The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043123	Bordetella holmesii strain H869 chromosome, complete genome	3696547	1095268	1202057	3696547	tRNA,transposase,protease	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095268_1096489_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096576_1097167_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097163_1097466_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097517_1098507_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098627_1099509_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099682_1100537_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100568_1101417_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101544_1102765_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102783_1103350_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103547_1104699_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104837_1105842_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1105998_1106970_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107048_1107837_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107908_1108145_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108153_1109065_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109108_1110980_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111140_1111938_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112169_1112544_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112620_1112944_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113027_1113300_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113314_1113770_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113891_1114728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114724_1116098_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116174_1117131_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117218_1118196_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118320_1119976_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120024_1120489_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120485_1120947_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121172_1122360_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122356_1123661_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123657_1125067_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125260_1126380_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126515_1127535_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127543_1130249_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130388_1131042_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131104_1131467_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132033_1133494_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133756_1134830_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134914_1136135_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137892_1139013_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138986_1140486_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140499_1141603_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141607_1142858_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142854_1144300_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144296_1144611_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144612_1145731_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145913_1147134_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147233_1148100_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148160_1149141_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149287_1150208_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150216_1151329_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151410_1152232_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152307_1152916_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153053_1154430_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154491_1154935_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155001_1155658_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155700_1156820_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156989_1157271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157981_1158770_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158766_1159873_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160547_1161906_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162020_1162218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162235_1163356_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163449_1164004_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164591_1165908_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165920_1166934_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167480_1168431_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168510_1168810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170170_1171829_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171977_1173198_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173315_1174599_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174602_1175544_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175653_1176112_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176492_1177113_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177520_1179941_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180048_1180786_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180832_1182077_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182399_1182672_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183255_1183984_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184005_1184923_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184922_1185432_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185548_1186220_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186329_1187397_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187416_1189261_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189397_1190585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190885_1191671_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191694_1192814_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192918_1194256_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194365_1195307_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195362_1196544_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196702_1196993_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197039_1197708_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197704_1197992_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198368_1199154_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199186_1199921_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200836_1202057_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043123	Bordetella holmesii strain H869 chromosome, complete genome	3696547	1206844	1263250	3696547	tRNA,transposase,protease	Ralstonia_virus(23.08%)	44	NA	NA
WP_005012808.1|1206844_1207795_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207876_1208356_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209567_1210767_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210912_1211290_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211313_1213095_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213103_1213841_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214125_1215685_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215744_1216503_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216599_1217256_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217409_1218174_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218188_1218368_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218393_1219428_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219424_1219838_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219834_1220419_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220771_1222130_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222223_1222802_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222926_1224047_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224119_1225376_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225479_1226685_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226748_1227198_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227330_1227576_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227800_1228115_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233368_1235474_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235527_1237837_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239190_1240858_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240860_1241526_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241658_1245465_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245690_1246836_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246954_1247884_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247880_1248957_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248953_1249760_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249756_1250488_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250864_1252103_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252150_1252489_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252736_1253687_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254005_1254188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254253_1255474_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255567_1256788_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256847_1257111_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257232_1258732_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012868.1|1259152_1259350_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259365_1259725_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259797_1260820_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260832_1263250_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043123	Bordetella holmesii strain H869 chromosome, complete genome	3696547	1586788	1693044	3696547	transposase,integrase,tRNA	Leptospira_phage(14.29%)	100	1644063:1644079	1689729:1689745
WP_005011985.1|1586788_1588009_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588363_1588840_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589098_1589707_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589725_1590397_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590570_1592457_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592484_1593327_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593323_1594667_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594851_1595667_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595732_1597214_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597412_1599485_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599704_1600742_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601928_1602786_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602813_1603590_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604417_1604927_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1606004_1606775_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1606771_1607782_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1607840_1608921_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1609089_1610209_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1610210_1610954_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1610958_1611330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611390_1611636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1611742_1613242_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1613863_1614199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614457_1614589_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614618_1615116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615125_1615500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615590_1616883_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1616999_1617899_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1618050_1618269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1618742_1620368_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620603_1622127_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622098_1622794_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623134_1624196_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624241_1624793_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1624799_1625720_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1625859_1628157_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628212_1629433_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1629691_1630297_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630307_1631468_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631489_1632371_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632667_1633366_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633507_1634230_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634348_1635287_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635317_1636097_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636083_1637307_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1637311_1638859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1638894_1639428_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639671_1640367_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640381_1640513_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640560_1641685_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1641690_1644030_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1644026_1644434_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1644063:1644079	