The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043124	Bordetella holmesii strain H863 chromosome, complete genome	3696532	1095295	1202084	3696532	tRNA,transposase,protease	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095295_1096516_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096603_1097194_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097190_1097493_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097544_1098534_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098654_1099536_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099709_1100564_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100595_1101444_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_153570626.1|1101571_1102792_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.6	2.5e-181
WP_005012619.1|1102810_1103377_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103574_1104726_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104864_1105869_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106025_1106997_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107075_1107864_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107935_1108172_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108180_1109092_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109135_1111007_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111167_1111965_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112196_1112571_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112647_1112971_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113054_1113327_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113341_1113797_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113918_1114755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114751_1116125_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116201_1117158_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117245_1118223_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118347_1120003_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120051_1120516_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120512_1120974_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121199_1122387_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122383_1123688_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123684_1125094_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125287_1126407_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126542_1127562_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127570_1130276_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130415_1131069_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131131_1131494_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132060_1133521_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133783_1134857_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134941_1136162_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137919_1139040_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1139013_1140513_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140526_1141630_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141634_1142885_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142881_1144327_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144323_1144638_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144639_1145758_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145940_1147161_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147260_1148127_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148187_1149168_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149314_1150235_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150243_1151356_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151437_1152259_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152334_1152943_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153080_1154457_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154518_1154962_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155028_1155685_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155727_1156847_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1157016_1157298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1158008_1158797_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158793_1159900_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160574_1161933_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162047_1162245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162262_1163383_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163476_1164031_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164618_1165935_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165947_1166961_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167507_1168458_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168537_1168837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170197_1171856_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1172004_1173225_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173342_1174626_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174629_1175571_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175680_1176139_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176519_1177140_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177547_1179968_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180075_1180813_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180859_1182104_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182426_1182699_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183282_1184011_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184032_1184950_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184949_1185459_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185575_1186247_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186356_1187424_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187443_1189288_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189424_1190612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190912_1191698_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191721_1192841_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192945_1194283_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194392_1195334_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195389_1196571_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196729_1197020_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197066_1197735_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197731_1198019_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198395_1199181_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199213_1199948_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200863_1202084_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043124	Bordetella holmesii strain H863 chromosome, complete genome	3696532	1206871	1263277	3696532	tRNA,transposase,protease	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1206871_1207822_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207903_1208383_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209594_1210794_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210939_1211317_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211340_1213122_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213130_1213868_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214152_1215712_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215771_1216530_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216626_1217283_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217436_1218201_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218215_1218395_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218420_1219455_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219451_1219865_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219861_1220446_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220798_1222157_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222250_1222829_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222953_1224074_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224146_1225403_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225506_1226712_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226775_1227225_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227357_1227603_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227827_1228142_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233395_1235501_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235554_1237864_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239217_1240885_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240887_1241553_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241685_1245492_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245717_1246863_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246981_1247911_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247907_1248984_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248980_1249787_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249783_1250515_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250891_1252130_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252177_1252516_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252763_1253714_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254032_1254215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254280_1255501_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255594_1256815_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256874_1257138_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257259_1258759_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1258806_1259082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259179_1259377_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259392_1259752_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259824_1260847_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260859_1263277_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043124	Bordetella holmesii strain H863 chromosome, complete genome	3696532	1652657	1693030	3696532	tRNA,transposase,integrase	Leptospira_phage(28.57%)	39	1644051:1644067	1689716:1689732
1644051:1644067	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|1652657_1653777_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654429_1655185_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655361_1656156_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656152_1656590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656701_1656854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657274_1658243_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658399_1659407_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659464_1659923_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1659996_1661343_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661360_1661732_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661731_1663201_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663356_1664082_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664095_1666810_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667061_1668426_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668465_1669524_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669551_1670370_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670407_1670686_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671949_1672249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672818_1674222_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674234_1674885_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675026_1676247_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676277_1677354_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677500_1678631_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678817_1680443_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680449_1681265_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681279_1682350_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682401_1683061_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683700_1684863_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684904_1685219_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685202_1685589_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685627_1685894_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686286_1686976_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687075_1687237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687387_1687552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687678_1687915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688104_1688353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688466_1689837_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689716:1689732	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689837_1690578_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691077_1693030_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 5
NZ_CP043124	Bordetella holmesii strain H863 chromosome, complete genome	3696532	1711324	1755251	3696532	tRNA,transposase,integrase,holin	Leptospira_phage(33.33%)	37	1753819:1753833	1760295:1760309
WP_005019367.1|1711324_1714186_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714175_1715141_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715897_1717373_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717377_1717653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1717989_1719109_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1718983_1719232_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719410_1720619_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720615_1722898_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722908_1725290_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725553_1727461_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727475_1728366_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728372_1729506_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729505_1730327_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730351_1731542_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731843_1732125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732290_1732611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732650_1733737_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733933_1734194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734686_1735457_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735453_1736464_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736498_1737341_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737803_1738589_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739448_1740568_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741634_1742639_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742714_1743527_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743754_1745926_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1745979_1747299_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747387_1748608_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748826_1749687_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749683_1750907_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751205_1751703_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751741_1752524_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752549_1752768_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752842_1753112_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753331_1753796_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753819:1753833	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753869_1754151_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754267_1755251_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760295:1760309	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP043124	Bordetella holmesii strain H863 chromosome, complete genome	3696532	1780527	1821918	3696532	