_1629458_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1629716_1630322_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630332_1631493_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631514_1632396_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632692_1633391_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633532_1634255_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634373_1635312_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635342_1636122_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636108_1637332_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1637336_1638884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1638919_1639453_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639696_1640392_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640406_1640538_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640585_1641710_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1641715_1644055_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1644051_1644459_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1644088:1644104	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1644720_1644981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645203_1646154_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646252_1647203_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1647252_1648461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1648682_1649222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1649446_1649851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1649915_1650671_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1650670_1652032_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1652028_1652652_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1652695_1653815_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654467_1655223_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655399_1656194_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656190_1656628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656739_1656892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657312_1658281_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658437_1659445_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659502_1659961_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1660034_1661381_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661398_1661770_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661769_1663239_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663394_1664120_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664133_1666848_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667099_1668464_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668503_1669562_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669589_1670408_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670445_1670724_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671987_1672287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672856_1674260_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674272_1674923_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675064_1676285_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676315_1677392_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677538_1678669_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678855_1680481_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680487_1681303_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681317_1682388_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682439_1683099_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683738_1684901_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684942_1685257_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685240_1685627_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685665_1685932_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686324_1687014_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687113_1687275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687425_1687590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687716_1687953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688142_1688391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688504_1689875_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689754:1689770	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689875_1690616_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691114_1693067_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043128	Bordetella holmesii strain H807 chromosome, complete genome	3695342	1711309	1755236	3695342	transposase,integrase,holin,tRNA	Leptospira_phage(33.33%)	37	1753804:1753818	1760280:1760294
WP_005019367.1|1711309_1714171_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714160_1715126_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715882_1717358_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717362_1717638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1717974_1719094_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1718968_1719217_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719395_1720604_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720600_1722883_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722893_1725275_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725538_1727446_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727460_1728351_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728357_1729491_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729490_1730312_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730336_1731527_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731828_1732110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732275_1732596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732635_1733722_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733918_1734179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734671_1735442_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735438_1736449_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736483_1737326_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737788_1738574_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739433_1740553_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741619_1742624_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742699_1743512_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743739_1745911_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1745964_1747284_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747372_1748593_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748811_1749672_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749668_1750892_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751190_1751688_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751726_1752509_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752534_1752753_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752827_1753097_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753316_1753781_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753804:1753818	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753854_1754136_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754252_1755236_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760280:1760294	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043128	Bordetella holmesii strain H807 chromosome, complete genome	3695342	1794101	1821776	3695342	transposase	Ralstonia_virus(50.0%)	26	NA	NA
WP_005011985.1|1794101_1795322_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795397_1796519_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796556_1797270_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797280_1798501_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798583_1799138_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799283_1800234_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800193_1800355_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800395_1801322_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801335_1802208_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802370_1803318_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803656_1804238_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804815_1805766_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805745_1806498_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806510_1807242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807398_1809564_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809653_1809923_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810011_1810218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810216_1810735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810753_1811533_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811700_1812717_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812789_1813281_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813291_1815007_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816170_1817121_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818772_1820014_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820025_1820799_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1820825_1821776_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043128	Bordetella holmesii strain H807 chromosome, complete genome	3695342	2148942	2209065	3695342	transposase,protease,tRNA	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2148942_2149431_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2149423_2150272_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2150363_2150861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2150998_2151358_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2151354_2151636_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2151635_2152118_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2152119_2153748_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2153744_2154089_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2154090_2157033_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2157478_2158450_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2158439_2159822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2159964_2160915_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2160874_2162116_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2162112_2163234_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2164725_2165193_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2165263_2165914_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2166000_2167140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2167308_2168313_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2168309_2169557_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2169909_2170776_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2170735_2172340_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2172351_2173038_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2173034_2174075_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2174190_2174862_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2174858_2175851_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2175847_2176786_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2176782_2177937_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2177945_2179397_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2179427_2179910_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2179911_2180805_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2180801_2181245_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2181257_2181632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2181774_2182173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2182299_2182587_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2182583_2183000_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2183175_2183808_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2183836_2184283_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2184569_2185721_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2185834_2186839_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2187822_2188530_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2188462_2189914_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2189919_2193078_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2193090_2193612_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2193601_2194426_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2194422_2195022_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2195130_2196987_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2197135_2198140_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2198348_2199611_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2199615_2199951_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2199947_2200877_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2200881_2201595_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2201698_2203156_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2203152_2203449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2203573_2204932_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2205032_2205833_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2206012_2207131_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2207203_2207575_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2207581_2208433_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2208453_2209065_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043128	Bordetella holmesii strain H807 chromosome, complete genome	3695342	2304188	2425699	3695342	transposase,protease,integrase,tRNA	Leptospira_phage(15.15%)	105	2335718:2335777	2357025:2357299