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1644695_1644956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645178_1646129_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646227_1647178_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1647227_1648436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1648657_1649197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1649421_1649826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1649890_1650646_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1650645_1652007_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1652003_1652627_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1652670_1653790_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654442_1655198_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655374_1656169_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656165_1656603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656714_1656867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657287_1658256_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658412_1659420_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659477_1659936_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1660009_1661356_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661373_1661745_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661744_1663214_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663369_1664095_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664108_1666823_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667074_1668439_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668478_1669537_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669564_1670383_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670420_1670699_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671962_1672262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672831_1674235_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674247_1674898_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675039_1676260_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676290_1677367_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677513_1678644_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678830_1680456_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680462_1681278_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681292_1682363_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682414_1683074_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683713_1684876_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684917_1685232_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685215_1685602_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685640_1685907_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686299_1686989_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687088_1687250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687400_1687565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687691_1687928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688117_1688366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688479_1689850_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689729:1689745	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689850_1690591_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691091_1693044_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043123	Bordetella holmesii strain H869 chromosome, complete genome	3696547	1711338	1755265	3696547	transposase,tRNA,integrase,holin	Leptospira_phage(33.33%)	37	1753833:1753847	1760309:1760323
WP_005019367.1|1711338_1714200_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714189_1715155_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715911_1717387_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717391_1717667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557815.1|1718003_1719123_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_161992024.1|1718997_1719246_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719424_1720633_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720629_1722912_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722922_1725304_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725567_1727475_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727489_1728380_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728386_1729520_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729519_1730341_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730365_1731556_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731857_1732139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732304_1732625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732664_1733751_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733947_1734208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734700_1735471_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735467_1736478_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736512_1737355_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737817_1738603_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739462_1740582_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741648_1742653_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742728_1743541_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743768_1745940_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1745993_1747313_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747401_1748622_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748840_1749701_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749697_1750921_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751219_1751717_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751755_1752538_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752563_1752782_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752856_1753126_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753345_1753810_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753833:1753847	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753883_1754165_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754281_1755265_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760309:1760323	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043123	Bordetella holmesii strain H869 chromosome, complete genome	3696547	1780541	1821932	3696547	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780541_1781492_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781488_1782004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782361_1782982_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783081_1783333_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783420_1784899_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784895_1788066_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788078_1789275_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789463_1790396_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790464_1791196_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791261_1791897_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791882_1793061_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793221_1793770_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793850_1794210_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794257_1795478_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795553_1796675_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796712_1797426_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797436_1798657_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798739_1799294_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799439_1800390_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800349_1800511_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800551_1801478_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801491_1802364_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802526_1803474_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803812_1804394_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804971_1805922_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805901_1806654_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806666_1807398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807554_1809720_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809809_1810079_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810167_1810374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810372_1810891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810909_1811689_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811856_1812873_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812945_1813437_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813447_1815163_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816326_1817277_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818928_1820170_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820181_1820955_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1820981_1821932_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043123	Bordetella holmesii strain H869 chromosome, complete genome	3696547	2150146	2210269	3696547	transposase,tRNA,protease	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150146_2150635_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150627_2151476_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151567_2152065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152202_2152562_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152558_2152840_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152839_2153322_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153323_2154952_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154948_2155293_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155294_2158237_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158682_2159654_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159643_2161026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161168_2162119_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162078_2163320_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163316_2164438_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165929_2166397_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166467_2167118_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167204_2168344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168512_2169517_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169513_2170761_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171113_2171980_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171939_2173544_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173555_2174242_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174238_2175279_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175394_2176066_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2176062_2177055_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177051_2177990_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2177986_2179141_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179149_2180601_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180631_2181114_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181115_2182009_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2182005_2182449_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182461_2182836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2182978_2183377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183503_2183791_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183787_2184204_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184379_2185012_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185040_2185487_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185773_2186925_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187038_2188043_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189026_2189734_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189666_2191118_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191123_2194282_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194294_2194816_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194805_2195630_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195626_2196226_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196334_2198191_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198339_2199344_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199552_2200815_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200819_2201155_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201151_2202081_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202085_2202799_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202902_2204360_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204356_2204653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204777_2206136_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206236_2207037_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207216_2208335_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208407_2208779_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208785_2209637_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209657_2210269_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043123	Bordetella holmesii strain H869 chromosome, complete genome	3696547	2305393	2426903	3696547	transposase,integrase,protease,tRNA	Leptospira_phage(12.5%)	105	2336923:2336982	2358230:2358504