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780527_1781478_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781474_1781990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782347_1782968_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783067_1783319_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783406_1784885_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784881_1788052_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788064_1789261_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789449_1790382_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790450_1791182_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791247_1791883_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791868_1793047_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793207_1793756_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793836_1794196_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794243_1795464_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795539_1796661_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796698_1797412_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797422_1798643_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798725_1799280_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799425_1800376_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800335_1800497_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800537_1801464_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801477_1802350_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802512_1803460_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803798_1804380_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804957_1805908_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805887_1806640_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806652_1807384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807540_1809706_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809795_1810065_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810153_1810360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810358_1810877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810895_1811675_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811842_1812859_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812931_1813423_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813433_1815149_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816312_1817263_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818914_1820156_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820167_1820941_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1820967_1821918_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043124	Bordetella holmesii strain H863 chromosome, complete genome	3696532	2150132	2210255	3696532	tRNA,transposase,protease	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150132_2150621_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150613_2151462_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151553_2152051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152188_2152548_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152544_2152826_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152825_2153308_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153309_2154938_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154934_2155279_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155280_2158223_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158668_2159640_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159629_2161012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161154_2162105_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162064_2163306_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163302_2164424_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165915_2166383_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166453_2167104_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167190_2168330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168498_2169503_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169499_2170747_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171099_2171966_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171925_2173530_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173541_2174228_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174224_2175265_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175380_2176052_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2176048_2177041_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177037_2177976_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2177972_2179127_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179135_2180587_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180617_2181100_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181101_2181995_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2181991_2182435_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182447_2182822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2182964_2183363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183489_2183777_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183773_2184190_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184365_2184998_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185026_2185473_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185759_2186911_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187024_2188029_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189012_2189720_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189652_2191104_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191109_2194268_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194280_2194802_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194791_2195616_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195612_2196212_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196320_2198177_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198325_2199330_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199538_2200801_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200805_2201141_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201137_2202067_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202071_2202785_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202888_2204346_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204342_2204639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204763_2206122_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206222_2207023_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207202_2208321_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208393_2208765_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208771_2209623_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209643_2210255_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043124	Bordetella holmesii strain H863 chromosome, complete genome	3696532	2305378	2426888	3696532	tRNA,transposase,integrase,protease	Leptospira_phage(15.15%)	106	2336908:2336967	2358215:2358489
WP_101557807.1|2305378_2306541_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306653_2307622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307618_2308539_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308635_2313114_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313492_2317827_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318465_2319029_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319040_2319286_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319441_2319951_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2319996_2320977_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321188_2323540_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323586_2324417_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324413_2325103_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325095_2326376_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326473_2327412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327393_2329100_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329177_2330281_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330333_2331083_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331089_2332604_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332616_2332904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332924_2333812_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2333962_2334469_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334465_2335422_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335609_2336956_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336908:2336967	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2336923_2337154_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337183_2337747_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337901_2338672_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338668_2339679_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2339993_2340440_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340495_2340690_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340691_2341033_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341042_2342905_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2342944_2343451_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343454_2343778_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343779_2344184_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344220_2345432_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345453_2346002_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346226_2346718_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2346932_2348963_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349037_2350240_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350782_2351718_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352751_2353033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353119_2353293_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353404_2353749_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353820_2354489_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355904_2356948_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2356944_2357046_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357137_2358257_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358507_2359161_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358215:2358489	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359276_2360497_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360547_2362977_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363142_2364441_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364545_2365199_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365201_2366512_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366739_2367279_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367757_2368024_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368062_2368428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368309_2369320_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369316_2370087_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370172_2370832_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370799_2371291_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371400_2371604_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371921_2372242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372225_2372561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372615_2372828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372903_2373242_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_017685558.1|2373229_2373574_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373636_2375208_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376001_2376313_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376505_2377626_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377753_2377948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384029_2385191_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385576_2387040_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387172_2388723_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388719_2388869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389034_2390155_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391268_2392126_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392178_2392676_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392796_2394212_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394221_2395406_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395402_2397001_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398183_2398429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398839_2399025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399180_2400092_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400213_2401056_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401258_2402632_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2402941_2404453_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404605_2405337_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405443_2406745_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406752_2407661_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407657_2408251_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408294_2408708_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408704_2409175_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409181_2409787_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411588_2413373_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413369_2414755_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414740_2415703_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415772_2416402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416439_2417648_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417769_2418339_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418470_2420024_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420327_2421548_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2421955_2422858_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422854_2423724_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423720_2424572_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424568_2425393_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425667_2426888_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043124	Bordetella holmesii strain H863 chromosome, complete genome	3696532	2936347	3013407	3696532	tRNA,transposase,integrase	Ralstonia_virus(21.43%)	56	2939202:2939261	2987789:2988359
WP_005019978.1|2936347_2937127_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937149_2938097_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938098_2938299_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938633_2939753_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939202:2939261	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940074_2940791_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940787_2941681_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941844_2943065_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943217_2944300_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2945979_2946963_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947025_2948438_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948555_2949398_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949676_2950285_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950300_2950921_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2950986_2951694_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951698_2952421_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952407_2952698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952773_2953994_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954718_2955570_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955621_2956875_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957051_2957840_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2957959_2958874_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959006_2960899_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961084_2962464_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962908_2963205_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967005_2967608_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967741_2968200_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968201_2968801_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968809_2969619_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969653_2970508_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970627_2971215_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971211_2972591_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973095_2973242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2980913_2982254_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982267_2983119_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983130_2984396_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984457_2986362_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988337_2989192_-	hypothetical protein	NA	NA	NA	NA	NA
2987789:2988359	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989184_2989979_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990194_2991145_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991747_2992545_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992584_2993238_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993218_2994283_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994446_2996672_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996917_2998762_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998878_2999751_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999797_3001498_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001560_3002760_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002770_3003649_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003755_3004793_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004873_3005278_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005289_3006747_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007389_3007986_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008146_3008605_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009382_3010354_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010475_3010895_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012186_3013407_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