WP_101557807.1|2304188_2305351_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2305463_2306432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2306428_2307349_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2307445_2311924_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2312302_2316637_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2317275_2317839_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2317850_2318096_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2318251_2318761_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2318806_2319787_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014497.1|2322396_2323227_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2323223_2323913_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2323905_2325186_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2325283_2326222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2326203_2327910_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2327987_2329091_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2329143_2329893_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2329899_2331414_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2331426_2331714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2331734_2332622_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2332772_2333279_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2333275_2334232_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2334419_2335766_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2335718:2335777	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2335733_2335964_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2335993_2336557_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2336711_2337482_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2337478_2338489_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2338803_2339250_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2339305_2339500_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2339501_2339843_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2339852_2341715_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2341754_2342261_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2342264_2342588_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2342589_2342994_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2343030_2344242_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2344263_2344812_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2345036_2345528_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2345742_2347773_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2347847_2349050_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2349592_2350528_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2351561_2351843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2351929_2352103_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2352214_2352559_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2352630_2353299_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2354714_2355758_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2355754_2355856_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2355947_2357067_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2357317_2357971_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2357025:2357299	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2358086_2359307_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2359357_2361787_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2361952_2363251_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2363355_2364009_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2364011_2365322_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2365549_2366089_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2366567_2366834_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2366872_2367238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2367119_2368130_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2368126_2368897_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2368982_2369642_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2369609_2370101_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2370210_2370414_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2370731_2371052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2371035_2371371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2371425_2371638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2371713_2372052_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2372048_2372384_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2372446_2374018_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2374811_2375123_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2375315_2376436_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2376563_2376758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2382840_2384002_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2384387_2385851_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2385983_2387534_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2387530_2387680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2387845_2388966_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2390079_2390937_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2390989_2391487_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2391607_2393023_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2393032_2394217_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2394213_2395812_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2396994_2397240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2397650_2397836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2397991_2398903_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2399024_2399867_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2400069_2401443_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2401752_2403264_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2403416_2404148_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2404254_2405556_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2405563_2406472_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2406468_2407062_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2407105_2407519_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2407515_2407986_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2407992_2408598_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2410399_2412184_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2412180_2413566_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2413551_2414514_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2414583_2415213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2415250_2416459_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2416580_2417150_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2417281_2418835_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2419138_2420359_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2420766_2421669_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2421665_2422535_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2422531_2423383_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2423379_2424204_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2424478_2425699_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043128	Bordetella holmesii strain H807 chromosome, complete genome	3695342	2935158	3012218	3695342	transposase,integrase,tRNA	Ralstonia_virus(21.43%)	56	2938013:2938072	2986600:2987170
WP_005019978.1|2935158_2935938_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2935960_2936908_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2936909_2937110_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2937444_2938564_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2938013:2938072	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2938885_2939602_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2939598_2940492_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2940655_2941876_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2942028_2943111_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2944790_2945774_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2945836_2947249_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2947366_2948209_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2948487_2949096_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2949111_2949732_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2949797_2950505_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2950509_2951232_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2951218_2951509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2951584_2952805_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2953529_2954381_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2954432_2955686_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2955862_2956651_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2956770_2957685_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2957817_2959710_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2959895_2961275_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2961719_2962016_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2965816_2966419_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2966552_2967011_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2967012_2967612_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2967620_2968430_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2968464_2969319_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2969438_2970026_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2970022_2971402_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2971906_2972053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2979724_2981065_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2981078_2981930_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2981941_2983207_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2983268_2985173_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2987148_2988003_-	hypothetical protein	NA	NA	NA	NA	NA
2986600:2987170	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2987995_2988790_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2989005_2989956_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2990558_2991356_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2991395_2992049_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2992029_2993094_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2993257_2995483_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2995728_2997573_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2997689_2998562_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2998608_3000309_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3000371_3001571_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3001581_3002460_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3002566_3003604_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3003684_3004089_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3004100_3005558_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3006200_3006797_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3006957_3007416_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3008193_3009165_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3009286_3009706_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3010997_3012218_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
