The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043127	Bordetella holmesii strain H808 chromosome, complete genome	3697555	608967	677071	3697555	tRNA,transposase	Ralstonia_virus(38.46%)	59	NA	NA
WP_005012861.1|608967_610188_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005018628.1|610664_611120_-	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_005018629.1|612087_613656_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_005018630.1|613878_614316_+	universal stress protein	NA	NA	NA	NA	NA
WP_005018631.1|614327_614738_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_005018632.1|614768_615542_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_005018633.1|615769_617872_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_005018634.1|618380_619229_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005018635.1|619248_619464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005018636.1|619618_620515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341328.1|620618_621509_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_005018638.1|621585_622554_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005018639.1|622554_623265_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_005018645.1|623340_625434_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005018647.1|625959_626745_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_005018648.1|626803_628216_-	transglycosylase SLT domain-containing protein	NA	A0A223LD43	Bacillus_phage	29.3	2.1e-06
WP_005018649.1|628223_629033_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005018650.1|629050_629815_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005018651.1|629883_630345_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	51.5	4.5e-38
WP_005018652.1|630469_631552_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005018653.1|631567_631765_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005012861.1|631727_632948_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005018655.1|635957_636692_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.6e-40
WP_005011985.1|636860_638081_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005020417.1|638455_639442_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005020418.1|639445_642169_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	6.6e-20
WP_005018662.1|642169_643297_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005018670.1|644897_645554_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005018673.1|645574_646621_+	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	39.5	1.4e-58
WP_005018676.1|646617_648207_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_005018678.1|648142_648652_-	GtrA family protein	NA	NA	NA	NA	NA
WP_017685335.1|648577_649471_+	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_005018681.1|649460_650357_-	alpha/beta fold hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	33.1	6.5e-09
WP_005020419.1|650403_651036_-	LysE family translocator	NA	NA	NA	NA	NA
WP_005018686.1|651060_651945_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005018689.1|652072_653554_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005018691.1|653626_653971_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_005018693.1|654056_654521_+	universal stress protein	NA	NA	NA	NA	NA
WP_005018697.1|655686_657801_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.1	6.0e-61
WP_005018699.1|657833_658631_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005013747.1|658842_659793_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005018702.1|659825_660272_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_005018704.1|660320_661010_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_005018707.1|661097_661592_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_005018709.1|661623_662940_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_005018710.1|662956_663877_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_005018713.1|663911_664373_-	protein TolR	NA	NA	NA	NA	NA
WP_005018715.1|664372_665047_-	protein TolQ	NA	NA	NA	NA	NA
WP_005018717.1|665049_665472_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005018720.1|665525_667256_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	28.6	1.2e-11
WP_005018723.1|667321_667891_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005018726.1|667871_668558_+	response regulator	NA	NA	NA	NA	NA
WP_005018729.1|668577_670083_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005018732.1|670311_670761_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_005018735.1|670766_672287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|672340_673561_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005018738.1|673657_674587_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005018740.1|674745_675651_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005011985.1|675850_677071_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043127	Bordetella holmesii strain H808 chromosome, complete genome	3697555	1095276	1202065	3697555	protease,tRNA,transposase	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095276_1096497_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096584_1097175_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097171_1097474_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097525_1098515_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098635_1099517_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099690_1100545_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100576_1101425_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101552_1102773_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102791_1103358_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103555_1104707_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104845_1105850_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106006_1106978_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107056_1107845_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107916_1108153_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108161_1109073_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109116_1110988_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111148_1111946_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112177_1112552_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112628_1112952_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113035_1113308_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113322_1113778_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113899_1114736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114732_1116106_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116182_1117139_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117226_1118204_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118328_1119984_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120032_1120497_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120493_1120955_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121180_1122368_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122364_1123669_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123665_1125075_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125268_1126388_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126523_1127543_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127551_1130257_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130396_1131050_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131112_1131475_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132041_1133502_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133764_1134838_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005011985.1|1134922_1136143_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_101557770.1|1137900_1139021_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138994_1140494_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140507_1141611_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141615_1142866_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142862_1144308_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144304_1144619_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144620_1145739_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145921_1147142_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147241_1148108_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148168_1149149_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149295_1150216_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150224_1151337_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151418_1152240_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152315_1152924_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153061_1154438_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154499_1154943_+	cytochrome c	NA	NA	NA	NA	NA
WP_080687428.1|1155009_1155666_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155708_1156828_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156997_1157279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157989_1158778_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158774_1159881_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160555_1161914_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162028_1162226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162243_1163364_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163457_1164012_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164599_1165916_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165928_1166942_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167488_1168439_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168518_1168818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170178_1171837_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171985_1173206_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173323_1174607_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174610_1175552_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175661_1176120_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176500_1177121_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177528_1179949_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180056_1180794_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180840_1182085_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182407_1182680_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183263_1183992_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184013_1184931_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184930_1185440_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185556_1186228_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186337_1187405_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187424_1189269_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189405_1190593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190893_1191679_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191702_1192822_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192926_1194264_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194373_1195315_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195370_1196552_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196710_1197001_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197047_1197716_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197712_1198000_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198376_1199162_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199194_1199929_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200844_1202065_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 3
NZ_CP043127	Bordetella holmesii strain H808 chromosome, complete genome	3697555	1206852	1263258	3697555	protease,tRNA,transposase	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1206852_1207803_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207884_1208364_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209575_1210775_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210920_1211298_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211321_1213103_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213111_1213849_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214133_1215693_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215752_1216511_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216607_1217264_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217417_1218182_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218196_1218376_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218401_1219436_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219432_1219846_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219842_1220427_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220779_1222138_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222231_1222810_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222934_1224055_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224127_1225384_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225487_1226693_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226756_1227206_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227338_1227584_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227808_1228123_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233376_1235482_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235535_1237845_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239198_1240866_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240868_1241534_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241666_1245473_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245698_1246844_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246962_1247892_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247888_1248965_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248961_1249768_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249764_1250496_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250872_1252111_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252158_1252497_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252744_1253695_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254013_1254196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254261_1255482_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255575_1256796_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256855_1257119_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257240_1258740_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1258787_1259063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259160_1259358_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259373_1259733_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259805_1260828_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260840_1263258_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043127	Bordetella holmesii strain H808 chromosome, complete genome	3697555	1586796	1647190	3697555	transposase	Ralstonia_virus(10.0%)	54	NA	NA