WP_101557807.1|2305393_2306556_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306668_2307637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307633_2308554_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308650_2313129_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313507_2317842_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318480_2319044_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319055_2319301_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319456_2319966_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320011_2320992_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321203_2323555_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323601_2324432_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324428_2325118_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325110_2326391_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326488_2327427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327408_2329115_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329192_2330296_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330348_2331098_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331104_2332619_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332631_2332919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332939_2333827_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2333977_2334484_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334480_2335437_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335624_2336971_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336923:2336982	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2336938_2337169_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337198_2337762_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337916_2338687_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338683_2339694_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2340008_2340455_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340510_2340705_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340706_2341048_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341057_2342920_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2342959_2343466_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343469_2343793_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343794_2344199_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344235_2345447_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345468_2346017_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346241_2346733_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2346947_2348978_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349052_2350255_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350797_2351733_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352766_2353048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353134_2353308_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353419_2353764_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353835_2354504_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355919_2356963_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2356959_2357061_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357152_2358272_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358522_2359176_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358230:2358504	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359291_2360512_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360562_2362992_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363157_2364456_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364560_2365214_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365216_2366527_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366754_2367294_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367772_2368039_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368077_2368443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368324_2369335_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369331_2370102_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370187_2370847_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370814_2371306_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371415_2371619_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371936_2372257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372240_2372576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372630_2372843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372918_2373257_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2373253_2373589_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373651_2375223_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376016_2376328_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_005011899.1|2377767_2377962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384044_2385206_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385591_2387055_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387187_2388738_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388734_2388884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389049_2390170_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391283_2392141_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392193_2392691_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392811_2394227_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394236_2395421_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395417_2397016_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398198_2398444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398854_2399040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399195_2400107_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400228_2401071_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401273_2402647_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2402956_2404468_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404620_2405352_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405458_2406760_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406767_2407676_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407672_2408266_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408309_2408723_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408719_2409190_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409196_2409802_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411603_2413388_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413384_2414770_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414755_2415718_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415787_2416417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416454_2417663_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417784_2418354_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418485_2420039_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420342_2421563_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2421970_2422873_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422869_2423739_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423735_2424587_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424583_2425408_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425682_2426903_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043123	Bordetella holmesii strain H869 chromosome, complete genome	3696547	2936363	3013423	3696547	transposase,tRNA,integrase	Ralstonia_virus(21.43%)	56	2939218:2939277	2987805:2988375
WP_005019978.1|2936363_2937143_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937165_2938113_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938114_2938315_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938649_2939769_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939218:2939277	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940090_2940807_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940803_2941697_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941860_2943081_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943233_2944316_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2945995_2946979_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947041_2948454_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948571_2949414_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949692_2950301_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950316_2950937_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951002_2951710_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951714_2952437_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952423_2952714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952789_2954010_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954734_2955586_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955637_2956891_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957067_2957856_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2957975_2958890_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959022_2960915_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961100_2962480_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962924_2963221_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967021_2967624_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967757_2968216_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968217_2968817_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968825_2969635_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969669_2970524_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970643_2971231_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971227_2972607_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973111_2973258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2980929_2982270_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982283_2983135_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983146_2984412_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984473_2986378_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988353_2989208_-	hypothetical protein	NA	NA	NA	NA	NA
2987805:2988375	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989200_2989995_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990210_2991161_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991763_2992561_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992600_2993254_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993234_2994299_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994462_2996688_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996933_2998778_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998894_2999767_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999813_3001514_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001576_3002776_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002786_3003665_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003771_3004809_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004889_3005294_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005305_3006763_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007405_3008002_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008162_3008621_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009398_3010370_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010491_3010911_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012202_3013423_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