WP_005011985.1|1586796_1588017_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588371_1588848_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589106_1589715_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589733_1590405_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590579_1592466_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592493_1593336_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593332_1594676_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594860_1595676_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595741_1597223_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597421_1599494_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599713_1600751_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601937_1602795_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602822_1603599_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604426_1604936_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1606013_1606784_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1606780_1607791_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1607849_1608930_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_080601033.1|1610221_1610965_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1610969_1611341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611401_1611647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1611753_1613253_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1613874_1614210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614468_1614600_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614629_1615127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615136_1615511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615601_1616894_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1617010_1617910_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1618061_1618280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1618753_1620379_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620614_1622138_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622109_1622805_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623146_1624208_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624253_1624805_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1624811_1625732_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1625871_1628169_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628224_1629445_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1629703_1630309_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630319_1631480_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631501_1632383_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632679_1633378_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633519_1634242_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634360_1635299_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635329_1636109_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636095_1637319_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_033903441.1|1637323_1638871_+	protoheme IX synthesis protein	NA	NA	NA	NA	NA
WP_005013580.1|1638906_1639440_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639683_1640379_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640393_1640525_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640572_1641697_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1641702_1644042_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1644038_1644446_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_005013586.1|1644707_1644968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645190_1646141_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646239_1647190_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP043127	Bordetella holmesii strain H808 chromosome, complete genome	3697555	1652682	1693055	3697555	tRNA,integrase,transposase	Leptospira_phage(28.57%)	39	1644075:1644091	1689741:1689757
1644075:1644091	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|1652682_1653802_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654454_1655210_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655386_1656181_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656177_1656615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656726_1656879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657299_1658268_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658424_1659432_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659489_1659948_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1660021_1661368_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661385_1661757_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661756_1663226_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663381_1664107_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664120_1666835_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667086_1668451_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668490_1669549_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669576_1670395_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670432_1670711_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671974_1672274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672843_1674247_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674259_1674910_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675051_1676272_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676302_1677379_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677525_1678656_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678842_1680468_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680474_1681290_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681304_1682375_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682426_1683086_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683725_1684888_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684929_1685244_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685227_1685614_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685652_1685919_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686311_1687001_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687100_1687262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687412_1687577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687703_1687940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688129_1688378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688491_1689862_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689741:1689757	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689862_1690603_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691102_1693055_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 6
NZ_CP043127	Bordetella holmesii strain H808 chromosome, complete genome	3697555	1711349	1755276	3697555	tRNA,integrase,holin,transposase	Leptospira_phage(33.33%)	37	1753844:1753858	1760320:1760334
WP_033903449.1|1711349_1714211_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	7.8e-72
WP_005013657.1|1714200_1715166_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715922_1717398_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717402_1717678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1718014_1719134_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1719008_1719257_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719435_1720644_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720640_1722923_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722933_1725315_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725578_1727486_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727500_1728391_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728397_1729531_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729530_1730352_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730376_1731567_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731868_1732150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732315_1732636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732675_1733762_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733958_1734219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734711_1735482_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735478_1736489_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736523_1737366_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737828_1738614_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739473_1740593_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741659_1742664_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742739_1743552_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743779_1745951_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1746004_1747324_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747412_1748633_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748851_1749712_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749708_1750932_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751230_1751728_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751766_1752549_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752574_1752793_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752867_1753137_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753356_1753821_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753844:1753858	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753894_1754176_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754292_1755276_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760320:1760334	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 7
NZ_CP043127	Bordetella holmesii strain H808 chromosome, complete genome	3697555	2150156	2210279	3697555	protease,tRNA,transposase	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150156_2150645_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150637_2151486_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151577_2152075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152212_2152572_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152568_2152850_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152849_2153332_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153333_2154962_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154958_2155303_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155304_2158247_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158692_2159664_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159653_2161036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161178_2162129_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162088_2163330_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163326_2164448_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165939_2166407_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166477_2167128_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167214_2168354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168522_2169527_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169523_2170771_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171123_2171990_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171949_2173554_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173565_2174252_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174248_2175289_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175404_2176076_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2176072_2177065_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177061_2178000_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2177996_2179151_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179159_2180611_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180641_2181124_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181125_2182019_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2182015_2182459_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182471_2182846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2182988_2183387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183513_2183801_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183797_2184214_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184389_2185022_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185050_2185497_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185783_2186935_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187048_2188053_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189036_2189744_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189676_2191128_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191133_2194292_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194304_2194826_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194815_2195640_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195636_2196236_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196344_2198201_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198349_2199354_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199562_2200825_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200829_2201165_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201161_2202091_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202095_2202809_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202912_2204370_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204366_2204663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204787_2206146_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206246_2207047_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207226_2208345_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208417_2208789_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208795_2209647_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209667_2210279_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043127	Bordetella holmesii strain H808 chromosome, complete genome	3697555	2305400	2426910	3697555	protease,tRNA,integrase,transposase	Leptospira_phage(12.5%)	104	2336930:2336989	2358237:2358511
WP_101557807.1|2305400_2306563_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306675_2307644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307640_2308561_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_005019672.1|2313514_2317849_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318487_2319051_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319062_2319308_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319463_2319973_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320018_2320999_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321210_2323562_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323608_2324439_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324435_2325125_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325117_2326398_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326495_2327434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327415_2329122_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329199_2330303_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330355_2331105_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331111_2332626_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332638_2332926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332946_2333834_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2333984_2334491_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334487_2335444_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335631_2336978_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336930:2336989	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2336945_2337176_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337205_2337769_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337923_2338694_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338690_2339701_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2340015_2340462_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340517_2340712_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340713_2341055_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341064_2342927_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2342966_2343473_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343476_2343800_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343801_2344206_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344242_2345454_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345475_2346024_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346248_2346740_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2346954_2348985_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349059_2350262_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350804_2351740_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352773_2353055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353141_2353315_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353426_2353771_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353842_2354511_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355926_2356970_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2356966_2357068_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357159_2358279_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358529_2359183_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358237:2358511	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359298_2360519_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360569_2362999_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363164_2364463_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364567_2365221_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365223_2366534_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366761_2367301_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367779_2368046_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368084_2368450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368331_2369342_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369338_2370109_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370194_2370854_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370821_2371313_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371422_2371626_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371943_2372264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372247_2372583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372637_2372850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372925_2373264_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_017685558.1|2373251_2373596_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373658_2375230_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376024_2376336_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376528_2377649_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377776_2377971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384049_2385211_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385596_2387060_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387192_2388743_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388739_2388889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014703.1|2391290_2392148_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392200_2392698_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392818_2394234_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394243_2395428_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395424_2397023_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398205_2398451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398861_2399047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399202_2400114_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400235_2401078_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401280_2402654_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2402963_2404475_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404627_2405359_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405465_2406767_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406774_2407683_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407679_2408273_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408316_2408730_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408726_2409197_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409203_2409809_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411610_2413395_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413391_2414777_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414762_2415725_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415794_2416424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416461_2417670_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417791_2418361_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418492_2420046_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420349_2421570_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2421977_2422880_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422876_2423746_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423742_2424594_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424590_2425415_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425689_2426910_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043127	Bordetella holmesii strain H808 chromosome, complete genome	3697555	2937418	3014477	3697555	tRNA,integrase,transposase	Ralstonia_virus(21.43%)	56	2940273:2940332	2988859:2989429
WP_005019978.1|2937418_2938198_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2938220_2939168_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2939169_2939370_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2939704_2940824_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2940273:2940332	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2941145_2941862_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2941858_2942752_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2942915_2944136_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2944288_2945371_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2947050_2948034_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2948096_2949509_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2949626_2950469_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2950747_2951356_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2951371_2951992_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2952057_2952765_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2952769_2953492_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2953478_2953769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2953844_2955065_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2955789_2956641_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2956692_2957946_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2958122_2958911_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2959030_2959945_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2960077_2961970_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2962155_2963535_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2963979_2964276_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2968076_2968679_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2968812_2969271_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2969272_2969872_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2969880_2970690_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2970724_2971579_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2971698_2972286_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2972282_2973662_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2974166_2974313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2981983_2983324_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2983337_2984189_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2984200_2985466_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2985527_2987432_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2989407_2990262_-	hypothetical protein	NA	NA	NA	NA	NA
2988859:2989429	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2990254_2991049_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2991264_2992215_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2992817_2993615_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2993654_2994308_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2994288_2995353_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2995516_2997742_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2997987_2999832_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2999948_3000821_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|3000867_3002568_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3002630_3003830_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3003840_3004719_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3004825_3005863_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3005943_3006348_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3006359_3007817_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3008459_3009056_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3009216_3009675_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3010452_3011424_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3011545_3011965_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3013256_3014477_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
